ID: 1151570872

View in Genome Browser
Species Human (GRCh38)
Location 17:74924674-74924696
Sequence GGCGCCGCGTGCGGGCCCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 147}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151570862_1151570872 -6 Left 1151570862 17:74924657-74924679 CCCAAGGAGAGCCCCCCGGCGCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1151570872 17:74924674-74924696 GGCGCCGCGTGCGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 147
1151570861_1151570872 -5 Left 1151570861 17:74924656-74924678 CCCCAAGGAGAGCCCCCCGGCGC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1151570872 17:74924674-74924696 GGCGCCGCGTGCGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 147
1151570852_1151570872 23 Left 1151570852 17:74924628-74924650 CCGCCATGTCCGAGGAGCTGGCC 0: 1
1: 0
2: 0
3: 7
4: 153
Right 1151570872 17:74924674-74924696 GGCGCCGCGTGCGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 147
1151570859_1151570872 1 Left 1151570859 17:74924650-74924672 CCAGGGCCCCAAGGAGAGCCCCC 0: 1
1: 0
2: 1
3: 35
4: 579
Right 1151570872 17:74924674-74924696 GGCGCCGCGTGCGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 147
1151570863_1151570872 -7 Left 1151570863 17:74924658-74924680 CCAAGGAGAGCCCCCCGGCGCCG 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1151570872 17:74924674-74924696 GGCGCCGCGTGCGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 147
1151570858_1151570872 2 Left 1151570858 17:74924649-74924671 CCCAGGGCCCCAAGGAGAGCCCC 0: 1
1: 2
2: 4
3: 20
4: 296
Right 1151570872 17:74924674-74924696 GGCGCCGCGTGCGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 147
1151570850_1151570872 26 Left 1151570850 17:74924625-74924647 CCTCCGCCATGTCCGAGGAGCTG 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1151570872 17:74924674-74924696 GGCGCCGCGTGCGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 147
1151570853_1151570872 20 Left 1151570853 17:74924631-74924653 CCATGTCCGAGGAGCTGGCCCAG 0: 1
1: 0
2: 0
3: 17
4: 201
Right 1151570872 17:74924674-74924696 GGCGCCGCGTGCGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 147
1151570856_1151570872 14 Left 1151570856 17:74924637-74924659 CCGAGGAGCTGGCCCAGGGCCCC 0: 1
1: 0
2: 5
3: 74
4: 634
Right 1151570872 17:74924674-74924696 GGCGCCGCGTGCGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151570872 Original CRISPR GGCGCCGCGTGCGGGCCCCA GGG Exonic