ID: 1151572450

View in Genome Browser
Species Human (GRCh38)
Location 17:74933646-74933668
Sequence CTCTGGGACCAGAAGGAAAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151572450_1151572456 7 Left 1151572450 17:74933646-74933668 CCCATTTCCTTCTGGTCCCAGAG 0: 1
1: 0
2: 2
3: 46
4: 291
Right 1151572456 17:74933676-74933698 TTCACAAAAGTTATTTTTCCAGG 0: 1
1: 0
2: 1
3: 47
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151572450 Original CRISPR CTCTGGGACCAGAAGGAAAT GGG (reversed) Exonic
901083675 1:6597800-6597822 CTCTGGGTCCAGGAGGGAAGGGG - Intronic
901138410 1:7012348-7012370 CACAGGGACCAGAAAGAAAGTGG - Intronic
901220808 1:7582838-7582860 CTGAGGAACCAGAAGGAAATGGG + Intronic
902265654 1:15261672-15261694 GTCTGGGAGCAGAGGGAAAGAGG - Intronic
904399203 1:30244692-30244714 ATCAGGGACCAGCAGGAACTGGG + Intergenic
904896991 1:33824892-33824914 CACTCGGCCCAGAAGGAAAGTGG + Intronic
905245904 1:36613156-36613178 CTCTGGGGCCAGTGGGCAATGGG - Intergenic
905581022 1:39082469-39082491 CCCTGGCACTAGAAGGTAATGGG + Intronic
907050754 1:51328833-51328855 CTCTGGGCCCAGATGGTCATTGG - Intronic
907720069 1:56963652-56963674 CTCTGAGACCTGAATGAAACTGG + Intronic
910120172 1:83779134-83779156 GTTTAGGACCAGAAAGAAATCGG + Intergenic
910734675 1:90440253-90440275 TTCTGTTACCAGTAGGAAATTGG + Intergenic
913107709 1:115629697-115629719 CTCTGGAACCAGAAGGAAAAGGG - Intergenic
915213969 1:154328230-154328252 CTCAGGGAGCAAAAGGAAAAGGG + Intronic
915379389 1:155426907-155426929 CCTGGGGATCAGAAGGAAATTGG - Intronic
915492768 1:156260544-156260566 CTCTGGGAGCAGAAGGCTAGAGG + Exonic
916475777 1:165167596-165167618 GTCTGGTACCAGAAGTATATAGG - Intergenic
916498161 1:165364098-165364120 CTCTGTGCACAGAAGGAAATGGG + Intergenic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
920560712 1:206936523-206936545 CTCTGGGATGAGAAGGAGCTGGG + Intronic
921333308 1:214062149-214062171 ATCAGAGACCAGAAGGAAGTAGG - Intergenic
921704195 1:218302104-218302126 CTCTGGGAGCTGATGGCAATGGG + Intronic
923063219 1:230495928-230495950 TTCTGGGATCAGAAGGTGATTGG + Intergenic
923412397 1:233723373-233723395 CTGTGGGACCAGAACAAACTGGG - Intergenic
924239267 1:242025558-242025580 CTCTGGGACCCCAAATAAATGGG + Intergenic
924654391 1:245960130-245960152 CTCTGAGTCCAAAGGGAAATTGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063212032 10:3889319-3889341 CTCTGGGTACAGAAGTAAAAAGG - Intergenic
1064026120 10:11850133-11850155 GTGTGGGACCAGAAGGGAAGTGG + Intronic
1064667990 10:17677139-17677161 CTCTGGCACCAAAATAAAATTGG - Intronic
1065851413 10:29793018-29793040 CTCTGGGTCCAGGTGGAACTCGG - Intergenic
1066996872 10:42571953-42571975 ATCTGGCACAAGAAGGTAATTGG - Intergenic
1067833442 10:49623283-49623305 GTCTGGGATCAGAAGGAAAGTGG - Intronic
1067860489 10:49842057-49842079 CCCTGGGACAGGAAGGAAAGGGG + Exonic
1069348127 10:67494009-67494031 CTCAGGGGACAGAAGAAAATGGG + Intronic
1069710347 10:70483798-70483820 CTCTGTGACCAGCAGGAAAGGGG - Intronic
1069884484 10:71615257-71615279 CACAGAGACCAGAAGGAGATTGG + Intronic
