ID: 1151571046

View in Genome Browser
Species Human (GRCh38)
Location 17:74925464-74925486
Sequence GGACAGGCCCTGAGGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 453}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151571046_1151571051 -10 Left 1151571046 17:74925464-74925486 CCTCCCATCCTCAGGGCCTGTCC 0: 1
1: 0
2: 4
3: 48
4: 453
Right 1151571051 17:74925477-74925499 GGGCCTGTCCTCAGCTCGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151571046 Original CRISPR GGACAGGCCCTGAGGATGGG AGG (reversed) Intronic
900044883 1:497912-497934 GCACATGCCTCGAGGATGGGAGG + Intergenic
900066684 1:736226-736248 GCACATGCCTCGAGGATGGGAGG + Intergenic
900067079 1:739642-739664 GCACATGCCTCGAGGATGGGAGG + Intergenic
900343229 1:2198573-2198595 TGACGGGCCCTGAGGCTGGCAGG + Intronic
900407598 1:2499347-2499369 AGACAGGAGCTGAGGACGGGAGG + Intronic
900416948 1:2539744-2539766 AGACAAACCCTGAGGATGGCGGG + Intergenic
900432076 1:2607199-2607221 GTAAAGGCCCAGAGGCTGGGAGG - Intronic
900488154 1:2933221-2933243 GGAGAGGCCCTGGGGGTGGGCGG + Intergenic
900651552 1:3732477-3732499 GGCCCTGCCCTGAGGCTGGGAGG + Intronic
900941548 1:5801818-5801840 GACCAGGCCTTGAGGGTGGGGGG - Intergenic
901000822 1:6147998-6148020 TGGAAGGCCCTGGGGATGGGAGG - Intronic
901006479 1:6174069-6174091 GGAGAGGCCCAGGGCATGGGTGG + Intronic
901190629 1:7407835-7407857 GGACAGTCCCCCAGGAAGGGAGG + Intronic
901634234 1:10663254-10663276 GGACTGGGCCTGGGGAGGGGAGG + Intronic
901830479 1:11889035-11889057 GGACAGGCCCTCAGGTTGCAGGG - Intergenic
901841109 1:11954776-11954798 GGACAGGCCCTGGGGGAGGCTGG - Intronic
902283046 1:15388332-15388354 GGGCAGGGCCTGGGGAGGGGAGG - Intronic
902323191 1:15683171-15683193 GGTGAGGCACTGAGGAGGGGAGG + Intergenic
904162505 1:28532018-28532040 GGACAAGGCCTGGGGTTGGGTGG + Intronic
904577024 1:31511476-31511498 GGAGAGGCCCTGCTGAAGGGAGG - Intergenic
904609264 1:31716010-31716032 GGATAGGACCTGGAGATGGGGGG - Intergenic
904753173 1:32753901-32753923 GGGCGGGCCCGGAGGAGGGGCGG - Intronic
905791404 1:40791592-40791614 GGGCAGCGCCTGAGGAAGGGAGG + Intronic
905802876 1:40856623-40856645 GGACAGGCCCTGGATATGGTGGG + Intergenic
906109824 1:43315147-43315169 AGACAGGACCTGCGGATGGGCGG - Intronic
906150055 1:43582503-43582525 GGCCAGGCTCTGAGGAGGGCAGG - Intronic
906378650 1:45317362-45317384 GGACTGGATGTGAGGATGGGAGG - Intergenic
906673812 1:47678750-47678772 GGGCAGGCCCTGAGGAGGGAAGG + Intergenic
907422556 1:54357075-54357097 GGAAAGGCCCCTAGGAAGGGAGG + Intronic
907451213 1:54547151-54547173 CGAGAGGCCCTGAGGATGGAAGG + Intronic
907715470 1:56922229-56922251 GCAAAGGTCCTGAGGAGGGGAGG - Intergenic
907812008 1:57880178-57880200 AGAGAGGTCCTGAGGCTGGGAGG - Intronic
911064989 1:93780053-93780075 AAGCAGGCCCTGAGGGTGGGAGG - Intronic
912436297 1:109663866-109663888 GGACAGTCCCTGAGCATAGCAGG + Intronic
912438308 1:109677971-109677993 GGACAGTCCCTGAGCATAGTAGG + Intronic
913644557 1:120844400-120844422 GGGCGGGCCCTGAGGATGCAAGG - Intergenic
914095273 1:144539784-144539806 GGGTGGGCTCTGAGGATGGGAGG - Intergenic
914098927 1:144567649-144567671 GGGCGGGCCCTGAGGATGCAAGG - Intergenic
914177081 1:145287683-145287705 GGGCGGGCCCTGAGGATGCAAGG + Intergenic
914303250 1:146394112-146394134 GGGTGGGCTCTGAGGATGGGAGG + Intergenic
914479005 1:148048650-148048672 GGACAAGCCCTGAGGCTGGAAGG - Intergenic
914531808 1:148529174-148529196 GGGCGGGCCCTGAGGATGCAAGG + Intergenic
914636584 1:149558554-149558576 GGGCGGGCCCTGAGGATGCAAGG - Intergenic
915146022 1:153796190-153796212 GGACAGACCTAGAGGATGGGGGG - Intergenic
915665072 1:157436978-157437000 GGACAGGCACCGTGGGTGGGAGG + Intergenic
915678161 1:157551266-157551288 GGCCAGGTCCTGAGCATGAGAGG - Intronic
916253731 1:162765118-162765140 GGAGAATCCCTGAGGATGGGTGG - Intronic
916416761 1:164599571-164599593 GGACTGTCCCTCAGGAGGGGAGG + Intronic
918151243 1:181799544-181799566 TGACAGGCCTCAAGGATGGGGGG - Intronic
919821233 1:201473494-201473516 GCAAAGGCCCTGAGGAAGGATGG - Intergenic
922101402 1:222480168-222480190 GCACATGCCTCGAGGATGGGAGG + Intergenic
922943056 1:229485289-229485311 GGACAGGTCCTGAGGATTTGAGG + Intronic
923770117 1:236930932-236930954 GGAAAGCCTATGAGGATGGGAGG + Intergenic
924199035 1:241640442-241640464 GGACAGGCCGCGGGGAGGGGCGG - Intronic
924344323 1:243060280-243060302 GCACATGCCTCGAGGATGGGAGG + Intergenic
924583940 1:245345496-245345518 GGAAAGGCGCTGAGGGTGTGGGG - Intronic
924787810 1:247216502-247216524 AGACTGGCCCTGAGAAAGGGAGG + Intergenic
