ID: 1151572001

View in Genome Browser
Species Human (GRCh38)
Location 17:74931086-74931108
Sequence CTGGCGTCTCCACTGGCTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151572001 Original CRISPR CTGGCGTCTCCACTGGCTTC TGG (reversed) Exonic
900647268 1:3714604-3714626 CTGGCCTCTCCTCCGGCCTCTGG - Intronic
902747745 1:18484501-18484523 CTCCCATCTCCCCTGGCTTCTGG - Exonic
903753533 1:25645142-25645164 AGGGCGTCTTCACTGGCTGCAGG + Intronic
904287752 1:29462891-29462913 CTGATGTCCCCACTGGGTTCTGG - Intergenic
904675677 1:32197958-32197980 CAGGCAGCTCCACTGGCCTCCGG - Exonic
904869693 1:33608734-33608756 CGGGCCCCTCCCCTGGCTTCTGG - Intronic
905816201 1:40952855-40952877 CTTGGCTCTCCACTGCCTTCTGG + Intergenic
906414803 1:45612815-45612837 CTGAGGTCTCCACCTGCTTCTGG + Intronic
908452458 1:64269497-64269519 CAGTCCTCACCACTGGCTTCAGG + Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
917927078 1:179798398-179798420 CTGGTGTCTCCTCTTGTTTCAGG + Intronic
921410619 1:214832608-214832630 CATGCTTCTCCCCTGGCTTCCGG + Intergenic
922068541 1:222168410-222168432 CTGGTGTCTTCCCTGGTTTCTGG + Intergenic
922163342 1:223094542-223094564 CTGGCCTCTCCCTTGGCTTCTGG + Intergenic
922613012 1:226943995-226944017 CTGCCATCTGCACTGGCTCCTGG - Intronic
923205439 1:231754335-231754357 CTGGCATCTGCTCTGGCTTCTGG + Intronic
923554541 1:234990432-234990454 CTGGCCCCTCTCCTGGCTTCTGG + Intergenic
924544964 1:245018317-245018339 CTGGCCTCTCTACTAGGTTCTGG - Intronic
1064420002 10:15182548-15182570 CTGGAGTTTCCAATGGCTTATGG - Intergenic
1067150237 10:43726505-43726527 CTGGCCCCTCCACTGGCTGCTGG - Intergenic
1070610605 10:77929699-77929721 CTGGCGTCTCCCCTAGCTTCCGG - Intergenic
1070697403 10:78573241-78573263 CAGGCCTCTCTCCTGGCTTCTGG - Intergenic
1072743281 10:97923047-97923069 CTGGCTTCCTCACTGGTTTCTGG + Intronic
1076567635 10:131409802-131409824 CTGGCCTCTCTCCCGGCTTCCGG - Intergenic
1077170991 11:1165630-1165652 CTGGCAGCTCCACCGGCCTCCGG - Exonic
1077525441 11:3061472-3061494 CTTGCCTCTCTCCTGGCTTCTGG - Intergenic
1078404289 11:11055842-11055864 CTGGCCTCTCCACTTGCTTTGGG + Intergenic
1079086489 11:17449278-17449300 CTGTGTTCTCCACTGGCCTCTGG - Intronic
1081535909 11:43996097-43996119 CAGGCCTTTCCCCTGGCTTCTGG - Intergenic
1082171299 11:49008572-49008594 CTGGAGTCACCGCTGGCATCGGG + Intergenic
1083814457 11:65124734-65124756 CTGGACTCTCCAGTGGGTTCAGG + Intronic
1084565568 11:69926593-69926615 CTGGCATCTGCACTGACTCCTGG + Intergenic
1085727359 11:78965710-78965732 CTGGTCTCTCCTCTGGCCTCTGG + Intronic
1087791194 11:102407731-102407753 CATGCCTCTCCTCTGGCTTCTGG - Intronic
1087847199 11:102986959-102986981 CAGGCCTCTCTCCTGGCTTCTGG + Intergenic
1091242693 11:134064508-134064530 ATGCCGCCTTCACTGGCTTCCGG - Intergenic