1069952802 10:72031245-72031267 AACTGGGAGAAGAAGGAAATGGG - Intergenic
1070209952 10:74306740-74306762 CTCTAGGAACAGAAGCAAACAGG - Intronic
1070405472 10:76090835-76090857 GGCTGGGAAGAGAAGGAAATGGG + Intronic
1070816491 10:79327835-79327857 CTTTGGGACTAGGAGGAATTAGG - Intergenic
1070982841 10:80664068-80664090 ACCTGGCACCAGAAGTAAATGGG - Intergenic
1072168942 10:92841760-92841782 TTTTGGAACCAGAAGGATATGGG + Intronic
1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG + Exonic
1073070959 10:100793080-100793102 CTCTGGAACCAAGAGGAAAGGGG - Intronic
1073455538 10:103634737-103634759 CTCTGGGAACAGAGGTAATTAGG + Intronic
1073818847 10:107237056-107237078 CTGAGGGACCAGCAGGAAAGGGG + Intergenic
1076182188 10:128418944-128418966 CTCTGGGATCAGAGGGAATGAGG + Intergenic
1076599847 10:131650444-131650466 CCCTGGGCTCAGAAGGAGATGGG + Intergenic
1076624116 10:131811127-131811149 CTCTGAGACCAGCAGGGACTCGG + Intergenic
1078095622 11:8294852-8294874 CTCTGGGCCCAGAGCTAAATTGG - Intergenic
1078745514 11:14110249-14110271 TTCTGGGCCCATAAGGAGATGGG - Intronic
1080117163 11:28634022-28634044 ATCTGAGACTAGAAGAAAATAGG - Intergenic
1080934703 11:36850708-36850730 CTCTGGGAAAAGATGAAAATGGG - Intergenic
1081548905 11:44094469-44094491 ATCTGGGACCAGAAGGGATTTGG + Intergenic
1082873209 11:57962552-57962574 CTGTGTGATCAGAAGAAAATTGG - Intergenic
1083994104 11:66263783-66263805 CTCTGGGACCTGCAGGGGATGGG - Intronic
1084461269 11:69297924-69297946 CTCTGGGCTCAGAAGGTAATGGG + Intronic
1084541277 11:69788609-69788631 CTCTGGGACCTGCTGGGAATTGG - Intergenic
1084886101 11:72207935-72207957 GTCTGGGAGCAGAAGGGACTAGG + Intergenic
1086440263 11:86822745-86822767 CTCTGGGAGCAGAGAGACATGGG + Intronic
1086749985 11:90480339-90480361 CTCTGGGGTCTGAAGGAAAGGGG - Intergenic
1086915151 11:92521846-92521868 CTCTAGAACCAGAAGGGGATGGG - Intronic
1087328850 11:96754721-96754743 CTGTGGTACCAGAAAGAGATGGG - Intergenic
1089498595 11:118920007-118920029 CTCTGGGACCAGAGGCCACTGGG + Intronic
1089615630 11:119693150-119693172 CTCTGGGACGAGGAGGCAAGAGG - Intronic
1089781897 11:120879085-120879107 CTCAGGGAGCGGAAGGAACTTGG + Intronic
1090887897 11:130895310-130895332 CTGGGGGACCAGAAGCAAAATGG - Intronic
1091641149 12:2238647-2238669 CTCTGGGAGCAGAGGGAACCTGG + Intronic
1093214420 12:16347107-16347129 TTCAGGGTCCAGAATGAAATTGG - Intergenic
1096795970 12:54077776-54077798 CTCTGTGCCCAGAGGGAATTAGG + Intergenic
1099865063 12:88269657-88269679 ATTTGGAACCAGAAGGAAAAGGG + Intergenic
1100456915 12:94760561-94760583 CTCAGTGACCAGAAGGGCATTGG - Intergenic
1100639278 12:96466275-96466297 CTCTTGGAACAGAAGAAAAATGG - Intergenic
1100961425 12:99966958-99966980 CTCTGGGATCAGAGGAAGATTGG + Intronic
1101735148 12:107457863-107457885 CTTTGGCAACAGAAAGAAATGGG + Intronic
1102152759 12:110699957-110699979 CTCTTGGACCAGGAGGAAGAAGG - Intronic
1103062221 12:117867770-117867792 CTCTGGGATCAGCAGTAGATTGG - Intronic
1103563832 12:121805592-121805614 CTCTGGGTTCGGAAGGAAAGGGG - Intronic