1063124166 10:3125029-3125051 GCACAGGCCCTGGGGCTGGCAGG + Intronic
1063463627 10:6229602-6229624 ACACTGGCCCTGAGGATGGAGGG - Intronic
1067469914 10:46528608-46528630 GGGCAGGCTCTGAGCTTGGGCGG - Intergenic
1069823217 10:71240081-71240103 GGAGAGACCGTGAGGGTGGGTGG - Intronic
1070667503 10:78355791-78355813 GCACATGCTCTGAGTATGGGGGG + Intergenic
1071362777 10:84866679-84866701 GGACAGCCCCTAAGGGTGTGGGG + Intergenic
1071571482 10:86699739-86699761 GGCCAGGAGCTGAGGATGGTGGG - Intronic
1072011350 10:91305488-91305510 AGACAGGGTCTGAGGAGGGGAGG + Intergenic
1072305507 10:94102776-94102798 GGATAGCCCCTGGGAATGGGTGG - Intronic
1072614965 10:97043203-97043225 GGACCGGCTCTGAGGACCGGAGG + Intronic
1072661570 10:97366686-97366708 GGGCAGGCCCTTGGGTTGGGGGG + Intronic
1072665300 10:97388413-97388435 GGACAGGGCCTGCGGTAGGGCGG - Intronic
1072724752 10:97805649-97805671 GGAGAGGCCTTCAGGGTGGGTGG - Intergenic
1072892942 10:99341217-99341239 GCAAAGGCCCTGAGGAAGGAGGG + Intronic
1073192949 10:101665045-101665067 GAACAGACCCTGAGGCTGGGAGG + Intronic
1074018954 10:109564075-109564097 GGACAGGGTGTGAGGAGGGGAGG - Intergenic
1075216426 10:120540208-120540230 GGACAGGCCCTGGGGAGAGCTGG - Intronic
1075792938 10:125098494-125098516 GGCCAGGACCTGGGGATGAGCGG + Intronic
1076324965 10:129614039-129614061 TGAGGGGCTCTGAGGATGGGTGG - Intronic
1076488397 10:130839357-130839379 GCAAAGGCCCTGAGGAGGGGGGG - Intergenic
1076570844 10:131431998-131432020 GGACAGGAGCTGGGGCTGGGAGG + Intergenic
1076795308 10:132795296-132795318 GCACGTGCCCTGAGGCTGGGTGG + Intergenic
1076835453 10:133018706-133018728 GGACAGCCCCTGGGCCTGGGAGG - Intergenic
1076971210 11:134403-134425 GCACATGCCTCGAGGATGGGAGG + Intergenic
1077037614 11:502924-502946 GCACAGGCCCTGAATATGGAAGG + Exonic
1077524851 11:3057780-3057802 GAGCAGGGCCTGGGGATGGGCGG + Intergenic
1077631776 11:3816154-3816176 GGGCAGGCCCTGAGGAGCAGGGG + Intronic
1079003956 11:16779629-16779651 GGCCAGGCTCTGAGGAGGTGTGG - Intronic
1079307270 11:19334271-19334293 GGACTGGCCTTGGGGATGGAGGG + Intergenic
1080268618 11:30426797-30426819 AGACAGGCCCTGAGGCCAGGAGG + Intronic
1080826313 11:35852120-35852142 GGACTGGCTCCGAGGTTGGGTGG - Intergenic
1081736715 11:45409525-45409547 GGACAGGCCCTGAGCAGGAGAGG - Intergenic
1083594878 11:63914438-63914460 AGACAGGCCCGGCGGCTGGGGGG - Exonic
1083725348 11:64625173-64625195 GGACAGGCCCTGTTGGGGGGTGG - Intronic
1083779612 11:64911053-64911075 GGACAGGCCCTCTGGAAGCGTGG + Exonic
1083991327 11:66247489-66247511 GCAAAGGCCCTGAGGCTGAGTGG - Intergenic
1084066784 11:66708860-66708882 GGGCCTGCCCTGAGGGTGGGTGG + Intronic
1084353983 11:68624607-68624629 GGACAGGGTGTGAGGAGGGGAGG - Intergenic
1084430533 11:69108307-69108329 ACAAAGGCCCTGAGGCTGGGAGG - Intergenic
1084947471 11:72646251-72646273 AGACAGGGCCTGAGGTTGAGTGG - Intronic
1085257607 11:75184830-75184852 GGGGAGGCTCTGAGGATGAGAGG - Intronic
1085678564 11:78549106-78549128 GGACTGGGGCTGAGGAAGGGAGG - Intronic
1086860863 11:91923384-91923406 GGAGAGAAGCTGAGGATGGGAGG - Intergenic
1087165057 11:94994767-94994789 GGGCAGGACCTGGGGTTGGGTGG + Intronic
1088676197 11:112195961-112195983 GCACAGGCTCTCATGATGGGTGG - Intronic
1089985398 11:122808115-122808137 TGACAGGCCCTGAAGTTGGCAGG - Exonic
1090332583 11:125943258-125943280 GCACAGGCCCTGAGCAGGAGGGG + Intergenic
1090829967 11:130414503-130414525 GGACAGCCCCTGAGGATAGCGGG - Intronic
1090833332 11:130435625-130435647 AGAGAGACCCTGAGGATGAGGGG - Intergenic
1091293966 11:134459594-134459616 GGGCAGGCCCTGAGGAGGGCCGG - Intergenic
1091460600 12:641441-641463 GGAGAGGCCATGAGGATGGGAGG + Intronic
1091650609 12:2306320-2306342 GATCAGGCCCTGAGGGTGGAAGG - Intronic
1092396878 12:8134675-8134697 GGCCAGGCTCTGAGGAGTGGGGG - Intronic
1092543913 12:9437027-9437049 AGACAGGCCCGGAGGCTGAGCGG - Intergenic
1093213473 12:16334985-16335007 GGACAAGCCCTGAGGAGGTCCGG + Intergenic
1094470531 12:30797290-30797312 GGACTGGCCATGAGGCTGGCAGG - Intergenic
1094509033 12:31085024-31085046 AGACAGGCCCGGAGGCTGAGCGG + Exonic
1096070998 12:48775523-48775545 GGACAGCACCTGAGGGAGGGAGG + Intronic
1096214820 12:49793072-49793094 GGAGGGGCCCTGAGTAAGGGTGG - Intronic
1096462060 12:51827251-51827273 GGAAAGGCCCTGAGGACATGGGG + Intergenic
1097196155 12:57243408-57243430 GGAGAGGGCCTGCGGAGGGGTGG - Intergenic
1097224569 12:57469739-57469761 GGACCTGCCCTGAGGTTGAGAGG + Intronic
1098041998 12:66361900-66361922 CCACAGGCCCCGAGGGTGGGTGG - Intronic
1098818256 12:75195871-75195893 AGACAGTCCCTGAGGTTGGCTGG - Intronic
