ID: 1151576851

View in Genome Browser
Species Human (GRCh38)
Location 17:74956810-74956832
Sequence GAGAGGAAGCAGAAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1121
Summary {0: 1, 1: 0, 2: 8, 3: 115, 4: 997}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151576851_1151576859 9 Left 1151576851 17:74956810-74956832 CCTGGCTCCTTCTGCTTCCTCTC 0: 1
1: 0
2: 8
3: 115
4: 997
Right 1151576859 17:74956842-74956864 TGTGTGCAGTCCTTGCTGGGTGG 0: 1
1: 0
2: 1
3: 17
4: 219
1151576851_1151576869 28 Left 1151576851 17:74956810-74956832 CCTGGCTCCTTCTGCTTCCTCTC 0: 1
1: 0
2: 8
3: 115
4: 997
Right 1151576869 17:74956861-74956883 GTGGGGGTAGGGGCTGGACAGGG 0: 1
1: 1
2: 8
3: 107
4: 855
1151576851_1151576860 10 Left 1151576851 17:74956810-74956832 CCTGGCTCCTTCTGCTTCCTCTC 0: 1
1: 0
2: 8
3: 115
4: 997
Right 1151576860 17:74956843-74956865 GTGTGCAGTCCTTGCTGGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 159
1151576851_1151576857 5 Left 1151576851 17:74956810-74956832 CCTGGCTCCTTCTGCTTCCTCTC 0: 1
1: 0
2: 8
3: 115
4: 997
Right 1151576857 17:74956838-74956860 CAGCTGTGTGCAGTCCTTGCTGG 0: 1
1: 0
2: 0
3: 18
4: 187
1151576851_1151576863 16 Left 1151576851 17:74956810-74956832 CCTGGCTCCTTCTGCTTCCTCTC 0: 1
1: 0
2: 8
3: 115
4: 997
Right 1151576863 17:74956849-74956871 AGTCCTTGCTGGGTGGGGGTAGG 0: 1
1: 0
2: 3
3: 50
4: 416
1151576851_1151576868 27 Left 1151576851 17:74956810-74956832 CCTGGCTCCTTCTGCTTCCTCTC 0: 1
1: 0
2: 8
3: 115
4: 997
Right 1151576868 17:74956860-74956882 GGTGGGGGTAGGGGCTGGACAGG 0: 1
1: 0
2: 16
3: 149
4: 1242
1151576851_1151576858 6 Left 1151576851 17:74956810-74956832 CCTGGCTCCTTCTGCTTCCTCTC 0: 1
1: 0
2: 8
3: 115
4: 997
Right 1151576858 17:74956839-74956861 AGCTGTGTGCAGTCCTTGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 141
1151576851_1151576864 17 Left 1151576851 17:74956810-74956832 CCTGGCTCCTTCTGCTTCCTCTC 0: 1
1: 0
2: 8
3: 115
4: 997
Right 1151576864 17:74956850-74956872 GTCCTTGCTGGGTGGGGGTAGGG 0: 1
1: 0
2: 3
3: 30
4: 332
1151576851_1151576861 11 Left 1151576851 17:74956810-74956832 CCTGGCTCCTTCTGCTTCCTCTC 0: 1
1: 0
2: 8
3: 115
4: 997
Right 1151576861 17:74956844-74956866 TGTGCAGTCCTTGCTGGGTGGGG 0: 1
1: 0
2: 1
3: 41
4: 318
1151576851_1151576867 22 Left 1151576851 17:74956810-74956832 CCTGGCTCCTTCTGCTTCCTCTC 0: 1
1: 0
2: 8
3: 115
4: 997
Right 1151576867 17:74956855-74956877 TGCTGGGTGGGGGTAGGGGCTGG 0: 1
1: 2
2: 17
3: 209
4: 2085
1151576851_1151576862 12 Left 1151576851 17:74956810-74956832 CCTGGCTCCTTCTGCTTCCTCTC 0: 1
1: 0
2: 8
3: 115
4: 997
Right 1151576862 17:74956845-74956867 GTGCAGTCCTTGCTGGGTGGGGG 0: 1
1: 0
2: 1
3: 25
4: 250
1151576851_1151576865 18 Left 1151576851 17:74956810-74956832 CCTGGCTCCTTCTGCTTCCTCTC 0: 1
1: 0
2: 8
3: 115
4: 997
Right 1151576865 17:74956851-74956873 TCCTTGCTGGGTGGGGGTAGGGG 0: 1
1: 0
2: 4
3: 60
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151576851 Original CRISPR GAGAGGAAGCAGAAGGAGCC AGG (reversed) Intronic
900033100 1:385442-385464 GAGAGGAGGAAGAAGAAGCCAGG - Intergenic
900048936 1:530428-530450 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
900053941 1:615332-615354 GAGAGGAGGAAGAAGAAGCCAGG - Intergenic
900071167 1:772252-772274 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
900613769 1:3555226-3555248 GACAGCAAGCAGGAGGAGCTGGG + Intronic