1091724588 12:2836855-2836877 CACGCCTCTCCCCTGGCTTCTGG - Intronic
1092659811 12:10725791-10725813 CTTGTGGCTCCAGTGGCTTCAGG - Intergenic
1094655855 12:32418989-32419011 CTGCCATCACCACTGGCTTATGG + Intronic
1096867548 12:54573813-54573835 GTAGAGACTCCACTGGCTTCAGG + Intronic
1097009203 12:55940480-55940502 CTGCCTTCTCCACGGGCCTCCGG + Intronic
1097191636 12:57222237-57222259 CTGGCGAATCCCCTGGCTTTGGG - Intronic
1099719034 12:86337506-86337528 CTGCCATCTCCACTGCCTCCTGG - Intronic
1101405670 12:104426471-104426493 CATGCCTCTCCCCTGGCTTCTGG - Intergenic
1102876563 12:116453790-116453812 CTGGCGTCTCTTCTGTCCTCTGG + Intergenic
1103249669 12:119488780-119488802 CTGTGCTCTCCACTGGCTTCTGG + Exonic
1103969793 12:124663399-124663421 CTGGCCTCTTCCCTAGCTTCTGG + Intergenic
1104062027 12:125276744-125276766 CTGGCGTCTCCCCTGACAGCTGG + Intronic
1104654224 12:130561122-130561144 CTGGCCTCTCTCCTGTCTTCTGG - Intronic
1104878831 12:132055176-132055198 CTGGCGTCGCCAGTGGCTCCTGG + Exonic
1105436124 13:20379851-20379873 TTTGCCTCTCCAATGGCTTCAGG + Intergenic
1105454221 13:20525703-20525725 CCGGCGTCTCCCCGGGCTCCAGG + Intronic
1106155070 13:27146997-27147019 CAGGCTTCTCTACTTGCTTCCGG - Intronic
1107042344 13:35962426-35962448 CAGGCCTCTCCCCTAGCTTCTGG - Intronic
1112051835 13:95650365-95650387 CAGGTGTCCCCACTGGCTCCTGG + Intergenic
1112598678 13:100833398-100833420 CACGCCTCTCCCCTGGCTTCTGG - Intergenic
1112622222 13:101064669-101064691 CTAGCCTCTCCCCTGGCTGCTGG - Intronic
1112677723 13:101722899-101722921 TTGGCGTCACCCCAGGCTTCGGG + Exonic
1113271210 13:108676725-108676747 CACGCCTCTCCTCTGGCTTCTGG - Intronic
1113568594 13:111337541-111337563 CTGGCATCTCCTTTGGCTCCAGG + Intronic
1114888120 14:26880723-26880745 CTGGTGTCACCACTGGATTCTGG - Intergenic
1116799464 14:49428142-49428164 CTGGTGTTTCCACTGATTTCTGG - Intergenic
1117262131 14:54046559-54046581 CGGACGTCTCCAGAGGCTTCTGG + Intergenic
1118426497 14:65669454-65669476 CTGGCATCTCCACTGGACACTGG + Exonic
1119208357 14:72811404-72811426 CAGGCCTCTCTGCTGGCTTCTGG - Intronic
1121515883 14:94549546-94549568 CTGGCACATCCACTGCCTTCAGG - Intergenic
1122423405 14:101591249-101591271 CTGCCCTCTGCACTGTCTTCTGG - Intergenic
1122573153 14:102722359-102722381 CTGGGGACTTCACAGGCTTCTGG - Exonic
1122879055 14:104681896-104681918 CTGGAATCTCCACTTGCATCCGG - Intergenic
1123054461 14:105562447-105562469 CTGACCTCTCCAGTGGCCTCAGG - Intergenic
1123079045 14:105682866-105682888 CTGACCTCTCCAGTGGCCTCAGG - Intergenic
1125549929 15:40537513-40537535 CTGGCCTCTTCCCTGGGTTCTGG - Intronic
1125612257 15:40979511-40979533 CTGGTCTCTCTACTGGCTTCTGG + Exonic
1126372340 15:47960835-47960857 CTGGAGTCTCCACTGCCTGTTGG + Intergenic