1101155790 12:101926192-101926214 GAACTGGCCTTGAGGATGGTGGG - Intronic
1101431349 12:104630171-104630193 GGACAGGACCTGGGGATGTGAGG - Intronic
1101805062 12:108056425-108056447 AGACAGGCATTGAGGATGGATGG - Intergenic
1102985302 12:117272889-117272911 GCAAAGGCCCTGAGGGTAGGAGG - Intronic
1103935623 12:124475011-124475033 ACAGAGGCCCTGAGGATGGCAGG - Intronic
1104389558 12:128379931-128379953 GGATAGTCCGTGAGTATGGGTGG + Intronic
1104754725 12:131261921-131261943 AAACAGGCCCCGTGGATGGGCGG - Intergenic
1104888255 12:132124770-132124792 GCACAGGCCCAGAGGATGAGGGG + Intronic
1105296308 13:19090313-19090335 GGACAGGCCAACAGGAAGGGAGG + Intergenic
1105441384 13:20418006-20418028 GGACAGGCCATCAGGAGGGCAGG + Intronic
1105538521 13:21293141-21293163 GAACAGGCCATGAAGGTGGGTGG - Intergenic
1105601390 13:21891707-21891729 TGGCAGGCCCCGAGGATGGAAGG - Intergenic
1105891436 13:24685204-24685226 GTAGCAGCCCTGAGGATGGGAGG - Intronic
1106007822 13:25787716-25787738 GGAGAGGCCCTGAGGCAGAGAGG - Intronic
1106171713 13:27294388-27294410 GGACAGGGACTGAGGGTGAGAGG - Intergenic
1106467758 13:30027957-30027979 GCACAGGCTCTGAGAATGGTGGG + Intergenic
1111581630 13:90230564-90230586 GGCCTGGCCATGAGGATGGCGGG + Intergenic
1113108800 13:106799772-106799794 TGCCAGGCCCTGCGGTTGGGGGG + Intergenic
1113618225 13:111695867-111695889 GGAGAGGGCCTGGGGCTGGGCGG - Intergenic
1113623756 13:111781128-111781150 GGAGAGGGCCTGGGGCTGGGCGG - Intergenic
1113777907 13:112959255-112959277 GGAGAGACCCGGAGGACGGGGGG - Intronic
1113942710 13:114026709-114026731 GCACAGGCCCTGGAGATGTGAGG - Intronic
1114406977 14:22466029-22466051 GGACAAGCCGTGAGGACAGGAGG - Intergenic
1114875752 14:26715941-26715963 ACAAAGGCCCTGAGGATGCGGGG - Intergenic
1115554348 14:34532560-34532582 GGAAAAGCCCTGAGGAGGGGAGG + Intronic
1115834582 14:37385529-37385551 GCACAGGCCTTCAGGATGGCTGG + Intronic
1117724524 14:58659924-58659946 AGATATGCCCTGAGAATGGGTGG - Intergenic
1119112413 14:71987321-71987343 AGACTGGCAGTGAGGATGGGAGG + Intronic
1120078578 14:80188417-80188439 GGACAGGCCCAGAGGAAGGAAGG - Intergenic
1120758622 14:88266714-88266736 GGCAAGCCCCTGAGGCTGGGAGG - Intronic
1121397290 14:93637278-93637300 GGACAGCCATTGAGGATGAGAGG + Exonic
1121874081 14:97435021-97435043 AGACAGGTGCTGAGGATGGTGGG + Intergenic
1122421972 14:101583427-101583449 AGACAGCACCTGAGCATGGGGGG - Intergenic
1122772547 14:104103812-104103834 GGACAGGGCCTGGGGCTGGTGGG - Intronic
1122969105 14:105145260-105145282 GGGTCCGCCCTGAGGATGGGCGG - Intronic
1124090945 15:26599392-26599414 GGCCAGGCCCTGAGTTTAGGTGG - Intronic
1124342893 15:28901441-28901463 GGACAGGCCCATAGGAAGAGGGG - Intronic
1124883049 15:33659919-33659941 GGGCAGGGCCTGGGGGTGGGGGG - Intronic
1125541341 15:40471473-40471495 GGACAGGCCCCCAGGCTTGGGGG - Exonic
1125767573 15:42145703-42145725 GGCCAGGCCCTGACGTGGGGTGG - Intronic
1125828090 15:42692733-42692755 CCACAGGCCCTGATGATGGATGG + Exonic
1126175609 15:45732803-45732825 GGCCAGCCCCAGAGGCTGGGAGG + Intergenic
1126598582 15:50406131-50406153 GGAAAGGCCCTGGGGAAGGAGGG + Intergenic
1127897903 15:63318638-63318660 GGACTCGCCCTGTGGGTGGGAGG - Intergenic
1128312411 15:66639498-66639520 GGACAGCTCCAGAGGATCGGGGG + Intronic
1128446300 15:67764306-67764328 AGACAGCACCTGAGGGTGGGAGG - Intronic
1128868822 15:71136796-71136818 GGTCAGGCCCTGAGGAGAAGGGG + Intronic
1129024781 15:72560611-72560633 GCACAGCCTCTGAGGAAGGGTGG + Intronic
1129262593 15:74377128-74377150 GGAAAGGCCGTGGGGCTGGGAGG - Intergenic
1129929698 15:79400124-79400146 GCAAAGGCCCTGAGGTTGGGAGG - Intronic
1130398074 15:83522015-83522037 GAACAGGCACTGAGAAAGGGAGG + Intronic
1131838122 15:96410050-96410072 GGAAAGACCCGGAGGCTGGGAGG - Intergenic
1132004654 15:98216092-98216114 GGACAGGTGATGAGGATTGGTGG - Intergenic
1132333182 15:101026478-101026500 GGACAGACCCTGGGGAGGGAGGG + Intronic
1132352589 15:101149079-101149101 GGTCAGGCCCTGAGGGCTGGAGG - Intergenic
1132599209 16:766553-766575 GGACAAAGCCTGAGGTTGGGCGG + Intronic
1132679775 16:1134948-1134970 GGACGGGCCCTGAAATTGGGAGG - Intergenic
1132680975 16:1141627-1141649 GGACAGGCCTTGTGGATGATGGG - Intergenic
1132797521 16:1732595-1732617 GGACTTGCCCTGAGAACGGGCGG + Intronic
1132833990 16:1943308-1943330 GGACCAGCCCTGAGGAGGGGCGG - Exonic
1132858048 16:2056252-2056274 GGGCCGGCCCTGGGGAGGGGAGG - Intronic
1132880688 16:2160534-2160556 GGGCAGGCGGTGTGGATGGGCGG + Intronic
1133147193 16:3797125-3797147 AGGCAGGCACTGAGGATGGAGGG + Intronic
1134742684 16:16561807-16561829 GGACAGATCCAGAGGGTGGGGGG - Intergenic