1104081849 12:125436085-125436107 CACAGGGACCAGATGGAAAGAGG - Intronic
1104158199 12:126153452-126153474 ATCTGGGAAGAGAAGGAAAATGG + Intergenic
1104889204 12:132132257-132132279 CTCTGGGGCCAGCAGGCAAAAGG - Intergenic
1108405104 13:50092945-50092967 CTCTGAGACTAGAAGGGAACAGG + Intronic
1109319510 13:60792614-60792636 CTGTGGGACCAGAGTGAAATGGG - Intergenic
1109778972 13:67082243-67082265 CGCTGGGAGCAGGAGGAAGTAGG - Intronic
1111549588 13:89789361-89789383 CTATGGGACTACAAGGAAAACGG + Intergenic
1112032570 13:95471121-95471143 CACTGTGACCTGAAGGAAAAGGG + Intronic
1112140421 13:96635313-96635335 GGCTGGGACCAGCAGGACATTGG - Intronic
1112472429 13:99701146-99701168 CTCTGTGACCAAAAGTACATAGG + Intronic
1112571757 13:100599582-100599604 CTTGGGGACCAGAAGAAAAAAGG + Intergenic
1113755082 13:112805280-112805302 CTCTGGTACTAGAAGGAAAGGGG - Intronic
1114660215 14:24339027-24339049 CTCTGGGTCCAGCAGGACGTTGG + Exonic
1116302958 14:43209253-43209275 CTCTGGAAGCAGAAGGGATTAGG - Intergenic
1117102923 14:52369022-52369044 CTATGGGAGATGAAGGAAATGGG + Intergenic
1117755125 14:58966908-58966930 CTTTGGGAACAAAAGGAGATAGG + Intergenic
1118093147 14:62505134-62505156 TTCTGGGCCCAGAAGGGCATGGG - Intergenic
1118287647 14:64491143-64491165 CTCTTGGGCCACAAGTAAATTGG - Intronic
1121641752 14:95489275-95489297 GTCTGGGACCTGTAGGAGATGGG - Intergenic
1121928388 14:97949387-97949409 CTCATGGACCAGAAGGAAGCAGG + Intronic
1122104057 14:99437947-99437969 TTCTGGAACCAGAAGGAGGTTGG - Intronic
1124449016 15:29767810-29767832 CTTTGAGACCAGAAGGAAAGAGG - Intronic
1125831296 15:42718731-42718753 CCCTGGGGACAGAGGGAAATGGG - Exonic
1126425938 15:48527059-48527081 CACTGGCCCCAGAAGGAATTGGG - Intronic
1126802694 15:52314320-52314342 GGCTGGGACCAGAAGGAAGGAGG + Intronic
1128655952 15:69462244-69462266 CTCCGTGTCCAGAAGGAAGTGGG - Intergenic
1129294505 15:74592498-74592520 CTTGGGGACCAGAAGGAAACTGG + Intronic
1129427504 15:75474625-75474647 TTCTGGGAGATGAAGGAAATGGG - Intronic
1130443700 15:83979038-83979060 CCCTGGGACCAGCAGGAAAGTGG - Intronic
1131388621 15:92029014-92029036 CTCTGGGGCCTGAAGGAAACAGG - Intronic
1132844624 16:1994302-1994324 CCCTGGCACCAGAAGGGAAGGGG - Intergenic
1133595483 16:7287078-7287100 CTCTGGGACCATAATGATCTTGG - Intronic
1133977426 16:10609340-10609362 ATCTGGGAGCAGGAGAAAATGGG + Intergenic
1136129962 16:28213466-28213488 TTCAGGAACCTGAAGGAAATGGG + Intergenic
1137705107 16:50529799-50529821 ATCTGATACCAGAAGAAAATGGG + Intergenic
1137762845 16:50954542-50954564 CTCTGGGAACATCAGGAACTCGG + Intergenic
1138271011 16:55695863-55695885 CTCTGTGGCCATAAGGATATGGG - Intronic
1139323760 16:66135613-66135635 CTCTGAGCCCAGAAGGAGTTTGG + Intergenic
1140255723 16:73334482-73334504 CTCTTGGAGCTGAAGGAAGTGGG + Intergenic
1141402353 16:83761214-83761236 CTCTGGGGCCCCAAGCAAATAGG - Intronic
1142031403 16:87840281-87840303 CTCTGGGGCCAGCAGGATGTGGG - Intronic
1143445963 17:7009752-7009774 CTCTGGGACTGGAAGGAGACAGG - Exonic
1143993215 17:10984756-10984778 CTCTGAGACTAGAAGGATTTGGG - Intergenic