1130681708 15:86002577-86002599 CTATCTTCTCCACTGGGTTCTGG - Intergenic
1132554751 16:567590-567612 CTGGAGACTCCACGGGCTCCCGG + Exonic
1132725388 16:1336186-1336208 GCGGCTGCTCCACTGGCTTCGGG + Intronic
1132975314 16:2708178-2708200 GAGGCCTGTCCACTGGCTTCTGG + Exonic
1133167283 16:3957285-3957307 CTGGAGCCTCCTCTGGCCTCAGG - Intronic
1134387560 16:13788067-13788089 ATGGCGTCTCAACTGGCATTTGG - Intergenic
1136183836 16:28573303-28573325 CTCCCTTCTCCTCTGGCTTCAGG - Intronic
1136508786 16:30723217-30723239 CTGGACTCACCACTGACTTCAGG - Exonic
1142307647 16:89294554-89294576 CTGGCCACTCCAGTGGCTTCTGG + Intronic
1143366997 17:6414957-6414979 CTGGCCTCTCTCCTGTCTTCCGG - Intronic
1144132911 17:12265488-12265510 CAGGCCTCTCTCCTGGCTTCTGG + Intergenic
1144295782 17:13873670-13873692 CTGGTCTCTCTTCTGGCTTCTGG - Intergenic
1144942366 17:18950591-18950613 CTGCCGTCTCCCCTTGCCTCTGG - Intronic
1145178935 17:20727934-20727956 CATGCCTCTCCCCTGGCTTCTGG + Intergenic
1145256313 17:21324726-21324748 CCCGCGTCTCCACTGGCTGATGG + Intergenic
1145988119 17:29061172-29061194 CTGGGGTCTGCACAGGCTGCAGG + Intergenic
1146852786 17:36237784-36237806 CATGCCTCTCCCCTGGCTTCTGG - Intronic
1146868697 17:36361676-36361698 CATGCCTCTCCCCTGGCTTCTGG - Intronic
1147071571 17:37962300-37962322 CATGCCTCTCCCCTGGCTTCTGG - Intergenic
1147083097 17:38041824-38041846 CATGCCTCTCCCCTGGCTTCTGG - Intronic
1147099040 17:38165797-38165819 CATGCCTCTCCCCTGGCTTCTGG - Intergenic
1148450657 17:47775757-47775779 CCCGTGTCTACACTGGCTTCTGG + Intergenic
1148688062 17:49511870-49511892 CTGGCCTGTCCTCTGGCTCCAGG + Exonic
1149838591 17:59937517-59937539 CATGCCTCTCCCCTGGCTTCTGG + Intronic
1150080576 17:62234840-62234862 CATGCCTCTCCCCTGGCTTCTGG - Intergenic
1151572001 17:74931086-74931108 CTGGCGTCTCCACTGGCTTCTGG - Exonic
1152288222 17:79424529-79424551 CTGGAGTCACCACTGGCCTGGGG + Intronic
1152726445 17:81949029-81949051 TTGTCGTCTCCATTGGCTGCTGG + Intergenic
1152795791 17:82305517-82305539 CTGCCGTCTCCTCTGGCATCAGG + Intergenic
1154453839 18:14503080-14503102 GTGGCTGCTCCACTGGCTCCTGG - Intergenic
1155454646 18:25998157-25998179 CACTCTTCTCCACTGGCTTCTGG - Intergenic
1155868076 18:30991766-30991788 CTGGCTTCTCGACTGTCTTTTGG + Exonic
1158467686 18:57705648-57705670 CCTGCCTCTCCCCTGGCTTCTGG - Intronic
1158557503 18:58487351-58487373 CATGCCTCTCCTCTGGCTTCCGG - Intronic
1158629018 18:59096001-59096023 CTTGCCTCTCCCCTGGCTTCTGG - Intergenic
1158841659 18:61394529-61394551 CAGGCCTCTCCTTTGGCTTCTGG - Intronic
1158926117 18:62262921-62262943 CTGGGCTCTCCCCTGGCTTCTGG + Intronic
1160449531 18:78952900-78952922 GAGGTGTCTCCACTGGCTTCTGG - Intergenic
1162161830 19:8723817-8723839 CTGGCATTTCCCCTGGTTTCAGG - Intergenic