900637528 1:3673240-3673262 GAGAGGCACTCGAAGGAGCCAGG + Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900780072 1:4612230-4612252 GAGAGGAAGCAGGAGAGGCACGG - Intergenic
901169884 1:7249149-7249171 GACAGAAAGCAAAAAGAGCCAGG - Intronic
901226325 1:7614841-7614863 AAGTGGATGCAGATGGAGCCAGG - Intronic
901240408 1:7689760-7689782 GAGAGCATGCAGAAGGAGTCAGG - Intronic
901300452 1:8196565-8196587 GAGAGGGAGAAGAGGGAGGCAGG - Intergenic
901534882 1:9875592-9875614 GAGTTGAAGCAGGAGTAGCCTGG - Intronic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
901715837 1:11153181-11153203 GAGTGGAAGGGGAAGGGGCCAGG + Intronic
901765237 1:11495778-11495800 GTGAGAAAGCAGAAGGACCTTGG - Intronic
901929282 1:12586416-12586438 GAGACGAAGCAGGAGAAGGCTGG - Intronic
902367086 1:15983052-15983074 CAGAGAAAGCAGAATCAGCCTGG - Intergenic
902405641 1:16181989-16182011 GGAAGGAAGCAGAGGCAGCCTGG + Intergenic
902541481 1:17158695-17158717 GAGAGCAAGCAGGAGGTACCAGG - Intergenic
902554521 1:17239078-17239100 GAGAGGAAGGAGGAGAAGCCAGG + Intronic
902919044 1:19655778-19655800 GGCAGGAAGCAGGAGGAGGCTGG - Intronic
903121163 1:21217881-21217903 GAGAGGAAGCAGACGGCACAGGG - Intronic
903545312 1:24120306-24120328 GAAAAGAACCAGAAGGAGGCTGG - Exonic
903653393 1:24934402-24934424 GAGGGGAGGGAGAAGGAGCAAGG + Intronic
903943322 1:26946390-26946412 GAGAGGACACAGAAGGAGCTGGG - Exonic
904035029 1:27554289-27554311 GAGAGGATGTAGCAGGGGCCAGG - Intronic
904045519 1:27606037-27606059 GAGAGAAAGGAGGAGGAACCTGG - Intergenic
904456336 1:30650403-30650425 GAGAGGCATCAGATGGAGCCAGG - Intergenic
904474557 1:30756678-30756700 GACAGGAAGCAGACGCAGGCAGG + Intronic
904799257 1:33081363-33081385 GACAGGAGGCAGAAGGGGCAGGG - Intronic
904819805 1:33234631-33234653 GAGAGGAAGCAGGAGGAACAGGG + Intergenic
904924879 1:34039636-34039658 GTGACAAGGCAGAAGGAGCCTGG + Intronic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
904994481 1:34620711-34620733 GTGAGGAAGCATAAGGTCCCAGG + Intergenic
905037127 1:34925536-34925558 GAGGGGAAGAAGCAGGAGCGAGG + Intronic
905115981 1:35641317-35641339 GAGAGGAAGCAGGGGAGGCCCGG - Intronic
905288978 1:36908385-36908407 GAGAGGGAGCAGGAGGACCCAGG - Intronic
905901430 1:41584229-41584251 GAGAGGAAGCCCCAGAAGCCAGG - Exonic
906129361 1:43446929-43446951 GGGAGGCAGCAGCAGGAGACAGG - Intronic
906212525 1:44019988-44020010 GAGAGGAAGCTGAGGAAGGCTGG + Intronic
906222155 1:44089301-44089323 GAAAGGAAGGAGAAGGAAGCAGG + Intergenic
906746548 1:48226038-48226060 GACAGGAAGAAGTAGGAGCAGGG + Intronic
907849792 1:58245249-58245271 AAGTGAAAGCAGAAGGTGCCTGG + Intronic
907865897 1:58398754-58398776 GACAGGAAGCAGAGGAAGGCTGG + Intronic
908020346 1:59892059-59892081 GACAGAAAGCAGGAGGTGCCAGG - Intergenic
908167606 1:61473888-61473910 GAGGGGAACCAGAGGGAGCCAGG - Intergenic
908287310 1:62621136-62621158 GAGAGGAAGAAGAGGGAGGAAGG + Intronic
908392433 1:63695893-63695915 TAGAGGCAGCAGAAAGAACCAGG + Intergenic
909455148 1:75841738-75841760 GAAAGGAAGAAGGAGGAGTCTGG + Intronic
910047065 1:82930860-82930882 GAGAGGAACCAGAAGTAGGCGGG - Intergenic
910474472 1:87591948-87591970 GAGTGACAGCAGAAGGACCCAGG - Intergenic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911094656 1:94045585-94045607 GAGAGAAAGCAGATGGATGCAGG + Intronic
912187327 1:107294016-107294038 GACAGGCAGCAGCAGTAGCCAGG + Intronic
912724932 1:112050650-112050672 GAGAGGAAGAGGAAGGAGACGGG - Intergenic