1144235498 17:13256820-13256842 CTCTGGCAGGAGAATGAAATTGG + Intergenic
1144705344 17:17364227-17364249 CTCTGGGATCTGGAAGAAATGGG - Intergenic
1145951196 17:28818907-28818929 CTTTGGCACTAGAAGGGAATTGG - Intronic
1147136054 17:38434689-38434711 CTCTCGGGCCAGAATGAACTCGG - Intronic
1147248663 17:39139421-39139443 CTCTGGGTCCAGGAGGGAGTAGG + Intronic
1147330848 17:39698575-39698597 CTCTGGGACCAAGAGGACCTGGG - Intronic
1148152564 17:45405187-45405209 CTCAGGGACCAGAAGGCAAGGGG - Intronic
1148830389 17:50426884-50426906 CACTGAGGACAGAAGGAAATAGG - Intronic
1149141524 17:53437733-53437755 CTCTGTGATAAGAAGGAAATTGG + Intergenic
1149921428 17:60663484-60663506 CTTAGGGGCCAGAAGAAAATTGG + Exonic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151572450 17:74933646-74933668 CTCTGGGACCAGAAGGAAATGGG - Exonic
1151932098 17:77238936-77238958 CTCTGGGGCCAGATGGCAAAGGG + Intergenic
1151943249 17:77305835-77305857 AACTGTGACCAGATGGAAATGGG - Intronic
1152007396 17:77691199-77691221 ATCTGGGAACAGAAAGAAAGAGG - Intergenic
1152387902 17:79986164-79986186 CTTTGGGACCACGAGGAAATTGG - Intronic
1152572956 17:81128489-81128511 CTCCTGTACCTGAAGGAAATCGG - Exonic
1153109684 18:1570444-1570466 CCCAGGAACTAGAAGGAAATAGG + Intergenic
1153150159 18:2083572-2083594 CTTTGGGGCTAGATGGAAATAGG - Intergenic
1153536845 18:6110907-6110929 GTCTGAGACCAGCTGGAAATGGG - Intronic
1153728821 18:7986452-7986474 TTCTGGCACCAAAAGGCAATGGG - Intronic
1157145254 18:45155975-45155997 CTCTGGAACAAGAAGAAAATTGG + Intergenic
1157173454 18:45429411-45429433 CTCTCTGAGCAGAAGCAAATTGG + Intronic
1157446106 18:47748024-47748046 CTGTGGGTCCATAGGGAAATGGG - Intergenic
1157615880 18:48987439-48987461 ATCTGGGAGCAGAAGGAGAAAGG - Intergenic
1158436637 18:57438968-57438990 ACCGGGGACCAGAAGGAACTTGG + Intronic
1159173417 18:64802828-64802850 CTCTGGAAATAGAATGAAATTGG + Intergenic
1159529692 18:69639851-69639873 CTTTGGGACAGGAAAGAAATAGG - Intronic
1160139003 18:76302524-76302546 CTGTTGCACCAGAAGGAAAGGGG + Intergenic
1160376267 18:78414957-78414979 CTCTGGGATGAGGTGGAAATTGG - Intergenic
1160911195 19:1474542-1474564 CCCGGGGCCCAGAAGGAAGTGGG + Exonic
1161064103 19:2229123-2229145 CTTTGAGACCAGAAGGAAGTTGG + Intronic
1161499378 19:4605163-4605185 CTCTGAGACGAAAAGAAAATGGG - Intergenic
1161622081 19:5303336-5303358 CACGGGGACCAGGAGGAATTAGG - Intronic
1164767141 19:30780853-30780875 CTCTGGGACCACCATGAAAATGG - Intergenic
1166717487 19:44977683-44977705 CTCAGGGACCAGAGAGAAATTGG + Intronic
1167596875 19:50432606-50432628 GTCTGGGAGCAGAAGCAACTGGG - Intergenic
1168346414 19:55652223-55652245 ATCTTGGACCAGTGGGAAATGGG - Intronic
925285297 2:2711856-2711878 CTCTGGAATCAGAAGGAATCAGG + Intergenic
926409633 2:12589792-12589814 CTCTGAGCCCAGAAGGACAGTGG - Intergenic
926777729 2:16438935-16438957 CTTTGGGCCCAGGAGTAAATTGG + Intergenic
927522101 2:23705184-23705206 CTCTGAGACTAGAAGTAAATGGG + Intronic
930743851 2:54860901-54860923 CTCTGGGAGCAGAAGGGACTAGG + Intronic
932294030 2:70609437-70609459 CCTTGGGACAAGAAGGAAAAAGG + Intronic
