ID: 1151572844

View in Genome Browser
Species Human (GRCh38)
Location 17:74935885-74935907
Sequence CACCGACTGCGGGCGCTGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151572844_1151572852 11 Left 1151572844 17:74935885-74935907 CCGCTCAGCGCCCGCAGTCGGTG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1151572852 17:74935919-74935941 GCGATGCCTCTCCCGGCCTCAGG 0: 1
1: 0
2: 1
3: 16
4: 153
1151572844_1151572849 4 Left 1151572844 17:74935885-74935907 CCGCTCAGCGCCCGCAGTCGGTG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1151572849 17:74935912-74935934 GCCCACGGCGATGCCTCTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 93
1151572844_1151572858 28 Left 1151572844 17:74935885-74935907 CCGCTCAGCGCCCGCAGTCGGTG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1151572858 17:74935936-74935958 CTCAGGTAAGCCCGGAGCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 80
1151572844_1151572854 20 Left 1151572844 17:74935885-74935907 CCGCTCAGCGCCCGCAGTCGGTG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1151572854 17:74935928-74935950 CTCCCGGCCTCAGGTAAGCCCGG 0: 1
1: 0
2: 2
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151572844 Original CRISPR CACCGACTGCGGGCGCTGAG CGG (reversed) Exonic
901436072 1:9248178-9248200 CACGCACTGCGGGGGCTGGGGGG - Intronic
903921356 1:26803470-26803492 CACCCAGTCCGGGAGCTGAGGGG - Intergenic
905038196 1:34930440-34930462 CACAGGCTGCGGGAGCCGAGAGG + Intergenic
910694333 1:89995457-89995479 CGCCGGCAGCGGGCGCCGAGCGG - Intronic
920177080 1:204108669-204108691 CACCCACTGCGGGCGCAGGCCGG - Intronic
920853345 1:209644183-209644205 CACCTAGTGCAGGCGCTGGGTGG + Intronic
1065830397 10:29609355-29609377 CACCCTCTGCTGGTGCTGAGTGG + Intronic
1077778209 11:5294650-5294672 CACCGGCCGCGGGCAGTGAGGGG - Intronic
1077923031 11:6655656-6655678 CAGCGACTGCGGACGATGCGCGG - Exonic
1078514119 11:12008585-12008607 CGGCGGCTGCGGGCGCAGAGCGG - Exonic
1080600911 11:33819962-33819984 CACAGACTGCGGGTGTGGAGAGG - Intergenic
1082824522 11:57567926-57567948 CACCGGCGGCGAGCGCTCAGGGG + Intronic
1085703774 11:78768192-78768214 CACCCACTGCGGGAGCCAAGGGG - Intronic
1085982816 11:81744802-81744824 CACCGACCGGGTGCTCTGAGTGG + Intergenic
1087670674 11:101102840-101102862 CACGGACTGGGGGCAGTGAGGGG + Intronic
1088223232 11:107591230-107591252 CACTGGCTGCGGGCGCGGAAGGG - Exonic
1088927577 11:114317917-114317939 CACCCTCTGCTGGCGCTCAGAGG - Intergenic
1094536404 12:31325591-31325613 CACCGACCCCGGCCGCTGCGCGG + Intronic
1104475451 12:129067245-129067267 CACAGAGTGCTGGCCCTGAGGGG + Intergenic
1108648038 13:52450153-52450175 CGCCGTCTGCGGGCGCCGGGCGG - Intronic
1119203748 14:72778596-72778618 CACCGACTGGGGTCGGGGAGGGG - Intronic
1120968471 14:90187931-90187953 CACAGACTGTGGGCACTGATGGG + Intergenic
1121089142 14:91169297-91169319 CACCCACTACTGGCACTGAGAGG + Intronic
1123116659 14:105897893-105897915 CACCCACTCCTGGGGCTGAGGGG - Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132570463 16:641902-641924 AACGGACTGCGGGCGCCGCGGGG - Exonic
1138529020 16:57625048-57625070 CACAGACTCCGGGCTCAGAGAGG + Intronic
1141446556 16:84062517-84062539 CACTAACAGCGTGCGCTGAGAGG - Intronic
1143446792 17:7014663-7014685 CATCGACTGGGCGCGCCGAGCGG + Exonic
1148576983 17:48719281-48719303 CGCCGACTGCGGAGGCTGCGAGG - Intergenic
1148674832 17:49439115-49439137 GTCCGGCTGAGGGCGCTGAGCGG + Intronic
1150126692 17:62640625-62640647 CAGCTACTGCGGAGGCTGAGGGG - Intronic
1151572844 17:74935885-74935907 CACCGACTGCGGGCGCTGAGCGG - Exonic
1152785397 17:82245344-82245366 CACCGACGGCGGGGAGTGAGTGG + Intronic
1160567871 18:79798253-79798275 CCCGGACTCTGGGCGCTGAGCGG - Intergenic
1160982244 19:1821760-1821782 CACGTGCTGCTGGCGCTGAGCGG - Intronic
1163160183 19:15459648-15459670 CACCTACTGGGGAGGCTGAGTGG - Intronic
925022204 2:580209-580231 CTCCGTGTGAGGGCGCTGAGTGG + Intergenic
925258146 2:2507294-2507316 CACCTCCTGCAGGGGCTGAGGGG + Intergenic
926325876 2:11784939-11784961 CACCGACTGCGGGGACTGGTTGG - Exonic
926372063 2:12188677-12188699 CACCTACTCTGGGTGCTGAGGGG + Intergenic
930208719 2:48614424-48614446 CACCCAGTCCGGGAGCTGAGGGG - Intronic
942095597 2:172534328-172534350 CACAGACTGGGTGCGCTGAGGGG + Intergenic
945312927 2:208336116-208336138 GACCGACTGCAGTTGCTGAGGGG - Exonic
946832396 2:223740027-223740049 CACCCACTGGGGCCGCTGAGCGG + Intergenic
1172221247 20:33276545-33276567 CACAGACTGCAGGCACAGAGAGG + Intronic
1172843071 20:37913688-37913710 CAGGGACTGCTGGGGCTGAGAGG + Intronic
1173548182 20:43914909-43914931 CGCCCACCGCGGGCGCCGAGGGG - Exonic
1176547026 21:8206540-8206562 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176554931 21:8250749-8250771 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176565977 21:8389587-8389609 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176573852 21:8433774-8433796 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1179504015 21:41828128-41828150 CACCTGCTGCGGGCGGGGAGAGG - Intronic
1180988551 22:19919878-19919900 CAAAGGCTGCGGGCCCTGAGAGG - Intronic
1181726383 22:24813903-24813925 CAGCAACTGCGGGCCCTTAGGGG - Intronic
1183578256 22:38706159-38706181 CGGCGGCGGCGGGCGCTGAGGGG + Intronic
1203251901 22_KI270733v1_random:122825-122847 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203259952 22_KI270733v1_random:167908-167930 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
952970222 3:38645996-38646018 TACATTCTGCGGGCGCTGAGTGG + Intronic
967921334 3:194616612-194616634 CGCCGTCTGCAGGCGCTAAGAGG - Intronic
968235242 3:197027448-197027470 AACCGCCTGCGGCCACTGAGGGG + Intronic
973279123 4:48341400-48341422 GGCCGCCGGCGGGCGCTGAGAGG - Exonic
975131872 4:70839510-70839532 CAGCGACTGCGGCAGCAGAGAGG + Exonic
990895935 5:60700174-60700196 CGCGGGCTGCGGGCGCTGATTGG + Intronic
1006006078 6:31002703-31002725 CAAAGACTGAGGGAGCTGAGAGG - Intergenic
1012598852 6:101070373-101070395 CACCGACCCCGGGCAGTGAGGGG + Intergenic
1030347864 7:108454979-108455001 CACCGAGGGAGGGCGCCGAGCGG - Intronic
1037760004 8:21735541-21735563 CACCCACTGCTGGTGCTGAGTGG + Intronic
1039777293 8:40749604-40749626 CACCCACTGCAGGCTTTGAGGGG + Intronic
1042125182 8:65531059-65531081 CACTGACTGAGGCAGCTGAGAGG - Intergenic
1042962792 8:74321230-74321252 CACCTACTGCGGCGGCTGGGAGG - Exonic
1049694461 8:143976648-143976670 CGCCGCGTGCGGGCGCTGCGGGG - Intronic
1056580938 9:87887712-87887734 CACAGACTGAAGACGCTGAGGGG - Exonic
1059324743 9:113497383-113497405 CGGCGACTGCGGCCGCTGAGAGG + Exonic
1061565495 9:131436634-131436656 CAGCGACTCCGGCGGCTGAGAGG - Exonic
1061837044 9:133336332-133336354 CACCGACTCCGGGCGGAGATTGG - Exonic
1061881914 9:133572978-133573000 CACCGTCTGCAGGCGAGGAGAGG - Intronic
1062220293 9:135411322-135411344 CACCGCCTGGTGGAGCTGAGAGG - Intergenic
1203468303 Un_GL000220v1:105976-105998 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203476124 Un_GL000220v1:149948-149970 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1193775983 X:85642099-85642121 CACCCACTGGGGGCATTGAGGGG - Intergenic