912894942 1:113576418-113576440 TCCAGGAAGCACAAGGAGCCAGG - Intronic
913182352 1:116334318-116334340 GAGAGGAAGGAAGAGAAGCCAGG - Intergenic
913211965 1:116589614-116589636 GGGAGGTGGCAGAAGGAGACAGG - Intronic
913996444 1:143654664-143654686 GAGTGGGACCAGCAGGAGCCTGG - Intergenic
914345417 1:146794581-146794603 GAGAAGAAGGAGAAGGACCTGGG + Intergenic
914376372 1:147077253-147077275 GAGTGGGACCAGCAGGAGCCGGG + Intergenic
914745581 1:150498786-150498808 GAGAGGAAGCGGAAGCAAGCTGG - Intronic
914916276 1:151821233-151821255 GAGAGGAAGTGGTAGGAGCAGGG + Intronic
915010277 1:152679036-152679058 GACAGGAGGCAGAAGTAACCTGG - Intergenic
915143263 1:153779672-153779694 GACAGGGAGGAGAAAGAGCCAGG - Intronic
915166847 1:153952690-153952712 GACAGGAAGCAGAAGCAGGTGGG + Intronic
915294988 1:154913953-154913975 GAGAGACAGCAGGAGGTGCCAGG - Intergenic
915342121 1:155182260-155182282 AGGAGGAAGTAGTAGGAGCCTGG + Intronic
915556549 1:156664043-156664065 GAAAGAAAGCAGAAGGAGAGGGG + Intergenic
915716770 1:157951511-157951533 GAGAGGGAACAAAAGGAGTCAGG - Intergenic
916002723 1:160632385-160632407 GACAGGAAGCAGTAGAAACCTGG - Intronic
916026662 1:160838938-160838960 AAGAGGAAGGAGAAGCAGTCAGG - Exonic
916636304 1:166673037-166673059 GATAGAAAGGAGAAGGAACCTGG + Intergenic
916889890 1:169105249-169105271 CAGTGGAAGCAGAAGCATCCCGG + Intergenic
917118203 1:171623469-171623491 GAGAGGAACCAGCATGAGACAGG + Intergenic
917304086 1:173608955-173608977 GAGAGGAAGGAGAAGGGGAAGGG + Intergenic
917403962 1:174683430-174683452 GACAGGAACAAGCAGGAGCCTGG + Intronic
917483451 1:175433120-175433142 GAGAGAAGACAGAAGGAGCCTGG + Intronic
917640647 1:176980263-176980285 GACAGGAAGGTGAGGGAGCCAGG + Intronic
917755521 1:178094183-178094205 GAGAGGACGCAGAAGAACCCGGG - Exonic
917963576 1:180164912-180164934 GAGAGGAAGCAGGAGGGGGTTGG + Intronic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
918270838 1:182897605-182897627 GGGAGGTAGAAGAAGGAGTCAGG + Intergenic
918448930 1:184640812-184640834 GTGAGGCAGAAGGAGGAGCCAGG - Intergenic
919535548 1:198783125-198783147 GAGAGGAAGCAGCAGAAGGGGGG + Intergenic
920123865 1:203678089-203678111 GAAAGGAAACAGGAGGGGCCCGG - Intronic
920371120 1:205479971-205479993 GAGGGGCAGGAGAAGAAGCCAGG + Intergenic
920834585 1:209497893-209497915 GAGAGCAGGCAGCAGGTGCCAGG + Intergenic
921183705 1:212652257-212652279 TAAAGAAAGCAGAGGGAGCCTGG + Intergenic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
921628364 1:217403324-217403346 GAGAGGGAGCTGGAGGAGCGGGG + Intergenic
922030563 1:221793647-221793669 TAGACCAAGCAGAAAGAGCCTGG + Intergenic
922255460 1:223889593-223889615 GAGAGGAGCAAGAAGAAGCCAGG - Intergenic
922696570 1:227733866-227733888 GAGTGGAACCCGAAGGGGCCTGG - Intronic
922949798 1:229549124-229549146 GAGAGGAAGAGAATGGAGCCTGG + Intronic
923148050 1:231211393-231211415 GGGAGGAAGCCGAGGCAGCCGGG + Intronic
924336664 1:242992462-242992484 GAGAGGAGCAAGAAGAAGCCAGG - Intergenic
924348712 1:243095267-243095289 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1062805311 10:415386-415408 GAGAGGCAGCAGGAGGAGGGAGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063312488 10:4967500-4967522 GAGAGGAAGCAGAAGCAACAAGG - Intronic
1063315444 10:5000065-5000087 GAGAGGAAGCAGAAGCAACAAGG + Intronic
1064099502 10:12451294-12451316 GAAAGGAGGGAGAAGGAGCTGGG + Intronic