932314707 2:70772218-70772240 CTCTGGAAACAGAAGTGAATTGG + Intergenic
932701263 2:73993475-73993497 CTCTATGACCAGAAGGGAATGGG + Intronic
933316719 2:80724330-80724352 CTCTGTGTCCAGAAGGAAAAGGG - Intergenic
933344041 2:81060843-81060865 CTCTGGGAGCAGAAGGGACTAGG - Intergenic
934156166 2:89203095-89203117 CTCTTAGAGAAGAAGGAAATTGG - Intergenic
934211151 2:89979668-89979690 CTCTTAGAGAAGAAGGAAATTGG + Intergenic
934512486 2:94956967-94956989 CAGGGGGAGCAGAAGGAAATGGG - Intergenic
934521452 2:95022645-95022667 CTCTGGGAACACAAGGAAGTGGG - Intergenic
935261862 2:101362674-101362696 CCCTGGGAGCTGAAGGACATGGG + Intronic
935644515 2:105323173-105323195 CACTGGGACCACAAGAAAACTGG - Intronic
935712171 2:105908998-105909020 GTGTGGGCCCTGAAGGAAATGGG + Intergenic
936644466 2:114352556-114352578 CTCTGGAACCAGATTGAATTGGG + Intergenic
937077963 2:119120821-119120843 CTCTGGGAGAAGAGGGAAATTGG + Intergenic
940322301 2:152390147-152390169 CTCTGGGTCCAGCAGTAATTGGG - Intronic
940348471 2:152653261-152653283 CTCTAAGACCAGAAGAAAACCGG + Exonic
940883243 2:158968311-158968333 CTCTGGGACCAAAATGAGATGGG - Intergenic
940992582 2:160112717-160112739 CTCAGGGACCAGCAGGATAAAGG + Intronic
941323192 2:164081263-164081285 CCCTGGAGCCAGATGGAAATAGG - Intergenic
942471677 2:176267420-176267442 CTATGGGATGAGGAGGAAATTGG + Intergenic
943876667 2:193074677-193074699 CTCTGGGAGCAGAAGGGTCTAGG - Intergenic
944224797 2:197338939-197338961 TTCTGGGACCTGTAGGAAGTTGG - Intergenic
945111231 2:206361810-206361832 CTCTGGGGCCAGTAGGACAGGGG - Intergenic
945151767 2:206799202-206799224 CTCTGGGGTCAGAAGGACTTGGG - Intergenic
946587139 2:221202347-221202369 CTCTGGGAGGATAAGGAAAAAGG + Intergenic
946626603 2:221618858-221618880 CTCTGGGACTGGAAGGTGATGGG - Intergenic
947037854 2:225879712-225879734 CTCGGGGTCGAGAAAGAAATGGG + Intergenic
947156392 2:227165881-227165903 CTCTTGGAAGACAAGGAAATGGG - Intronic
947400014 2:229722352-229722374 CTCCTGAACAAGAAGGAAATGGG + Intergenic
947890775 2:233617264-233617286 CTCTCTGTCCAGAAAGAAATTGG - Intergenic
947892387 2:233636095-233636117 CTCTCTGTCCAGAAAGAAATTGG - Intronic
948446814 2:238039628-238039650 CTCTGGAGCCAGAAGGAGGTGGG - Intronic
948570940 2:238916761-238916783 CTCTGGGACTAGAAGGAAGGTGG + Intergenic
1173140008 20:40473599-40473621 CTCTGGGACAAGAAGCAAGGAGG - Intergenic
1173415317 20:42849939-42849961 ACCTGGACCCAGAAGGAAATGGG - Intronic
1173615981 20:44403240-44403262 CTCTGGAACCAGAAAGATCTGGG + Intronic
1173851597 20:46221980-46222002 CTCTGGGGCCAGACAGATATGGG + Intronic
1174690426 20:52498899-52498921 CTCTGGGACCTGAATGACAAAGG - Intergenic
1174920848 20:54700377-54700399 ATCTGGGGCCAGAAGGCAAATGG + Intergenic
1176059005 20:63163995-63164017 CTCCGGGGCCAGCAGGAAAGCGG - Intergenic
1176370723 21:6060140-6060162 CTCTGGGGCCAGAAAGAACAAGG - Intergenic
1178094732 21:29202100-29202122 CATTGAGATCAGAAGGAAATGGG - Intronic
1179280097 21:39926550-39926572 CTCTGGGAGTAGAAGGATTTGGG + Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1179752796 21:43478401-43478423 CTCTGGGGCCAGAAAGAACAAGG + Intergenic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1185014449 22:48334955-48334977 CTCTGTGAACTGAAGGAAAGAGG + Intergenic
949452204 3:4198311-4198333 GTGTGACACCAGAAGGAAATGGG + Intronic
949458251 3:4262339-4262361 TTCTGGGAGCAGAAGTGAATTGG - Intronic
949945879 3:9189682-9189704 GTCTGGGATCAGTAGGAAATGGG + Intronic
952120830 3:30242289-30242311 TTCTGGGAACAGAAGGAAAAGGG - Intergenic
952926704 3:38325693-38325715 CTCTGGGATCACATGGGAATGGG + Intergenic
952929127 3:38346394-38346416 CTCAGGGGCCACAGGGAAATGGG - Intergenic
953651811 3:44812642-44812664 GTCTCTGACCAGAAGAAAATTGG - Intronic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954468396 3:50672129-50672151 TTCTGAGACCATAATGAAATAGG - Intergenic
955676343 3:61452863-61452885 CTCTGAGGCCAGAAGGAATTTGG - Intergenic
956028199 3:65006653-65006675 GTCTGGGACAAGATGGAATTTGG - Intergenic
957934162 3:86920967-86920989 CTCTGTGACCAGAATGAGATTGG + Intergenic
958124714 3:89341161-89341183 CACGGGCAACAGAAGGAAATGGG - Intronic
958954952 3:100457284-100457306 CTCTGGCATCAGAATGAACTGGG - Intergenic
959916580 3:111823138-111823160 CTAAGGGACCAGGAGGAAGTGGG + Intronic
961123067 3:124390476-124390498 CTCTGGAACCAAAACTAAATTGG + Intronic
962893419 3:139692767-139692789 CTCTGGGTACAGATGGAAATAGG + Intergenic
962983790 3:140515702-140515724 CTCTCAGACCACAATGAAATTGG - Intronic
966907991 3:184541644-184541666 GGCTGGGACCTGAAGGAAAAAGG - Intronic
967010510 3:185428708-185428730 CTCGAGGACCAGCAGGAAAAGGG + Exonic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
970707922 4:18827251-18827273 GTCTGGGAGGAGGAGGAAATGGG + Intergenic
971798702 4:31260429-31260451 CTCTGTGGGCAGAAGGTAATGGG + Intergenic
972772362 4:42209400-42209422 GGCTGGGAGGAGAAGGAAATGGG - Intergenic
973831898 4:54769916-54769938 CTCTGGGACTAGATGGAGAGTGG - Intergenic
976217889 4:82731819-82731841 CTCTGGGGACGGAAGGGAATGGG - Intronic
976936627 4:90644031-90644053 CTCTGGCACATGAAAGAAATAGG - Intronic
978074678 4:104513861-104513883 CTAAGAGAACAGAAGGAAATAGG - Intergenic
980191081 4:129525998-129526020 CCCTGGGGTCAGAAGGAGATGGG + Intergenic
983103114 4:163650816-163650838 CTCTGAGATTAGCAGGAAATAGG - Intronic
983359726 4:166712767-166712789 CTCTGGGAACAGAAGATAATAGG - Intergenic
984277449 4:177627349-177627371 CTCTGGCAACTGAAGGCAATGGG - Intergenic
986970549 5:13331655-13331677 TTCTGGTACCAGCAGGAAAAGGG - Intergenic
989582426 5:43045330-43045352 CTGTAAGACCAGAAGGCAATTGG - Intergenic
990496179 5:56350267-56350289 CTTTGGTACCAGAAGGATACAGG + Intergenic
990998443 5:61757331-61757353 GTCTGGGAAGAGAGGGAAATGGG + Intergenic
992170786 5:74099837-74099859 CTCTGTGCCCAGGAGGAAATGGG + Intergenic
992940177 5:81752460-81752482 CTATGGGAGGAGAGGGAAATCGG + Intergenic
993686308 5:90942574-90942596 CTCTGGCCCCAGAAGGCATTTGG - Intronic
995250571 5:109988481-109988503 GTCTGGGAAGAGGAGGAAATAGG - Intergenic
996347871 5:122507154-122507176 TTCTGTGTCCTGAAGGAAATAGG + Intergenic
999182696 5:149681192-149681214 CTCTGGGCCCAGGGGGGAATGGG + Intergenic
999473442 5:151876635-151876657 CTATGGTACCAGAAGTAAACAGG - Intronic
1000344077 5:160299950-160299972 CAATGGCATCAGAAGGAAATTGG - Intronic
1000862327 5:166471006-166471028 ATATGGGAGCAGCAGGAAATTGG + Intergenic
1001240232 5:170063320-170063342 CTCTGGGAACAGAAGGGAGCAGG + Intronic
1001408184 5:171491364-171491386 CTCTGAGACCAGAAGTGATTGGG - Intergenic
1001432462 5:171673768-171673790 CTTTGAGGCCAGAATGAAATTGG - Intergenic
1001515404 5:172351991-172352013 CTCTGGGGTGAGAAGGGAATGGG + Intronic
1001990235 5:176110598-176110620 CTCTGGGATGAGAAGGAACGAGG - Intronic
1002226637 5:177727542-177727564 CTCTGGGATGAGAAGGAACGAGG + Intronic
1002267206 5:178043671-178043693 CTCTGGGATGAGAAGGAACGAGG - Intronic
1002930047 6:1627395-1627417 CTCTGGGCTGAGAAGGAATTAGG + Intronic
1003497623 6:6678232-6678254 CCCTGGGACCATATGGAAACGGG - Intergenic
1004333114 6:14739678-14739700 TTCAGCGACCAGAAGGAAAACGG + Intergenic
1005071793 6:21868813-21868835 CTCTCAGACCCAAAGGAAATGGG - Intergenic
1007100223 6:39240852-39240874 CTCTGGCACCAGCTGGAGATGGG - Intergenic
1008282317 6:49611544-49611566 TTCTGGGTGGAGAAGGAAATGGG - Intronic
1008375651 6:50788084-50788106 TTCTGCAACCAGAAGGAAATTGG - Intergenic
1008918082 6:56811356-56811378 CCCTGCTACCAGAAGGAAATGGG + Intronic
1009789737 6:68386195-68386217 CTCTGGGAGCAGAGGGAACTAGG - Intergenic
1010391424 6:75342626-75342648 CTCTGGGACCATTAGGAAGGTGG + Intronic
1011098456 6:83694158-83694180 GTCCAGGAGCAGAAGGAAATGGG - Intronic
1011107320 6:83797181-83797203 CTCTGGGACAAGTTGGGAATTGG - Intergenic
1011908936 6:92410443-92410465 CTCTGGGAGCAGAGGGGAGTAGG - Intergenic
1012261700 6:97094890-97094912 CTCTGGCCACACAAGGAAATTGG + Intronic
1013340677 6:109212462-109212484 CTTATGGACCAGAAGAAAATAGG - Intergenic
1013431880 6:110063082-110063104 CTCTGAGAACAGAAGTAACTTGG + Intergenic
1015642947 6:135356411-135356433 GTCTGGGACCAGAGGGCACTGGG + Intronic
1015867174 6:137739363-137739385 CTCTTGGACCAGCAGGCAACAGG - Intergenic
1016863568 6:148745974-148745996 CTATGGGACGTGAAGGAAAAGGG + Intergenic
1017200288 6:151745888-151745910 CCTTGGGAGGAGAAGGAAATGGG - Intronic
1017417166 6:154233568-154233590 CTCTGGGTTCTGTAGGAAATTGG - Intronic
1018922353 6:168184116-168184138 CTCTGGGACCAGAAGGAGGAAGG + Intergenic
1019212549 6:170418278-170418300 CTCTGGGACCATTTGGAAAATGG - Intergenic
1019219305 6:170462039-170462061 GTCTGGGAGCTGAAGGAAGTGGG + Intergenic
1019290782 7:249023-249045 CTCTGTGCACAGAAGGACATTGG - Intronic
1019627364 7:2024506-2024528 CTATGGGAGTTGAAGGAAATTGG - Intronic
1021079630 7:16348512-16348534 CTCTGGAAGCAGAAGGGACTAGG + Intronic
1022016395 7:26352557-26352579 CTGTGGTAGCAGGAGGAAATAGG - Intronic
1023463893 7:40432292-40432314 CTCACTGACCAGAAGGGAATAGG - Intronic
1024164787 7:46720264-46720286 TTCTGGGGCCATAAGGATATCGG - Intronic
1024188578 7:46981378-46981400 TTCTGGGACCAAAAAGAATTGGG + Intergenic
1028636082 7:92990716-92990738 TTCTGGAGCCAGAAGGATATGGG - Intergenic
1028753645 7:94410434-94410456 CACTGGGACCAGGAGGACCTTGG - Exonic