1134924875 16:18150657-18150679 GGACAGATCCAGAGGGTGGGGGG + Intergenic
1136044177 16:27602349-27602371 GGACAGACCCTGAGGCTGCCAGG - Intronic
1137674160 16:50295795-50295817 TGCCAGGCCCTGAGTCTGGGTGG + Intronic
1138514140 16:57526665-57526687 AGACAGGCCTTGGAGATGGGCGG - Intronic
1138547313 16:57727607-57727629 CTACAGCCCCTGGGGATGGGGGG - Intronic
1139106729 16:63835433-63835455 GGACAAGCCTTGGGGATGGACGG - Intergenic
1139315447 16:66063936-66063958 GCACAGCCTCTGAGTATGGGAGG + Intergenic
1139506718 16:67401722-67401744 GGCCAGGCCCTGAACATGGCAGG - Intronic
1139922102 16:70467028-70467050 GGGCAGGCCCAGAGGCAGGGTGG - Intronic
1139923049 16:70471458-70471480 GGACAGGCTGTGAGGAGGGTCGG + Intronic
1139965169 16:70741343-70741365 TGCCAGGCACTGAGGATGTGTGG - Intronic
1140376519 16:74449329-74449351 CCACAGGCCTGGAGGATGGGAGG + Intergenic
1140697284 16:77547645-77547667 GGCCTGTCCCTGAGGGTGGGGGG - Intergenic
1141641266 16:85342953-85342975 GCACAGGCTCTGAAGATAGGAGG + Intergenic
1142178725 16:88656900-88656922 GGACAGGCTCTGACAGTGGGTGG + Intronic
1142225507 16:88875341-88875363 GGGCAGGGCTGGAGGATGGGAGG + Exonic
1142458448 17:72170-72192 GCACATGCCTCGAGGATGGGAGG + Intergenic
1144666653 17:17106664-17106686 GGTCAGTCTCAGAGGATGGGTGG + Intronic
1144707322 17:17378153-17378175 GGACAGGCCCTGGGGACCAGTGG - Intergenic
1144773324 17:17771442-17771464 GCAGTGGCTCTGAGGATGGGAGG + Intronic
1146063129 17:29617412-29617434 GGGCATGCCCTGCGGGTGGGGGG + Intronic
1146293516 17:31630417-31630439 GGACAGGCATGGAGAATGGGGGG - Intergenic
1146619431 17:34386088-34386110 GGGCAGGGACTGAGGATGGGTGG + Intergenic
1147795106 17:43036643-43036665 GGCCAGGCTCTGAGGATTTGAGG - Intergenic
1148031955 17:44627914-44627936 GGGCAGGCTCTGTGGGTGGGTGG - Intergenic
1149628256 17:58095947-58095969 GGGCAGGCCGTGTGGAAGGGAGG + Intergenic
1149989427 17:61373549-61373571 GGAAAGGGCCTGAGGAGAGGAGG - Intronic
1150569954 17:66376767-66376789 GGAGAGGGGGTGAGGATGGGTGG + Intronic
1151255192 17:72871415-72871437 GGAAAGCCCTTAAGGATGGGGGG + Intronic
1151409100 17:73909285-73909307 GGACCGAGCCTGAGGAGGGGAGG + Intergenic
1151508685 17:74545079-74545101 GAACAGGGACTGAGGGTGGGAGG + Intronic
1151571046 17:74925464-74925486 GGACAGGCCCTGAGGATGGGAGG - Intronic
1152335998 17:79700533-79700555 GGACAGGGCCTGGGGAGCGGGGG + Intergenic
1152772418 17:82178496-82178518 GTGCAGGCCCTGAGGATGCATGG - Exonic
1152794365 17:82299598-82299620 GGCCAGGCTCTGAGGCTGCGAGG + Intergenic
1152857492 17:82674247-82674269 GGAGAGTCACTGAGGCTGGGAGG + Intronic
1153527178 18:6008479-6008501 GGAGAGGCTGTGATGATGGGAGG + Intronic
1155067038 18:22276669-22276691 GGACAGGCCCAGCGGTTGGGAGG + Intergenic
1155250854 18:23951863-23951885 GGTCAGGCACTGTGGATGGAGGG - Intronic
1156457488 18:37302930-37302952 GGCCAGGCACAGAGGAGGGGTGG + Intronic
1157277648 18:46323180-46323202 AGTCAGTCCCTGAGGCTGGGTGG - Intergenic
1158486288 18:57868949-57868971 GGAAAGCCCATGAGGATGTGAGG + Intergenic
1158749597 18:60243580-60243602 GCACAGACCCTGAGGAGGTGAGG - Intergenic
1159099027 18:63937848-63937870 GGACAGGACCTGGGGATTGTTGG - Intergenic
1160292743 18:77609218-77609240 GGTCAGGTCCTGAGCCTGGGCGG - Intergenic
1161250369 19:3276661-3276683 GGACGGGCCCTGAAGAGGGGCGG + Intronic
1161680620 19:5678041-5678063 GGACAGGAGCTGAGGAGGGCAGG + Intronic
1161719282 19:5894295-5894317 GGACAGGCCCAGAGAAAGGATGG + Intronic
1161829084 19:6589897-6589919 GGAGAGGCCCAGAGAAAGGGAGG - Intronic
1161853282 19:6750071-6750093 GGAAAGACCCTGGGGAGGGGCGG + Intronic
1162026241 19:7895546-7895568 AGAGAGACCCTCAGGATGGGAGG - Intronic
1162722879 19:12672936-12672958 GGACAGGCAGGGAAGATGGGGGG + Intronic
1163441264 19:17323741-17323763 GGACGGGCCCTGGGGCTGCGGGG - Exonic
1163565658 19:18049656-18049678 GGACAGGCCCCTAGAATGGGAGG + Intergenic
1164590104 19:29502028-29502050 GGAGAGGCCGAGAGGATGGGGGG - Intergenic
1164681072 19:30134066-30134088 GGACAGGCCGTGAGGGGAGGTGG + Intergenic
1164700116 19:30279038-30279060 GCAAAGGCCCTGAGGTTGGATGG - Intronic
1165142268 19:33706877-33706899 GGACAGGCCATGATTGTGGGAGG + Intronic
1165426750 19:35750136-35750158 GGACAGGCCATGGGGTTGGTGGG + Intronic
1165488832 19:36111536-36111558 GGACAGGTCCCGAGGCTGGAGGG - Intronic
1165971858 19:39638447-39638469 GGAAAAGACCTGAGGATGAGAGG - Intergenic
1166053265 19:40273845-40273867 GGAGAGGTCCTGAGCAGGGGAGG - Intronic
1166205214 19:41264888-41264910 GGAGACGACCTGAGGATCGGGGG + Intronic
1166629841 19:44396643-44396665 GGGCAGCCCCTCAGGAAGGGTGG - Intronic