1065497980 10:26349620-26349642 TAGAGGAAGGAGAGGAAGCCCGG + Intergenic
1065589565 10:27251514-27251536 GCGAGGAAGCAGAGGGCCCCAGG + Intergenic
1065610051 10:27463831-27463853 GAGAGGGTGCAGAAGTGGCCAGG + Intergenic
1065636667 10:27742221-27742243 GGGAGGAGGCAGAGGCAGCCAGG + Intronic
1065651656 10:27899155-27899177 GAGGGCAAGCAGAAGCAGACTGG + Intronic
1065860913 10:29871777-29871799 AAGATGAAGCAAAAGGAGCTGGG + Intergenic
1065967178 10:30779802-30779824 GAGAGGAAGCACAAGGAGGCAGG - Intergenic
1065980189 10:30887282-30887304 GTCAGGAGGCAGAAGGAGCCAGG - Intronic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1066727648 10:38409636-38409658 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1067192799 10:44085487-44085509 GAGGGGAAGGAGAAGCAGCTAGG - Intergenic
1067288831 10:44926949-44926971 AAGAGGAAGCACCAGAAGCCAGG + Intronic
1067491782 10:46714852-46714874 AAGACGAAGCAGAGGGGGCCGGG + Intergenic
1067516081 10:46945946-46945968 TAGAGGAGGCAGAAGGAATCTGG + Intronic
1067602877 10:47625524-47625546 AAGACGAAGCAGAGGGGGCCGGG - Intergenic
1067646167 10:48105864-48105886 TAGAGGAGGCAGAAGGAATCTGG - Intergenic
1067753311 10:48985854-48985876 CAGAGGCAGCAGAGGTAGCCAGG + Intergenic
1067980807 10:51082337-51082359 AATAGGAAGCAGAAGGACTCTGG + Intronic
1068010433 10:51442956-51442978 GACAGAAAGCAGAAGCTGCCAGG + Intronic
1068544097 10:58327144-58327166 GCGAGGACGCCGCAGGAGCCGGG - Intergenic
1069721101 10:70549872-70549894 GAGAGGAAGCAGAGCCAGCTAGG + Intronic
1069874854 10:71555564-71555586 GAGAAGATGCAGGGGGAGCCTGG + Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070466783 10:76732028-76732050 GAGAGGAAAAAGAAGGGGGCTGG - Intergenic
1070647873 10:78214029-78214051 GAGAGCAAGCAGCATGAGGCTGG - Intergenic
1070773802 10:79098296-79098318 GAGAGAAGGCAGAAGCTGCCTGG + Intronic
1070827977 10:79402127-79402149 CAGAGGAGGCAGAAGGTCCCTGG + Intronic
1071040647 10:81305590-81305612 GAGATGAATCAGAAGAAGGCAGG + Intergenic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071572675 10:86706597-86706619 GAGAGGCAGCAGCAGGTGGCTGG - Intronic
1071746594 10:88426742-88426764 GACAGTAAGGAGGAGGAGCCAGG + Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072309559 10:94141465-94141487 GAGAGGGAGGAGAAGGAGAAGGG + Intronic
1072479572 10:95797659-95797681 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1072535296 10:96357947-96357969 GAGAGGAAGGAGGAAGAGACAGG + Intronic
1072614159 10:97038376-97038398 AAGAGGCTGCAGCAGGAGCCCGG - Intronic
1072709030 10:97703640-97703662 GCCAGGAGGCAGAAGGAGCAAGG + Intergenic
1072826247 10:98609781-98609803 CATAGGAAACAGCAGGAGCCTGG - Intronic
1073140329 10:101242946-101242968 AAGAGAAAACAGCAGGAGCCAGG + Intergenic
1073305381 10:102499740-102499762 CAGAAGAAGCACAAAGAGCCTGG + Intronic
1073424813 10:103449971-103449993 GAGAGGAGGCAGGAGGAGACGGG + Exonic
1073597737 10:104817443-104817465 GAGAGGAGGAAGAAGGAGAAGGG - Intronic
1073779099 10:106817412-106817434 GTGGGGAAGCAGGAGGGGCCTGG - Intronic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1074739480 10:116470966-116470988 GAGAGACAGCAGGGGGAGCCAGG + Intronic
1074898435 10:117796433-117796455 GAGAGAAAGCAGAAGGGGCAGGG - Intergenic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075278034 10:121112929-121112951 GAGAGGGAGGTGAAGGTGCCAGG + Intergenic