1028952248 7:96649679-96649701 CACTGGGACCAGATGACAATGGG - Intronic
1029284482 7:99456411-99456433 CACTGGGAACAGCAGGAAGTGGG - Exonic
1030046895 7:105505416-105505438 CTCTGGGAAGGGGAGGAAATGGG - Intronic
1030521532 7:110603944-110603966 CTCTGGGACCCTAAGAGAATGGG + Intergenic
1030952059 7:115803021-115803043 ATCTGTGACCACAAGGAAAGAGG - Intergenic
1032088433 7:128896179-128896201 CCCCCCGACCAGAAGGAAATAGG + Intronic
1032139078 7:129310016-129310038 CTCTGGGACAGAAAGGAAAAAGG - Intronic
1032670033 7:134074172-134074194 CTCTGGGGTCAGGAGGAAAGAGG - Intergenic
1034570609 7:151952995-151953017 TTCTGGGGCCAGATGGTAATGGG + Intergenic
1036086209 8:5615907-5615929 CTTTGGGAACTGAAAGAAATAGG - Intergenic
1036235873 8:7039004-7039026 GTCTGGCTCCAGAAGGAACTAGG + Intergenic
1037334672 8:17780471-17780493 CACTAGGACAAGAAGGAAATGGG - Intronic
1037916173 8:22774822-22774844 ATATGGCAACAGAAGGAAATCGG - Intronic
1038425170 8:27460096-27460118 CCCTAGGACCAAAAGGAAACTGG + Exonic
1038818556 8:30931452-30931474 CTCTGGGAGCAGAAGGGATTAGG - Intergenic
1045649830 8:104331187-104331209 CTTGGGGAGCAGAAGGACATAGG - Intronic
1047655804 8:126975572-126975594 CTCTGGGGCCAGATGGATATGGG + Intergenic
1048453013 8:134550683-134550705 CTCTGGAAAAAAAAGGAAATTGG - Intronic
1048828523 8:138453483-138453505 GTCCGGGACCAGCAGGGAATGGG - Intronic
1049481395 8:142825423-142825445 CACCAGGACCAGAAGGAAAATGG - Intergenic
1050449328 9:5763305-5763327 CGCTGGGACAAGAAGGAATGGGG - Exonic
1052051919 9:23858790-23858812 CTTTGGAACCAAAAGGATATAGG - Intergenic
1052887084 9:33660159-33660181 CTCTGGGACCACATGGAAGTAGG - Intergenic
1053172185 9:35896042-35896064 CTTTGGGGCCAGAAGGAACCAGG + Intergenic
1056765300 9:89441421-89441443 GTCTGGGATCAGAAGGAAAGGGG + Intronic
1056769204 9:89464742-89464764 CTTTGGGTCCATTAGGAAATGGG + Intronic
1057921816 9:99104494-99104516 CGCTGGGAGCAGGAGGAAATAGG + Intronic
1057971882 9:99566631-99566653 GCCTGAGACAAGAAGGAAATTGG + Intergenic
1059113844 9:111583064-111583086 CTGTTGTACTAGAAGGAAATGGG - Intronic
1059266219 9:113033864-113033886 TTCAGGGACCAGGAGGAAAGAGG + Intergenic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061485574 9:130918968-130918990 TGCTGAGCCCAGAAGGAAATCGG + Intronic
1062169267 9:135125686-135125708 CTCTGTGTCCAGAAGGCAAAAGG + Intergenic
1187213792 X:17254919-17254941 CTCTGGGAACAGAAGGGACTAGG + Intergenic
1188014829 X:25097037-25097059 CCCTGGGAGCAGAAGGGACTTGG - Intergenic
1188857693 X:35217812-35217834 TTCTGGCCCCAGAAGGAAAGAGG - Intergenic
1192201341 X:69068575-69068597 CTGTGGGCCCTGAAGGAAAAAGG - Intergenic
1196131858 X:112165514-112165536 GTCTTGGCCCAGCAGGAAATAGG - Intergenic
1196464507 X:115958610-115958632 CTCAGGGAAGAGAAGAAAATTGG + Intergenic
1197245418 X:124161754-124161776 CTGTAGGTCCAGAAGCAAATAGG + Intronic
1197730236 X:129803723-129803745 CTCTGGGGGCAGGTGGAAATTGG - Exonic
1199548634 X:149034238-149034260 TTCTGGGACCAGCAAGCAATCGG - Intergenic
1200088448 X:153623347-153623369 CTCTGGGGCCCGAAGGATGTAGG - Intergenic