1166637614 19:44464775-44464797 GGGCAGCCCCTCAGGAAGGGTGG + Intergenic
1166729552 19:45051184-45051206 TGAACGGCCCGGAGGATGGGAGG + Intronic
1166995145 19:46716510-46716532 GGAGGGGACCTGAGGATGGCGGG + Exonic
1167148275 19:47695111-47695133 AGACGGGGCCTGAAGATGGGTGG + Intronic
1167171615 19:47836172-47836194 TGTGAGGCCCTGAGGCTGGGTGG - Intronic
1167299700 19:48671626-48671648 TGGCAGGCCCTGGGGAGGGGAGG + Intronic
1167352088 19:48981816-48981838 GGAAAGCCCCTGAGTATGGTGGG - Intronic
1167473802 19:49689109-49689131 GGCCAGGCCCTGAGGGTGGAAGG - Exonic
1167727259 19:51224959-51224981 GGACAAGCTCTGAGCATGTGTGG + Intergenic
1168279092 19:55294464-55294486 GGAGATGACCTGAGGATGGAAGG - Intronic
1168287018 19:55340192-55340214 GGAGAGGCCCTGAGGATGCAGGG - Intronic
1168287055 19:55340310-55340332 GGAGAGGCCCTGAGGGTGCAGGG - Intronic
1168335716 19:55596498-55596520 GCAAAGGCCCTGAGGAAGGAAGG - Intronic
1168629104 19:57943373-57943395 GGACAGGCCCTGTGGTTCTGAGG - Intronic
925987395 2:9227241-9227263 GCACATGCCCTTAGGATTGGGGG - Intronic
926138969 2:10357159-10357181 GCACAGGCCCTGAGGAGGAACGG - Intronic
927256539 2:21044630-21044652 TCACTGCCCCTGAGGATGGGTGG + Intergenic
927504119 2:23602280-23602302 GGGCAGGCCCTGGGGCAGGGGGG - Intronic
929572273 2:43030133-43030155 GCAAAGGCCCTGAGGTGGGGAGG - Intergenic
931235716 2:60410911-60410933 AGACAGCCCCTGTGGGTGGGGGG + Intergenic
932651950 2:73567222-73567244 GGAAAGCCCCTTAGGATGGGGGG - Intronic
933654335 2:84875334-84875356 GCAAAGGCCCTGAGGCAGGGAGG + Intronic
934736274 2:96691431-96691453 GGCCAGGCCCTGTGGTGGGGAGG - Intergenic
935365452 2:102284840-102284862 GGACAGGCCATGAGGGTGAAAGG - Intergenic
935949870 2:108318961-108318983 GGACAGGCCCAGGTGACGGGTGG - Intergenic
937277812 2:120696682-120696704 GGACAGGGGCTGGGGAAGGGAGG + Intergenic
938543916 2:132309857-132309879 GGGCAGTCCCTCAGGAAGGGTGG + Intergenic
939122719 2:138137356-138137378 GGCCAGGACCTGAGGGTGGATGG - Intergenic
939381382 2:141440976-141440998 GGGCAGGGTCTGAGGGTGGGCGG - Intronic
939872231 2:147538404-147538426 GGAGAGACCCTGAGCATGGATGG - Intergenic
942469361 2:176243569-176243591 GAACAGGGCCTGAGGGTGGGTGG - Intergenic
945979932 2:216301242-216301264 GGAAGGCCCCTGAGCATGGGAGG - Intronic
946168801 2:217881381-217881403 GGTCAGACCCTGGGGGTGGGGGG + Intronic
946581921 2:221138290-221138312 AGAGAGGCCCTGACGATGGAGGG - Intergenic
947202069 2:227622675-227622697 GGACAGGCCATCAGAATGGGTGG + Intronic
947525761 2:230875817-230875839 GGCCAGGGCCTGGGGGTGGGGGG + Intronic
947926599 2:233927096-233927118 GGACAGGATCTGAGAGTGGGTGG - Intronic
948424495 2:237878501-237878523 TGGGAGGCCCTGAGGCTGGGTGG + Intronic
948883365 2:240871335-240871357 GGCCAGGCCCTGAGGAAGCAGGG - Exonic
948897796 2:240935278-240935300 GGGCAGGCCTTGGGGATGGCTGG + Intronic
1169044892 20:2527329-2527351 GGGCAGGCCTTGCTGATGGGTGG - Intergenic
1170591235 20:17773439-17773461 GGTCAAGGCCTGAGGAGGGGAGG + Intergenic
1170778661 20:19403743-19403765 GGACTGGCCCTGGGGAAGGGAGG + Intronic
1171374287 20:24681717-24681739 GGGCTGGCCCTGAGGCTGGCTGG - Intergenic
1173861610 20:46287526-46287548 GTAGAGGCCCTGAGGCTGGATGG + Intronic
1174196457 20:48775999-48776021 GGCAAGGCCCTGAGGAAGGAGGG + Intronic
1174687332 20:52468468-52468490 GGCAAAGCCCTGAGGCTGGGAGG + Intergenic
1175161575 20:57011774-57011796 GGACTGGCCCTGAGGCTTGGTGG - Intergenic
1175989140 20:62778875-62778897 GGAGAGGAGCTGAGGATGGTGGG + Intergenic
1176040148 20:63060914-63060936 GGGAAGGCCCTGGGGGTGGGGGG + Intergenic
1176070291 20:63222666-63222688 GAACAGGACCTGGGGTTGGGCGG + Intergenic
1176219711 20:63964141-63964163 GGCCAGGCCCTGAGGACGCCCGG - Exonic
1178427037 21:32487185-32487207 GGAAAGCCCCTAATGATGGGGGG + Intronic
1178436817 21:32567314-32567336 GGACCTGCCCTGTGGAGGGGAGG + Intergenic
1180092460 21:45540062-45540084 TGACAGGCCCTGAGGAGGCATGG - Intronic
1180127571 21:45802690-45802712 GGAGAGGCCCTGAGGGAGGCAGG + Intronic
1181279598 22:21709732-21709754 CGTCATGACCTGAGGATGGGGGG + Intronic
1181279630 22:21709882-21709904 GGTCATGACCTGAGGATCGGTGG + Intronic
1181279646 22:21709953-21709975 TGTCATGACCTGAGGATGGGTGG + Intronic
1181288518 22:21772505-21772527 GTGCTGGCCCTGAGGATGGCCGG - Intronic
1181329098 22:22075240-22075262 GGACATGCCCTGGACATGGGAGG - Intergenic
1181637641 22:24181754-24181776 GGGCAGCCCATGGGGATGGGAGG + Intronic
1182192642 22:28478745-28478767 GCAAAGGCCCTGAGGTTGGATGG - Intronic
1182295904 22:29311178-29311200 GGGCGGGCCCTGTGGCTGGGCGG + Intronic