1075410325 10:122223019-122223041 GAGAGGAGGAGGAAGGAGACAGG - Intronic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075453325 10:122568505-122568527 GAGAGGAAGAAGGAGGAGTGAGG + Intronic
1075748130 10:124742728-124742750 GAGCGGGTGCAGATGGAGCCAGG - Intronic
1075762917 10:124870310-124870332 GAGAGGAAGCGGGAGGAGCAGGG + Intergenic
1076369862 10:129945221-129945243 GAAAGGAAGCAGAGGGAGGGAGG + Intronic
1076704511 10:132293856-132293878 CCGGGGACGCAGAAGGAGCCAGG + Intronic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076796001 10:132798813-132798835 GTGAGGTAGGAGAAGGGGCCTGG + Intergenic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076886413 10:133264826-133264848 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886455 10:133265024-133265046 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886509 10:133265263-133265285 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886519 10:133265303-133265325 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1076897907 10:133323142-133323164 GAGAGGAAGCAGGAGAAGGATGG - Intronic
1076975280 11:167029-167051 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1077160300 11:1109621-1109643 GAGGGAAAGGAGAATGAGCCCGG - Intergenic
1077251572 11:1563130-1563152 GAGGCCAGGCAGAAGGAGCCTGG + Intronic
1077724693 11:4662274-4662296 GAGAGGAAGGAGAGGGAGGGAGG - Intergenic
1077795715 11:5489475-5489497 GTGAGGAAGGAGAAGAAGGCAGG - Exonic
1078110468 11:8388024-8388046 GAGAGGAACCAGCAGAAGCCTGG + Intergenic
1078846356 11:15122305-15122327 GATTGGAAGAAGAAAGAGCCTGG + Intronic
1079333417 11:19551691-19551713 GAGAGGAAGCAGGACGTGGCTGG - Intronic
1080160118 11:29163620-29163642 GAGAGGCAGCAGAAGTAGAATGG + Intergenic
1080222737 11:29924861-29924883 GAGTGGGACAAGAAGGAGCCTGG - Intergenic
1080747962 11:35126196-35126218 GCCAGGAAGCAGATGGAACCTGG - Intergenic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1081540546 11:44031571-44031593 GAGAGGGAGCAGGAGGAGGTGGG + Intergenic
1081683761 11:45027101-45027123 GAGAGGGAGGAGAGGGAGACAGG - Intergenic
1082284189 11:50301781-50301803 AAGAGGCAGCAGAGGGAGCAGGG - Intergenic
1082637455 11:55613892-55613914 GAAAGGAGGCAGAGGGAGACAGG - Intergenic
1083148134 11:60773644-60773666 GATAGGCATCAGAAGGAGCAAGG + Intronic
1083190698 11:61050026-61050048 GAGCTGGAGCAGAGGGAGCCAGG - Intergenic
1083197706 11:61098980-61099002 TACAGGAAGCCCAAGGAGCCAGG + Intergenic
1083263659 11:61536368-61536390 GTGAGGGAGCAGAAGCAGGCTGG - Intronic
1083294891 11:61709982-61710004 GAGAGGAGGCAGCAGGACCAGGG + Intronic
1083593581 11:63908756-63908778 GGGAGGGAGCAGGAGCAGCCAGG - Intronic
1083714936 11:64569732-64569754 GAGAGGAGGCAGCAGGGGCAGGG - Exonic
1083813835 11:65120772-65120794 GAGAAGAAGAAGAAGAAGACAGG - Exonic
1083829505 11:65222442-65222464 GAGAGGAGGAAGAAGGATCTGGG - Intergenic
1084010077 11:66342943-66342965 AAGAGGAAGCAGAAGGAGATGGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084612432 11:70212181-70212203 GAGAGGAAACAGCAGGGGCAAGG - Intergenic
1084639283 11:70414823-70414845 GAGAGGAAGCAGGATGCGGCGGG + Intronic
1084764291 11:71298098-71298120 GAGAGGAAGCAGAGGCAGTCAGG - Intergenic
1084768212 11:71325953-71325975 GAGAGGCCTCAGGAGGAGCCAGG + Intergenic
1085533495 11:77205000-77205022 GAGTGGTGGCTGAAGGAGCCTGG + Intronic
1085803184 11:79610848-79610870 GAGAGGAACAAGAATGAGCATGG + Intergenic
1085863560 11:80261842-80261864 GGGAGGAAGCAGAAGCAGAGGGG - Intergenic
1085931554 11:81089343-81089365 GGGAGGAAGCAGAAGGAAGGAGG - Intergenic
1086458656 11:86984108-86984130 GAGATGAAGCAGGAGGAGAGGGG + Intergenic
1087091129 11:94274340-94274362 GAAAAGATGCAGCAGGAGCCAGG - Intergenic
1087144246 11:94796499-94796521 GATTGAAAGGAGAAGGAGCCAGG + Intronic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1087679364 11:101202346-101202368 GAGTGGAGGCAGAAGGAGCCAGG - Intergenic
1088085860 11:105979540-105979562 GAAAGGAAGCAGAAAGAACGCGG - Intronic
1088689265 11:112311411-112311433 GTGAGGGAGCAGAATGAGCCAGG + Intergenic
1089308850 11:117544613-117544635 GAGAGGAAGAAGGATGGGCCTGG - Intronic
1089621633 11:119726114-119726136 GAGAGGAAGAGGGAGGGGCCTGG - Intronic
1089768148 11:120783472-120783494 GAGAGGGAGCAGAGGGAGAAAGG - Intronic
1090235079 11:125141048-125141070 GAAAGGAGGCAGAAGGAACTAGG - Intergenic
1090660022 11:128875562-128875584 TAGAGGAAGGAGAAGCAGCATGG + Intergenic
1090745215 11:129699838-129699860 CAGAAGTGGCAGAAGGAGCCGGG - Intergenic
1091694920 12:2622042-2622064 GAGAGGAAGGAGAAGGAAAGGGG + Intronic
1091781813 12:3218649-3218671 GAAAGGAAGGAGAAGGCACCAGG + Intronic
1091796273 12:3299076-3299098 GAGAGGAAGAAGAAGGTGGCGGG - Intergenic
1091833413 12:3567100-3567122 GAGGGGAAGCAGATAGGGCCAGG - Intronic
1091974201 12:4811443-4811465 GAGACGGAGCAGGAGGAGCAAGG + Exonic
1091990339 12:4950088-4950110 GAGAGGAGGCAGAGGCAGCTAGG + Intergenic
1092766390 12:11856653-11856675 GAGAGGAAGTAGCTGGAGGCAGG - Intronic
1092776269 12:11947364-11947386 GGGAGGAAACAGAAGGAACCAGG + Intergenic
1093257377 12:16886700-16886722 GGGAGCAGGTAGAAGGAGCCAGG - Intergenic
1093815028 12:23535124-23535146 AAGATGAAGCAGAAGAACCCAGG + Intronic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094371584 12:29744245-29744267 AAGATGAAGCAGAATGAACCAGG + Intronic
1094487555 12:30937107-30937129 GAGATGAAGCAGGAGGAGATAGG + Intronic
1095771899 12:45969244-45969266 GCGGGGAATCAGAAGTAGCCAGG + Intronic
1095859834 12:46904812-46904834 GTGAGGACTTAGAAGGAGCCTGG - Intergenic
1096109783 12:49021686-49021708 GAGAGGTAGCAGCCAGAGCCAGG - Exonic
1096149468 12:49299564-49299586 AAGAAGAAGAAGAAGAAGCCCGG + Intergenic
1096261394 12:50094411-50094433 GACAGGAAACCAAAGGAGCCTGG - Intronic
1096439295 12:51626057-51626079 GTCAGGAGGCAGAAGGAGCGAGG + Intronic
1096448524 12:51717082-51717104 GTCAGGAAGCAGAAGGAGTGAGG - Intronic
1096559318 12:52424435-52424457 GAGAGGAAGGAGGAGGACCCTGG + Exonic
1096815619 12:54200095-54200117 GGGAGGAAACAGGAGGAGCCAGG + Intergenic
1096843239 12:54391431-54391453 GGGAGGAAGCGGGAGGGGCCAGG - Intergenic
1096863478 12:54547068-54547090 GAGAGGAATGAGAAGGAGCCTGG + Exonic
1098191430 12:67953250-67953272 GGGAGGAGGGAGAAGGAGGCTGG + Intergenic
1098194935 12:67989723-67989745 GGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098850388 12:75589100-75589122 GGGAGGAAGCTGGAGGAGACTGG - Intergenic
1099163857 12:79277014-79277036 AAGAGGAAGAAGAAGGAGAAGGG + Intronic
1099334990 12:81344153-81344175 GTCAGGAGGCAGAAGGAGCAGGG - Intronic
1099379781 12:81939605-81939627 TGGAGGAAGGAGAAGGAGACAGG - Intergenic
1099509681 12:83518274-83518296 GAGGGGAAGCACACAGAGCCTGG - Intergenic
1099538819 12:83879112-83879134 GAGAGGAAACAGAAGCCTCCAGG - Intergenic
1099888126 12:88556668-88556690 GAGAAGAGGCAGCAGGAGTCTGG + Intronic
1100013423 12:89980481-89980503 GAGAGGAAGTTGGAGGAGGCTGG - Intergenic
1100197220 12:92260529-92260551 GAGAGGAAGCTGGAAAAGCCTGG - Intergenic
1100778116 12:97994544-97994566 GAGAGAAAGAAAAAGGAGCCTGG - Intergenic
1100887483 12:99087398-99087420 CGGAGGAAGCAGAATGATCCAGG + Intronic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101329502 12:103746092-103746114 GGGAGGAGGCAGAAGGAACAGGG - Intronic
1101387169 12:104268149-104268171 GAGAGAAAGAGGAAGGGGCCGGG - Intronic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101585654 12:106083226-106083248 GAGAGGGAGAAGTAGGAGACAGG + Intronic
1101711900 12:107275517-107275539 GAGAGGAACCCCAAGGAGTCAGG + Intergenic
1101979984 12:109397617-109397639 GAGAGAGAGCGGAAGGAGCCAGG - Intronic
1101986502 12:109451495-109451517 CAAGGGAAGCAGAAGGGGCCCGG + Exonic
1102109520 12:110354272-110354294 GGGAGGAAGCAGAGGAAGCAAGG + Intergenic
1102548674 12:113674961-113674983 GAGAGGTGGCAGAGGGAGGCCGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102720570 12:115012854-115012876 GTGAAGAAGAGGAAGGAGCCAGG - Intergenic
1102733541 12:115136712-115136734 AAGATGAAGAAGAAGGAGCAAGG + Intergenic
1102799154 12:115716469-115716491 TAAAGGAAGCAGGAGGAGGCTGG + Intergenic
1103060689 12:117856027-117856049 GAGAGGAAGCAGAGAGAGAGTGG - Intronic
1103192887 12:119017519-119017541 GATGGGAAGCAGCAGGAGGCTGG + Intronic
1103237232 12:119383559-119383581 GTGCGAGAGCAGAAGGAGCCAGG + Intronic
1103359762 12:120346638-120346660 GAACGGAGGCAGGAGGAGCCCGG - Intronic
1103401903 12:120649051-120649073 GAGATGGAGGAGGAGGAGCCTGG - Intronic
1104035520 12:125094668-125094690 GAGAGCAGGCAGAAGGAGGTGGG - Intronic
1104101435 12:125616377-125616399 GAGAGGCAGAAGAGGAAGCCTGG + Intronic
1104316200 12:127704281-127704303 AAGAGGAAGCAGAAGAAACAAGG + Intergenic
1104378372 12:128285574-128285596 GAGAGGAACCAGCCGGACCCAGG + Intronic
1104718665 12:131032600-131032622 GAGAGGAAGCAGAGGGGCCCTGG - Intronic
1104721876 12:131048944-131048966 GAAAGGAAGCACAAGGAGAATGG + Intronic
1105215212 13:18280240-18280262 GGGAGGTGGCAGAAGGAGACAGG - Intergenic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1106012291 13:25836505-25836527 GGGAGGACGCAGAAGGAGAAGGG - Intronic
1106131558 13:26943925-26943947 GAGAGGAAGGAAGAGAAGCCAGG - Intergenic
1106138070 13:26989555-26989577 GAGGGGCAGCAATAGGAGCCTGG + Intergenic
1106328969 13:28721247-28721269 GAGAGGAAGCAGGGAGGGCCAGG + Intergenic
1106633126 13:31498056-31498078 GACAGGAGGCAGAGGGAGCAAGG + Intergenic
1106788156 13:33127929-33127951 GAGAGGAAAGAGACGGAGACAGG + Intronic
1106864645 13:33950019-33950041 GAGAGAAAGCAGAGAGAGACAGG - Intronic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1107319629 13:39171794-39171816 GAGAGGAAGCAGTCTGAGCCGGG + Intergenic
1107424197 13:40276399-40276421 AACAGGCAACAGAAGGAGCCCGG + Intergenic
1107561946 13:41565162-41565184 GACAGGCACAAGAAGGAGCCAGG + Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1107859838 13:44650292-44650314 GAGAGGGAGCAAAAGAAGGCAGG - Intergenic
1110440489 13:75520725-75520747 CATAGGTACCAGAAGGAGCCAGG - Intergenic
1110549211 13:76792905-76792927 GGCAGGAAGCAGAATGAGCCAGG + Intergenic
1111717988 13:91904732-91904754 GAGAGGAAGCTGAGTAAGCCTGG + Intronic
1112120147 13:96401111-96401133 GGGAGGGTGCAGAAGGAGGCTGG + Intronic
1112182929 13:97103195-97103217 GAGAGAAAGCAGGAGGTGTCAGG + Intergenic
1112380261 13:98882295-98882317 GAGAGGAGTCAGAGGGAGCTGGG + Intronic
1112626572 13:101111468-101111490 GGGAGGAGGCAGAAGGAGGAGGG - Intronic
1112676268 13:101705697-101705719 GAGGGGGAGCAGATGGAGCAAGG + Intronic
1113077427 13:106480864-106480886 GAGATGAGGGAGGAGGAGCCAGG + Intergenic
1113203178 13:107888918-107888940 GACAGGAAGATGAGGGAGCCTGG - Intergenic
1113635007 13:111913390-111913412 GAGAGGGAGGAGGAGAAGCCTGG - Intergenic
1113792677 13:113037663-113037685 GAGAGGCTGCAGAGGCAGCCAGG + Intronic
1113909507 13:113835557-113835579 CAGAGGCAGGAGTAGGAGCCGGG + Exonic
1114222003 14:20705010-20705032 GAGAGGTAGCAGAAGGGGGCAGG - Intergenic
1114553608 14:23548742-23548764 GAGAGAAAGCAGAAATATCCAGG - Intronic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1114873865 14:26691082-26691104 GAGAGGGAGGAGAAGGACACAGG - Intergenic
1115500767 14:34047547-34047569 GAGAGAGAGGAGAAGGTGCCAGG + Intronic
1116243873 14:42383016-42383038 GAGAGGAATGAGAAGCAGGCTGG - Intergenic
1116433063 14:44868504-44868526 CATAGGAAGGAGAAAGAGCCAGG + Intergenic
1116957839 14:50943202-50943224 GAGAGGAAACTGGAGAAGCCAGG - Intronic
1117232851 14:53739438-53739460 TTGAGGAAGGAGAAGGAGCAAGG + Intergenic
1117450839 14:55848277-55848299 GAGAGGAAGGAGATAGAGACTGG - Intergenic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1118288698 14:64501791-64501813 GAGGGGAATGTGAAGGAGCCAGG - Intronic
1118516334 14:66532407-66532429 CAGAGGAAGCAGAAGATGCCAGG + Intronic
1119143691 14:72291088-72291110 GAGATCAAGCAGAAGGATCTAGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119594058 14:75917628-75917650 GAGAGGGAGGATAAGGAGCAAGG + Intronic
1119601750 14:75981325-75981347 AAGAAGAAGCAGAAGGACCATGG + Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1120055611 14:79920393-79920415 GAGATGCAGCAGAAGGTGTCGGG + Intergenic
1120404360 14:84076053-84076075 AAGAGGAGGCAAAAGGAGCAGGG - Intergenic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1120868745 14:89318452-89318474 GAGAGAAAGAAAAAGGGGCCGGG - Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121688490 14:95857349-95857371 TGGAGGCAGCAGAAGGGGCCTGG - Intergenic
1121731500 14:96190394-96190416 AACAGGACCCAGAAGGAGCCTGG - Intergenic
1121781352 14:96624389-96624411 GAGAGGAAGGAGACGGGGTCAGG - Intergenic
1121847849 14:97189566-97189588 GAGAGGAATCAGAAGGAAAAGGG - Intergenic
1121905790 14:97741542-97741564 GAGAGGAAGGAGAAGCAGTGTGG - Intergenic
1122027508 14:98888377-98888399 GAGAGGAGGAGGAGGGAGCCAGG - Intergenic
1122156375 14:99752786-99752808 GGGAGGAAGCACAGGGGGCCTGG + Intronic
1122611190 14:102984611-102984633 CAGAGCAAGCGGGAGGAGCCTGG + Intronic
1122935429 14:104953843-104953865 GTGAGGAGGTGGAAGGAGCCGGG - Exonic
1123072016 14:105646639-105646661 GGTAGGAAGCAGGAGGAGCAGGG - Intergenic
1123108839 14:105855855-105855877 GAGAGGGAGCCGAAGGGGGCGGG - Intergenic
1123738463 15:23210144-23210166 GAGAGGAAGCTGAGTAAGCCTGG + Intergenic
1123858159 15:24435337-24435359 GATTGGTTGCAGAAGGAGCCTGG + Intergenic
1123862789 15:24485796-24485818 GATTGGTTGCAGAAGGAGCCTGG + Intergenic
1123898339 15:24850701-24850723 CAGATGAGGTAGAAGGAGCCTGG + Intronic
1124289673 15:28438808-28438830 GAGAGGAAGCTGAGTAAGCCTGG + Intergenic
1124293548 15:28478503-28478525 GAGAGGAAGCTGAGTAAGCCTGG - Intergenic
1124412672 15:29449427-29449449 GACAGGAAGAAGAAGGAGCTTGG + Intronic
1125152768 15:36551978-36552000 GAGAGGAAAGAGAAAGAGCTTGG + