ID: 1151572856

View in Genome Browser
Species Human (GRCh38)
Location 17:74935931-74935953
Sequence GCTCCGGGCTTACCTGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151572856_1151572865 17 Left 1151572856 17:74935931-74935953 CCGGCCTCAGGTAAGCCCGGAGC 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1151572865 17:74935971-74935993 AGCTTGCGCACCCCAGACACTGG 0: 1
1: 0
2: 0
3: 3
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151572856 Original CRISPR GCTCCGGGCTTACCTGAGGC CGG (reversed) Intronic
900673077 1:3868032-3868054 GATCCGGAGTTACCTGAGGGAGG + Exonic
901068084 1:6504142-6504164 GCTTCCTGCCTACCTGAGGCAGG - Intronic
901438433 1:9263391-9263413 GCGAGGGGCTTCCCTGAGGCAGG + Intronic
901842864 1:11964776-11964798 GCTCCTGGCTGACCTGCTGCCGG - Exonic
902577856 1:17389612-17389634 GCTCCTGGATTCCCTGAAGCCGG - Intronic
902738598 1:18418331-18418353 GCTCCGGGATTACCAGACACAGG - Intergenic
903664768 1:24999586-24999608 GCTCAGGGCTGACCTGGGCCTGG - Intergenic
905548492 1:38818123-38818145 GCTCCGGGCTTACCCGGAGCGGG - Intergenic
907475090 1:54700210-54700232 GCTCCGGGCAGAGCTGAGCCTGG + Intronic
912490754 1:110061422-110061444 GCTGGGGTCTTACCTGAGGGTGG + Exonic
912528956 1:110306351-110306373 GCTCTGGGCTCAGATGAGGCAGG - Intergenic
913581587 1:120232661-120232683 GCTCTGGGGTTACCTGTGGGTGG + Intergenic
913626590 1:120665727-120665749 GCTCTGGGGTTACCTGTGGGTGG - Intergenic
914248946 1:145906406-145906428 GTGCCAGGCTTCCCTGAGGCTGG + Exonic
914563519 1:148844108-148844130 GCTCTGGGGTTACCTGTGGGTGG + Intronic
914609308 1:149286117-149286139 GCTCTGGGGTTACCTGTGGGTGG - Intergenic
920377898 1:205519111-205519133 GCCCCGGGCTGGCCTCAGGCTGG + Intronic
1065483560 10:26216507-26216529 TCTCCGCGCTTTCCTGAGTCCGG + Exonic
1067704363 10:48596121-48596143 CCTCCTGGCTCAGCTGAGGCTGG + Intronic
1067919454 10:50438495-50438517 GCTGCTGTCTTACCTGAGGCTGG - Intronic
1072691398 10:97574378-97574400 GCTCCTGCATTTCCTGAGGCTGG - Intronic
1076548211 10:131260246-131260268 GCTCCGAGCCTACCTGAGACGGG + Exonic
1077339770 11:2021122-2021144 CTTCTGGGCTTTCCTGAGGCTGG - Intergenic
1077358674 11:2130184-2130206 GCTCCTGGCTGGCCTGAGGCTGG - Intronic
1079263757 11:18910457-18910479 GCTCCAGGGTTTCCTGAGGAAGG + Intergenic
1081685896 11:45042775-45042797 GATGGGGGCTTCCCTGAGGCTGG - Intergenic
1081854193 11:46293675-46293697 GCCCCGGGCTTGCATGGGGCTGG - Intronic
1081980193 11:47261347-47261369 GTTCCGGGCTGAGCTGGGGCAGG - Exonic
1082842168 11:57698719-57698741 GCCCTGGGCTGACTTGAGGCTGG - Exonic
1084979507 11:72821774-72821796 GCCCCGGGCCTCCCTGAGGTGGG - Intronic
1084980091 11:72824370-72824392 GCTCCTGCCCTGCCTGAGGCTGG - Intronic
1090424832 11:126600265-126600287 TCTCAAGGCTTACCTGGGGCAGG - Intronic
1090634117 11:128678533-128678555 ACATCGGGCTTACCTGATGCTGG + Intergenic
1090777648 11:129979426-129979448 GTTCGGAGCTCACCTGAGGCTGG + Intronic
1202822755 11_KI270721v1_random:76311-76333 CTTCTGGGCTTTCCTGAGGCTGG - Intergenic
1096431412 12:51546967-51546989 GCTAAGGGGTTACCTGAAGCTGG + Intergenic
1096594427 12:52685583-52685605 TCACCGGGCTCACCTGAGGCTGG + Intergenic
1103209551 12:119156596-119156618 GCTCCGGGAGTAGCTGCGGCTGG - Exonic
1105011848 12:132761605-132761627 GCCTGGGCCTTACCTGAGGCGGG + Exonic