1182547107 22:31082775-31082797 GGGTAGGCCCTGTGGATGGGTGG + Intronic
1183044118 22:35206179-35206201 GGAAAGGCCAAGAGGATTGGCGG - Intergenic
1183078685 22:35442625-35442647 TGACAGGTCCAGAGGGTGGGAGG - Intergenic
1183100946 22:35583662-35583684 GGCCAGTGCCTGAGGAAGGGAGG + Intergenic
1183278857 22:36921676-36921698 GCACAGGCCCTGTGGAAGTGAGG + Intronic
1183350983 22:37334731-37334753 TGACAGTCCCTGAGCATAGGCGG - Intergenic
1183460549 22:37947355-37947377 GGACGGGCTGCGAGGATGGGAGG + Exonic
1183704640 22:39469187-39469209 GGACAAGCCTTGGTGATGGGTGG + Intronic
1183951689 22:41356210-41356232 GGCCAGGCCCTGAGGCTGAGCGG + Intronic
1184210361 22:43031739-43031761 GCAAAGGCCCTGAGGCAGGGAGG + Intergenic
1184236957 22:43187526-43187548 GGGCAGGCCCTGCGCATCGGCGG + Intergenic
1184263322 22:43332388-43332410 AGACAGGACCTGGGAATGGGAGG - Intronic
1184430244 22:44438197-44438219 GGCCAGGTCCTGGGGCTGGGGGG + Intergenic
1184642768 22:45881004-45881026 TGGCAGGCACTGGGGATGGGAGG + Intergenic
1184728238 22:46358335-46358357 GCACAGGCCCTGAGGCTGGCAGG - Intergenic
1185065343 22:48629215-48629237 GGCCAGGCCCTGAGGGTGGGAGG - Intronic
1185182264 22:49370147-49370169 GGACAGGCCCCTGGGATGAGAGG + Intergenic
1185219430 22:49622110-49622132 GGGCAGGCCCTGGGGTGGGGAGG - Intronic
1185345686 22:50309573-50309595 GGACAGGCCCTGAGGAAGAGGGG + Exonic
950100911 3:10356197-10356219 GCAAAGGCCCTGAGGCAGGGAGG + Intronic
950188514 3:10960263-10960285 GAAGAGGCCCTGAGGCTGGCAGG - Intergenic
950449239 3:13056293-13056315 GGCCAGGACATGAGGTTGGGAGG - Intronic
950550829 3:13664925-13664947 GGACAGGCCCTGTCGCTGGAGGG + Intergenic
950581719 3:13866673-13866695 GGAAAGGCCCTGAGGTGGGAGGG + Intronic
950723147 3:14898871-14898893 GGAAGGCCCCTGAGGAGGGGTGG + Intronic
953061935 3:39434759-39434781 AGACAGGCCCAGAGTATTGGCGG - Intergenic
953366501 3:42350091-42350113 GGAAAGGCTCTGGGGAAGGGAGG - Intergenic
953368358 3:42366387-42366409 GCACACGTCCTGAGGAGGGGAGG + Intergenic
953806896 3:46078310-46078332 GGCCAGGCGCTGAGTCTGGGAGG - Intergenic
953926296 3:46984345-46984367 GGTCAGGCCCTGGGGCAGGGTGG + Intronic
954194205 3:48986669-48986691 GGAGTGGCCCTGAGCATGGGTGG - Intergenic
954331169 3:49891141-49891163 GGACAGGGCATGAGGGTGTGCGG - Intronic
954538047 3:51376032-51376054 GGGTAGGCCCTGAGGAAGGAGGG - Intronic
954692315 3:52402154-52402176 GTCCAGGCCCTGGGAATGGGAGG - Exonic
954942622 3:54388532-54388554 GGAGAAGCTCTGAGGATGGTTGG + Intronic
955397451 3:58567160-58567182 GGACAGCCCTGGAGGATGCGTGG + Intronic
956542312 3:70354690-70354712 GGACAGTGCCTGAGCATGGCAGG + Intergenic
956750003 3:72337731-72337753 GGACAGGATCTGAGTGTGGGTGG + Intergenic
956843162 3:73158335-73158357 GGCCATACCCTGAGGAGGGGAGG + Intergenic
960300498 3:115997608-115997630 GCAAAGGCCCTGAGGTTGGAAGG + Intronic
960997435 3:123349327-123349349 GGACAGGTCCTGCGGCTGAGGGG - Intronic
961456111 3:127024743-127024765 GGACATGGCCTGAGGCTGAGAGG + Intronic
961467805 3:127092133-127092155 GCAAAGGCCCTGAGGCTGGCAGG + Intergenic
961492463 3:127265097-127265119 GGAGAGGCCCTAGGGATGGCGGG + Intergenic
961635604 3:128330832-128330854 GGAGATGCACTGAGGAAGGGGGG - Intronic
961635628 3:128330917-128330939 GGAGATGCACTGAGGAAGGGGGG - Intronic
961635645 3:128330974-128330996 GGAGATGCACTGAGGAAGGGGGG - Intronic
961635661 3:128331031-128331053 GGAGATGCACTGAGGAAGGGGGG - Intronic
961635694 3:128331144-128331166 GGAGATGCACTGAGGAAGGGGGG - Intronic
961635747 3:128331337-128331359 GGAGATGCACTGAGGAAGGGGGG - Intronic
963955722 3:151251471-151251493 GGACACACCCTGTGGGTGGGAGG - Intronic
965544765 3:169904051-169904073 GGCCTGGCCATGGGGATGGGCGG - Intergenic
966098641 3:176239073-176239095 TGACAGGCCATCAGGGTGGGGGG - Intergenic
968602406 4:1516453-1516475 GGCCAGGCACTGAGTAGGGGAGG + Intergenic
968622822 4:1611361-1611383 GGACAGGCCAGGAGGACGGGGGG - Intergenic
968876208 4:3269198-3269220 GGAAGGGCCCTGAGGAGGGGAGG + Intronic
968890354 4:3365388-3365410 GGACAGGTCTTGAGGGAGGGAGG + Intronic
969119618 4:4898520-4898542 GGACAGCACGTGAGGCTGGGTGG + Intergenic
971012685 4:22456352-22456374 GGACCTGCCCTCAGTATGGGTGG + Intronic
971299594 4:25430855-25430877 GGACTGGCCCAGAGGAGGGAAGG - Intergenic
972339115 4:38135613-38135635 AGCCAGGCCCTGACGATGGGTGG + Intronic
973919732 4:55673107-55673129 GCCCAGGCCCTGAGGCAGGGAGG - Intergenic
974800270 4:66808403-66808425 GGACAGGCTCTGTGGAAGGAGGG - Intergenic
976358274 4:84146658-84146680 GCACAGGCCCTGAATATGGATGG - Intergenic
978159507 4:105529106-105529128 GGATATGCCCGGAGGGTGGGGGG + Intergenic