1162256892 19:9498127-9498149 CTGGCGACTCCACCGTGTTCGGG - Exonic
1165363745 19:35351731-35351753 CTAGCGCCTCCACCGCCTTCAGG - Exonic
1165737079 19:38183623-38183645 CTGACCTCTCCACTGAATTCGGG - Intronic
1167043930 19:47039226-47039248 CTGGTGGCTTCACTGGCTGCAGG + Intronic
1167998667 19:53426947-53426969 CTGGCCTCTCCTCTTCCTTCCGG + Intronic
1168008792 19:53513058-53513080 CTGGCCTCTCCTCTTCCTTCTGG + Intergenic
1168095649 19:54113378-54113400 CAGGCCTCTCCCCTGGCTTCTGG - Intronic
927943594 2:27121207-27121229 CATGCCTCTCCCCTGGCTTCTGG - Intergenic
931442211 2:62298103-62298125 GTGGTGTCTGCACTGACTTCAGG + Intergenic
932106761 2:68950611-68950633 ATGGCCTCTCTACTGTCTTCAGG + Intronic
932885641 2:75546940-75546962 CAGGGTTCTCCAATGGCTTCTGG - Intronic
935363033 2:102263792-102263814 CTGGGGTCTACACTGGCTTGTGG + Intergenic
935600666 2:104918633-104918655 CAGGCCTCTCTCCTGGCTTCTGG - Intergenic
937905552 2:127051171-127051193 CCGCCGTCTCCCCTGGCTCCTGG + Exonic
937936011 2:127245951-127245973 CCAGCCTCTCCACTGGCTTTTGG - Intergenic
940013563 2:149080188-149080210 CAGGCCTCTCTCCTGGCTTCTGG + Intronic
942247966 2:174024857-174024879 CTGGAGACTCCCCTGGCTTGGGG - Intergenic
944676382 2:202036266-202036288 TCGGCATCACCACTGGCTTCTGG + Exonic
946496681 2:220202520-220202542 CTGGCATCTCCTCTGGCCTCAGG + Intergenic
948227084 2:236319574-236319596 CTGGCCTCTCCACTGCATACTGG - Intergenic
948390003 2:237605141-237605163 CTGGCCTCTTCTCGGGCTTCTGG - Intergenic
1169512022 20:6274773-6274795 TGGGCTTCTCCTCTGGCTTCTGG + Intergenic
1170467975 20:16640027-16640049 CTGGGGTATCCACTGGCTGTGGG - Intergenic
1173356976 20:42302640-42302662 CTGTCTTCTCCACTGGATTGTGG + Intronic
1173747579 20:45449620-45449642 CAGGCCTCTCTCCTGGCTTCTGG + Intergenic
1174282456 20:49449081-49449103 CTGGCCTCACCTCTGGCTCCAGG + Intronic
1175547383 20:59787297-59787319 CTGGCAAGTGCACTGGCTTCCGG + Intronic
1175550948 20:59817302-59817324 CTGGCGACACCACTGCCGTCTGG + Intronic
1175607658 20:60324022-60324044 TTGGCCTCTCTTCTGGCTTCTGG + Intergenic
1175683218 20:61006476-61006498 CTGGCCCCTTCACTTGCTTCAGG - Intergenic
1176052351 20:63126598-63126620 CTGGTCTCTCCACTGTCTCCAGG - Intergenic
1176167184 20:63680465-63680487 CTGGCTTCTCTCCTGGCTGCTGG + Intronic
1179085756 21:38216172-38216194 CTGGCCTCTTTTCTGGCTTCTGG + Intronic
1179654528 21:42837206-42837228 TGGGCTTCTGCACTGGCTTCTGG + Intergenic
1179885829 21:44313923-44313945 CTGGTATCTGCACTGGCCTCAGG + Exonic
1181671379 22:24427094-24427116 TTGGTGTCTCCTCTGGCATCTGG + Intronic
1183933181 22:41247770-41247792 CTGGCCTGTTCACTGGCTTCAGG - Intronic
1184016043 22:41786411-41786433 CTGGGGTCAATACTGGCTTCAGG + Intronic
1184688477 22:46106921-46106943 CTGACCTCTCCTCTGGCCTCAGG - Intronic