1105932978 13:25069580-25069602 GCTCCGGGCTCACCGCAGCCCGG + Intergenic
1108032850 13:46254751-46254773 GCTGTGGGCTTAGCTGAGACTGG + Intronic
1117816956 14:59608567-59608589 GCTACAGACTTACCTCAGGCTGG + Intronic
1118726142 14:68630383-68630405 GCTCCAGGCTGACCTGCTGCAGG - Intronic
1121341241 14:93106387-93106409 GCTCTGGGCAGAACTGAGGCCGG - Intronic
1121626921 14:95392332-95392354 GTTCCGGGCTCAACTGAAGCTGG - Intergenic
1121776136 14:96592457-96592479 GCTCCGGGTATAACTTAGGCCGG - Intergenic
1122375932 14:101257434-101257456 GCCCAGGGCTCACCTGATGCAGG - Intergenic
1124018861 15:25902111-25902133 GCTGCAGGCTCATCTGAGGCTGG - Intergenic
1130508888 15:84571914-84571936 GCTGAGGGCTTTCCTGAGCCAGG - Intergenic
1132213172 15:100041468-100041490 GCTCCAGGACCACCTGAGGCTGG + Intronic
1132480882 16:165614-165636 GCTACGGGGGTCCCTGAGGCCGG + Intronic
1141664915 16:85461079-85461101 GCTCAGGGCTTGCCCGAAGCAGG - Intergenic
1142183988 16:88685891-88685913 GCTCCGGGGGTCCCTGAGCCGGG + Intronic
1142899044 17:3001062-3001084 GCTCCAGGCTGAAGTGAGGCTGG + Intronic
1142899083 17:3001260-3001282 GCTCCAGGCTGAAGTGAGGCTGG + Intronic
1146621578 17:34402486-34402508 GCTCAGGCCTGGCCTGAGGCCGG + Intergenic
1148261983 17:46192649-46192671 TCTCCGGGCTTCCCTGCTGCGGG - Exonic
1151572856 17:74935931-74935953 GCTCCGGGCTTACCTGAGGCCGG - Intronic
1152508620 17:80770421-80770443 GGTCCGGGCTCTCCTGAGGAAGG + Intronic
1161076513 19:2288427-2288449 GCTCAGGGCTTGTCTGAGGCCGG + Intronic
1162298658 19:9830890-9830912 TCTCCTGCCTCACCTGAGGCAGG + Intergenic
1163604412 19:18266198-18266220 GCCCCGGGCATACCTGGGGCAGG + Exonic
925617121 2:5754244-5754266 CCCCTGGGCTTGCCTGAGGCTGG - Intergenic
927142214 2:20138133-20138155 GGTCAGGGCTTGCCTGAGGTGGG + Intergenic
932598626 2:73109620-73109642 GCTGCGGGCTTATCTGAGCCTGG + Intronic
937001478 2:118471719-118471741 GCTCCTGGGTTGCCTGATGCAGG - Intergenic
937626322 2:124047869-124047891 GCTCTGGGCTTCCCTGATCCTGG - Intronic
938708452 2:133954595-133954617 GCTCCCTGTTTACCTGAGTCAGG + Intergenic
945721454 2:213422458-213422480 GCTCCTGGCTTGCCTTTGGCTGG + Intronic
948239359 2:236416650-236416672 GCTCCGGGCATGACTGCGGCTGG - Intronic
948270794 2:236671853-236671875 GCTCCTGGGTGACCTGAGGATGG + Intergenic
948919231 2:241053548-241053570 GCTCCGGGCTGCTCTGAGGATGG - Intronic
1171816049 20:29786972-29786994 CCTCAGTGCTTACCTAAGGCAGG + Intergenic
1171837192 20:30168124-30168146 GGTCCGGGCAGGCCTGAGGCTGG + Intergenic
1171846752 20:30281972-30281994 GGTCCGGGCAGGCCTGAGGCTGG - Intergenic
1172599623 20:36174938-36174960 GCTCTGGGGTTACATGGGGCTGG - Intronic
1176170911 20:63696035-63696057 GCTCAGGGCTTCTCAGAGGCAGG - Exonic
1180937361 22:19634517-19634539 GCCCCGGGCTTCCCAGAGGAGGG + Intergenic
1183581599 22:38729653-38729675 GGCCCGTGCTCACCTGAGGCTGG - Exonic
950649213 3:14396727-14396749 GCTCCATCCTTACCTGGGGCAGG - Intergenic
952425932 3:33174443-33174465 GCTCTGGGCTGCCCTGAGGGTGG - Intronic
954850286 3:53594275-53594297 CCTCAGGCCTTACCTGAGGATGG + Intronic
960480756 3:118186171-118186193 GCTCCGGGCTAACTTGAAGAAGG - Intergenic
961749272 3:129085955-129085977 CCTCCTGGCTTCCCTGAGGGCGG + Intergenic
962218283 3:133541591-133541613 GCTCAGGGCTTGGCTGGGGCTGG - Intergenic