978599372 4:110411762-110411784 GGACAAGCTGTGAGGAAGGGTGG + Intronic
980103943 4:128569124-128569146 GAACAGTCCCTGAGGTTGGTAGG + Intergenic
980714299 4:136611667-136611689 AGACAGGGTGTGAGGATGGGAGG - Intergenic
981812220 4:148789054-148789076 GGATAAGCCCTGAAGATGGCTGG - Intergenic
982318732 4:154058007-154058029 GGACTGGGTGTGAGGATGGGAGG - Intergenic
983568184 4:169176279-169176301 GGACAGTCCCAGAGCTTGGGGGG - Intronic
984972886 4:185206442-185206464 GGACAGATCCTGAGGTCGGGGGG + Intronic
985824263 5:2181073-2181095 GGAAAGACCATGAAGATGGGAGG - Intergenic
986506459 5:8457448-8457470 CGCCAGTCCCTTAGGATGGGAGG - Intergenic
987753205 5:22067678-22067700 GCACAGGCCCTTAGGATTTGGGG + Intronic
988274682 5:29065489-29065511 AGACAGGCCATGAGTAGGGGAGG - Intergenic
990568213 5:57051443-57051465 TGACAGCCCCAGAGGATGGGGGG + Intergenic
990854442 5:60248265-60248287 GGAAAGGCCCTGAGGAGGGATGG + Intronic
991574407 5:68087864-68087886 AGACAGTCCCTGAGGAAGGTGGG + Intergenic
992198619 5:74363533-74363555 TGACAGGGTCTGAGGATGGGAGG - Intergenic
992834014 5:80622404-80622426 GGACAAGCCCTTAGCAAGGGTGG - Intergenic
993409868 5:87559951-87559973 CTACAGGCCCTGAGGTTGTGAGG - Intergenic
995482046 5:112603172-112603194 GGCAAGGCCATGAGGATCGGAGG - Intergenic
998164770 5:139836743-139836765 GGAAAGGCCATGACGATGCGGGG + Intronic
999302757 5:150501308-150501330 GGAAAGGCCATGAAGGTGGGTGG + Intronic
999454993 5:151707827-151707849 ACACAGGCCCTGAGCATGGGAGG + Intergenic
1001075128 5:168620781-168620803 GGAAAGCCCCTAAGGATGGAGGG - Intergenic
1001642568 5:173254941-173254963 GGCCAGCCCCGGGGGATGGGGGG + Intergenic
1001859813 5:175044184-175044206 GGAAACACCCTGAAGATGGGGGG - Intergenic
1002079333 5:176728187-176728209 GCACAGGCTCTGAGGGTGGTGGG - Intergenic
1002106580 5:176882232-176882254 GGACAGGCTGTGAGCATGAGAGG - Intronic
1002728961 5:181321017-181321039 GCACATGCCTCGAGGATGGGAGG - Intergenic
1003003627 6:2360530-2360552 AGACAGGCCCTGCGGAGGGATGG - Intergenic
1004183348 6:13399719-13399741 GGACAGGGGCTGAGGCTGGGAGG + Intronic
1004312157 6:14555263-14555285 GGACATGGGCTAAGGATGGGAGG - Intergenic
1004575155 6:16887708-16887730 GGACCGGGTGTGAGGATGGGAGG - Intergenic
1006340218 6:33442721-33442743 GGGCAGGCAGGGAGGATGGGAGG - Intronic
1006911455 6:37566147-37566169 GGGAAGACCCTGAGGATTGGGGG + Intergenic
1007249292 6:40484693-40484715 GTACAGGCCTGGATGATGGGTGG - Intronic
1007293074 6:40801680-40801702 GGAGAAGCCCTGAGGATGTCTGG + Intergenic
1007369839 6:41419479-41419501 AGAGAGGCCCTGAGGATGCCTGG + Intergenic
1007593943 6:43040064-43040086 GGGCAGACCCTGATGTTGGGAGG - Intronic
1007654941 6:43446207-43446229 GTTGAGGCCCTGAGGCTGGGTGG + Intronic
1008090219 6:47286191-47286213 GGACAGAGACTGAGGATGTGCGG - Exonic
1009301384 6:62027529-62027551 GGAAAGCCCCTAAGGATGAGGGG + Intronic
1010071794 6:71752538-71752560 GGACAGGCTGTGAGGAGGGGAGG + Intergenic
1013599481 6:111691132-111691154 GGCCAGGCCCTGAGCCTGTGAGG - Intronic
1018090411 6:160342029-160342051 GGACAGGCTCTGAGCCTGGAAGG + Intergenic
1018900709 6:168050420-168050442 GAACAGGCCCTGGGGAGTGGTGG + Intergenic
1019197123 6:170289465-170289487 GGGCCGGCCCTGAAGCTGGGCGG - Intronic
1019521237 7:1461412-1461434 GGACAGGTCGTCTGGATGGGAGG - Intergenic
1019546715 7:1581093-1581115 GGACAGGGCGTTAGGATGGGAGG + Intergenic
1019597046 7:1863044-1863066 GCACAGGCCTGGAGGCTGGGAGG + Intronic
1019706832 7:2500739-2500761 GGACAGTGCCACAGGATGGGGGG - Intergenic
1020479950 7:8646961-8646983 GAACAGGCACTGGGGAGGGGAGG + Intronic
1020794131 7:12661310-12661332 GGACAGGGTGTGAGGAGGGGAGG - Intergenic
1021488643 7:21194154-21194176 GCACAGGCCCTGAGAACGTGAGG - Intergenic
1021804692 7:24343407-24343429 GGACAGGGCCTGAGGCAGGCAGG - Intergenic
1021846884 7:24771803-24771825 GGAAAGGCCAAGAGGAAGGGAGG + Intergenic
1023370117 7:39504959-39504981 GGACAGGCCTGGAGGAGAGGGGG - Intergenic
1024030510 7:45456227-45456249 GGCCAGGCACTGGGGATGGGAGG + Intergenic
1024470643 7:49766268-49766290 TGGCAGAACCTGAGGATGGGAGG - Intergenic
1025019311 7:55468315-55468337 AGAGAGGCCCTGAGGAGGAGAGG + Intronic
1027265595 7:76493664-76493686 GGACAGGCCTGGAGGTAGGGCGG + Intronic
1027316966 7:76991781-76991803 GGACAGGCCTGGAGGTAGGGCGG + Intergenic
1028811959 7:95097937-95097959 GGGCAGGCAGTGAAGATGGGAGG + Intronic
1029572190 7:101377361-101377383 GGGGAGGCCCTAAGGTTGGGGGG + Intronic
1032050698 7:128648158-128648180 GCACATGCCTCGAGGATGGGAGG - Intergenic
1033653506 7:143359171-143359193 GGAATGGCCTGGAGGATGGGAGG + Intronic
1034345449 7:150382645-150382667 GGCCAGGCCCTGAGGATCTTAGG + Intronic
1034458832 7:151186965-151186987 GGGCAGGTCCTGAGGCTGTGCGG + Exonic
1034672515 7:152869317-152869339 GGACCCACCCTGGGGATGGGTGG - Intergenic
1035039311 7:155916080-155916102 TGACAAGCCCTGAGGATGGGAGG - Intergenic
1035146285 7:156820947-156820969 GCACAGGCCCTTAGGATGTTGGG + Intronic
1035643733 8:1202622-1202644 GCAGAGGCTCTGGGGATGGGGGG + Intergenic
1035876302 8:3193510-3193532 GGCCAGACCCAGAGGACGGGCGG - Intronic
1037700022 8:21265273-21265295 GGAGAGGCCCTGGGGAGGGTGGG - Intergenic
1037989976 8:23314934-23314956 GTGCAGTCACTGAGGATGGGAGG + Intronic
1038963051 8:32542929-32542951 TGACAGGACTTGGGGATGGGTGG + Intronic
1039884022 8:41645465-41645487 GGACAGCCCCTCCGGCTGGGTGG - Exonic
1039915702 8:41858909-41858931 TGACAGGCTCTGAGAATGGAGGG + Intronic
1039990205 8:42481423-42481445 TGCCAGGCCCTGATGATAGGAGG + Intronic
1043869236 8:85412753-85412775 TGAAAGGCCCTGAGGCTGGGAGG + Intronic
1044572959 8:93740443-93740465 GGAAAGGCACGGAGGTTGGGCGG - Intronic
1046728234 8:117697364-117697386 TGACAGCCTCTGAGGATGGAGGG + Intergenic
1047552730 8:125894148-125894170 GGACATACCCTGAGATTGGGAGG + Intergenic
1048010005 8:130447956-130447978 GAACAGGTACTGAGGATGAGAGG + Intergenic
1049270904 8:141695731-141695753 GGACGGGGCCTGCAGATGGGAGG + Intergenic
1049537372 8:143188653-143188675 AGGCAGGACCTCAGGATGGGTGG + Intergenic
1049542567 8:143215219-143215241 GAACAAGTGCTGAGGATGGGCGG - Intergenic
1049582638 8:143419867-143419889 GGACAGACCCAGCGGATGAGGGG + Intronic
1053055142 9:34989573-34989595 TGACAGGGGCGGAGGATGGGCGG + Intergenic
1055343286 9:75308525-75308547 GGCCAGGCAGTGTGGATGGGGGG - Intergenic
1056953585 9:91065331-91065353 GGTCAGGCCCAGAGGAGGGAGGG - Intergenic
1057183177 9:93040651-93040673 GGGTAGGCCCTGGGGCTGGGCGG - Intergenic
1057187373 9:93064394-93064416 GGACAGGCTCTGGGGATGCTGGG + Intronic
1057225308 9:93289717-93289739 GGACGGGCCCTGAGTGAGGGCGG - Intronic
1057699686 9:97354800-97354822 GGACAGGCCCAGTGAATGGTTGG - Intronic
1057860246 9:98635264-98635286 GGACAGCCACTGAGGTTGGGTGG + Intronic
1057951679 9:99373914-99373936 GCACAGGCCCTGGGGTCGGGGGG + Intergenic
1058421145 9:104834695-104834717 AAACAGGTCCCGAGGATGGGTGG + Intronic
1058654339 9:107206167-107206189 GGACAGGCTCGGAGGGAGGGGGG + Intergenic
1059323045 9:113483917-113483939 GGACAGGGCCTCATGGTGGGTGG - Intronic
1060105100 9:120868719-120868741 GAACAGGACCTGAGGAGGCGAGG - Intronic
1060157131 9:121327577-121327599 GGACAGGCCCTCAGGTGGGATGG - Intronic
1060938239 9:127528165-127528187 AGTCAGTCCCTGAGGATTGGAGG - Intronic
1061493058 9:130956851-130956873 GGAAAGGCCTGGAGGTTGGGGGG + Intergenic
1061792174 9:133064573-133064595 GGACTGGCCCTGCGGCGGGGCGG + Intronic
1061999159 9:134207404-134207426 GGACAGGTGGGGAGGATGGGGGG - Intergenic
1061999220 9:134207580-134207602 GGACAGGTGGGGAGGATGGGGGG - Intergenic
1061999282 9:134207756-134207778 GGACAGGTGGAGAGGATGGGGGG - Intergenic
1062062693 9:134505110-134505132 GGCCAGGCTGTGTGGATGGGTGG + Intergenic
1062280894 9:135751163-135751185 GGACAGGCACTGGGGAAGGAAGG - Intronic
1062357331 9:136171027-136171049 GGACAGGGTCTGAGGCTCGGTGG - Intergenic
1062387274 9:136317831-136317853 GGAGAGCCCCCGAGGGTGGGTGG - Intergenic
1062620386 9:137417863-137417885 GGACAGAGCCTGAGGATCTGAGG + Intronic
1062707749 9:137954579-137954601 GGCCATGCCCTGAGAATGAGAGG - Intronic
1203576542 Un_KI270745v1:12895-12917 GCACATGCCTCGAGGATGGGAGG - Intergenic
1186413398 X:9362932-9362954 GCAAAGGCCCTGAGGCAGGGAGG + Intergenic
1186715861 X:12250904-12250926 AGACAGGCCCTGAGCCTGGCTGG - Intronic
1186998441 X:15149331-15149353 GGAAAGGCCTTGAGGCAGGGAGG - Intergenic
1187749445 X:22445816-22445838 GACCAGGACCTGAGGATGTGTGG - Intergenic
1187852669 X:23606538-23606560 GGACAAGTCATTAGGATGGGTGG - Intergenic
1190093918 X:47463705-47463727 GAACAGTCACTGAGGCTGGGGGG - Intronic
1190399311 X:50015649-50015671 GCTCAGGCGCTAAGGATGGGAGG - Intronic
1190525679 X:51327379-51327401 GCAAAGGCCCTGAGGAGGGAAGG + Intergenic
1190543807 X:51504293-51504315 GCAAAGGCCCTGAGGAGGGAAGG - Intergenic
1190712346 X:53079924-53079946 GCCCAGGCCCTGAGCACGGGAGG + Exonic
1190875555 X:54457874-54457896 GGCCAGGCCTTAAGCATGGGTGG - Intronic
1196525556 X:116724952-116724974 GGACAGGGTGTGAGGAGGGGAGG + Intergenic
1198425130 X:136510834-136510856 GGAAAGGCTGAGAGGATGGGAGG + Exonic
1200268163 X:154657727-154657749 GGACCGGCCCTCTGGAGGGGAGG - Intergenic
1202061985 Y:20897955-20897977 AGACAGGGTTTGAGGATGGGAGG - Intergenic