1185173702 22:49307441-49307463 CTGGGGTCTCCCCTGGCTTCTGG + Intergenic
951962857 3:28348691-28348713 CAGGGGTCACCACGGGCTTCCGG + Exonic
953409309 3:42680819-42680841 CTTGCTTCTTCACTGACTTCTGG - Intergenic
954951427 3:54477690-54477712 CTGGCTTGTCCTCTGGCTCCAGG + Intronic
955336721 3:58092958-58092980 ATGGCGTCTGCACTAACTTCAGG - Intronic
955414554 3:58680263-58680285 CTGGCTTCTCCAGTGACTTAGGG + Intergenic
957966017 3:87323218-87323240 CTTGTATCTCCACTGGGTTCAGG + Intergenic
961547850 3:127647872-127647894 CTGGAATGTCCCCTGGCTTCAGG - Intronic
962210987 3:133477374-133477396 CAGGCAACTCCACTGGCCTCTGG + Intergenic
964093691 3:152906402-152906424 CTGTTGTCTACAGTGGCTTCTGG + Intergenic
966723784 3:183090277-183090299 CTGGAGACTCCACTGGATTTAGG + Intronic
969432918 4:7166485-7166507 CAGGCCTCTCCCCTGGCTTCAGG - Intergenic
973923869 4:55717246-55717268 CAGGCCTCTCCCCTGGCTTCTGG + Intergenic
973980959 4:56307855-56307877 CTGTCCTCTTCACTGGCTACAGG - Intronic
975351623 4:73353471-73353493 CAGGCCTCTCTCCTGGCTTCTGG - Intergenic
978956497 4:114620237-114620259 CTGGTCTCTCCACTGGGTTCTGG - Intronic
980012756 4:127615167-127615189 CTGGCATTTCCAGTGGCTACAGG - Intergenic
980226961 4:129999009-129999031 CTGGAGTCTCCACAGGCCTAGGG + Intergenic
981514831 4:145596593-145596615 CTGCAGCCTCCACTGGCTGCAGG - Intergenic
986290851 5:6397659-6397681 CACGGGTCTCCACTGGCCTCGGG - Intergenic
987308943 5:16664462-16664484 CTGGCGGGGCCACAGGCTTCAGG + Intronic
987860077 5:23473752-23473774 TTGGCATATACACTGGCTTCAGG - Intergenic
988601174 5:32640748-32640770 CTGGATTCTCCACTCCCTTCAGG - Intergenic
990485680 5:56257623-56257645 TTGGTGTCTCCAGTGCCTTCAGG + Intergenic
991137569 5:63199997-63200019 CTGTCCTTTCAACTGGCTTCTGG + Intergenic
993048953 5:82902952-82902974 CTGCTGCCTCCAGTGGCTTCAGG + Intergenic
1002130885 5:177080905-177080927 TTGGCTTCTCCACAGGCTCCAGG - Intronic
1004589093 6:17031463-17031485 CAGGCTTCGCCCCTGGCTTCTGG - Intergenic
1005016890 6:21383089-21383111 CAGGCTTCTCCCCTGGCTTCCGG + Intergenic
1005154490 6:22788943-22788965 CAGGCCTCTCCCCTAGCTTCTGG + Intergenic
1007132110 6:39484930-39484952 CTGCCCTCTCCTCTGGATTCTGG + Intronic
1010743598 6:79536764-79536786 CTTGAGTCTCCACGGGCCTCCGG + Intronic
1014974047 6:127856493-127856515 CTCGCTTGTCCTCTGGCTTCTGG - Intronic
1016131544 6:140478780-140478802 TTTGCCTCTCCCCTGGCTTCTGG + Intergenic
1016303523 6:142657977-142657999 CTTGCCTCTCCCCTGGTTTCTGG + Intergenic
1017262487 6:152403185-152403207 CTGGCAGCCCCACTGGCTCCAGG - Intronic
1018435344 6:163753946-163753968 CAGGCCTCTCCTCTGGCTTCTGG + Intergenic
1018848950 6:167574050-167574072 CTGGCCTCTCCAATGGCTGCTGG + Intergenic
1019347749 7:539011-539033 CTGCTGACTCCACTGGCTTCTGG - Intergenic
1021887704 7:25156240-25156262 CGTGCCTCTCCCCTGGCTTCTGG - Intronic
1022976923 7:35567251-35567273 CTGGCCTCTATTCTGGCTTCAGG - Intergenic
1023152496 7:37215262-37215284 CTGGCATTACCACTGGCTTTGGG + Intronic
1023197302 7:37655456-37655478 GTGGGGTCTCCACTGGCACCAGG - Intergenic
1024325924 7:48109181-48109203 CTTGGGTCTTCACTGGCTTGTGG + Intergenic
1026248480 7:68645374-68645396 CTTGGGTCTTCACTGGCATCTGG - Intergenic
1031025273 7:116672545-116672567 CTGACTTCTCCACTGGTTCCTGG + Exonic
1034255954 7:149724789-149724811 CTGGTGTCTCCAGTGGCTGAGGG - Exonic
1034450694 7:151135676-151135698 CTGGCCACTCCCCTGCCTTCGGG - Intronic
1035126392 7:156610972-156610994 CTTCCGTCTCCACTGGGCTCTGG - Intergenic
1041391825 8:57353721-57353743 CAGGCCTCTCTCCTGGCTTCTGG + Intergenic
1044841294 8:96339151-96339173 CTGGCATCTCGACTGATTTCAGG - Intergenic
1046661291 8:116950354-116950376 CTAGAGTCTCCACAGGGTTCAGG - Intronic
1048044321 8:130759045-130759067 CTGGCTCCACCACTGGCATCAGG + Intergenic
1049784035 8:144442061-144442083 CTGCCCTCTGCACAGGCTTCTGG + Exonic
1049791479 8:144474567-144474589 CTGGCCTCTCCACTTACTGCAGG - Exonic
1050062971 9:1729762-1729784 CAGGTCTCTCCCCTGGCTTCTGG - Intergenic
1052857591 9:33416749-33416771 CTGCCGTCACCACAGGCTTAGGG + Intergenic
1053071147 9:35102804-35102826 CAGGGCTCTCTACTGGCTTCTGG - Exonic
1055837091 9:80456293-80456315 ATGGTTTCTCCAATGGCTTCAGG + Intergenic
1058082768 9:100716943-100716965 CAGGCCTCTCCGCTAGCTTCTGG + Intergenic
1058110542 9:101027848-101027870 CTGCCATCTCCCCTGGCCTCAGG + Intergenic
1058782878 9:108356245-108356267 CATGCGTCTCTCCTGGCTTCTGG + Intergenic
1059325894 9:113503814-113503836 CTGGCGTCTTCCCTGGCCTCAGG + Intronic
1060022147 9:120140966-120140988 CTGGCTTCTCTACTTGCTTTGGG - Intergenic
1060595327 9:124844382-124844404 CTCTCTTCTCTACTGGCTTCTGG - Intergenic
1061534377 9:131238641-131238663 CTGCCGTCTCCTCTGGGGTCTGG + Intergenic
1061902003 9:133677806-133677828 CAGGCGGCTCTGCTGGCTTCAGG - Intronic
1062242530 9:135548030-135548052 ATGGTGGTTCCACTGGCTTCTGG - Intronic
1062682194 9:137787990-137788012 CTGGCCTCTCCACTTACTGCAGG - Intronic
1062701093 9:137903888-137903910 CTGGTGTCACTGCTGGCTTCTGG + Intronic
1062711875 9:137979354-137979376 GTGGCCTCTCCACAGGCTGCCGG + Intronic
1186926863 X:14343322-14343344 CTGACTTCTCCACTAGCTTTAGG + Intergenic
1187985670 X:24808108-24808130 CTCGCGTCTCTACTGGCTTTAGG - Intronic
1189280261 X:39816175-39816197 CTGCCTTGACCACTGGCTTCTGG - Intergenic
1191674185 X:63777743-63777765 TTGGCTGCTCCACTGGATTCTGG - Intronic
1195018587 X:100802519-100802541 CTGGCCTCATCACTGACTTCTGG - Intergenic
1199579233 X:149344813-149344835 CTGGCTTCTCCACGTGCTCCAGG + Intergenic
1199996702 X:153030591-153030613 CTGGCCTCCCCACTGCCTCCAGG - Intergenic