965885814 3:173445832-173445854 GCTAAGGGCTTATCTGAGGTTGG - Intronic
968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG + Intronic
969444282 4:7235262-7235284 GCGCCAGGCTCAGCTGAGGCAGG + Intronic
972294173 4:37720709-37720731 TATCAGGGCTTACTTGAGGCTGG + Intergenic
977582000 4:98735829-98735851 GCACCAGGCTTCCCTGAGGTGGG - Intergenic
981660287 4:147158390-147158412 GCTCCCGGCCGTCCTGAGGCAGG + Intergenic
985619747 5:948017-948039 GCTCCGAGCTGCCCTGAGGATGG + Intergenic
985638701 5:1053073-1053095 GCTCAGGGCTGCCCTGGGGCTGG - Intronic
986596693 5:9430024-9430046 GCTGGGAGCTTAGCTGAGGCAGG + Intronic
986739593 5:10694492-10694514 GCTCTGTGCTTTCCTGAGGAGGG + Intronic
987099828 5:14581949-14581971 GCCCCAGGCTCACCTGCGGCGGG - Exonic
987321107 5:16770118-16770140 GCTCCTGGCTTGGCTGAGGCAGG + Intronic
988546780 5:32165126-32165148 GCAAGGGGATTACCTGAGGCAGG - Intronic
993234106 5:85280588-85280610 GATCAGGGCTTACTTGAGGTTGG + Intergenic
999030842 5:148289263-148289285 TTTACGGGCTTACCTGAGGTGGG + Intergenic
1007783660 6:44268371-44268393 GCTCCAGTCTTCTCTGAGGCTGG + Intergenic
1013422724 6:109980246-109980268 GCACCGAGCTTACCAAAGGCTGG - Exonic
1015938302 6:138424402-138424424 GCTGCGGCCGTACCTGGGGCCGG + Exonic
1016754553 6:147669657-147669679 GCGAGGGGATTACCTGAGGCTGG - Intronic
1017614695 6:156232490-156232512 GATGAGAGCTTACCTGAGGCTGG - Intergenic
1019427868 7:985872-985894 CCTCCTGGCTTCCCAGAGGCAGG + Intronic
1020347586 7:7182497-7182519 GCTCCGCCCTTCCCTGGGGCTGG + Intronic
1020679459 7:11219226-11219248 GCTCCCAGCTTTCCTCAGGCAGG + Intergenic
1024656043 7:51452045-51452067 ACTCCCGGCTTACATGAGTCTGG + Intergenic
1025023772 7:55499462-55499484 GCTCTGTGCTTTCCTGAGGGTGG + Intronic
1026398316 7:69982448-69982470 GCTCCAGGCTATCCTGAGGGGGG + Intronic
1029658150 7:101941049-101941071 GAGCCGGGCTTCCTTGAGGCAGG + Intronic
1029728981 7:102426881-102426903 TCCCCTGGCTTACCAGAGGCAGG - Intergenic
1033981413 7:147170454-147170476 GCTGTGGGCTTCCCTGGGGCAGG + Intronic
1034296005 7:149972971-149972993 GCACGGGGCTTACCTGGGACAGG - Intergenic
1035290453 7:157834714-157834736 GCTCCAGGCTCACTGGAGGCTGG - Intronic
1036964885 8:13285886-13285908 GCTCAGTGCTTGCCAGAGGCTGG + Intronic
1041737974 8:61131908-61131930 GCTCGGGGATTTCCTGAAGCTGG + Intronic
1048270600 8:133025242-133025264 TCTCTGAGCTTGCCTGAGGCAGG - Intronic
1049323877 8:142011797-142011819 GCTCCGGCCTTTCCTGTGTCAGG + Intergenic
1050026817 9:1343434-1343456 GCTCCGGGCTTTCCTGGGCTTGG + Intergenic
1053609277 9:39694794-39694816 GCTCAGTGTTTACCTGAGGTGGG + Intergenic
1053867116 9:42451066-42451088 GCTCAGTGTTTACCTGAGGTGGG + Intergenic
1054089038 9:60776694-60776716 GCTCAGTGTTTACCTGAGGTGGG - Intergenic
1054244247 9:62647603-62647625 GCTCAGTGTTTACCTGAGGTGGG - Intergenic
1054558373 9:66682151-66682173 GCTCAGTGTTTACCTGAGGTGGG - Intergenic
1059789946 9:117630896-117630918 CTTCCAGGCTTACCTGTGGCCGG + Intergenic
1189415325 X:40807605-40807627 GCTGCTGGCTTCCCTGAGGGTGG - Intergenic
1190222566 X:48521852-48521874 GCTCCGGGCTCTCTTTAGGCTGG - Exonic
1196425104 X:115561705-115561727 GCTCCGGGATTTCCTGAGTCCGG - Intronic
1200089794 X:153629187-153629209 GCTCCTGGAGTCCCTGAGGCAGG - Intergenic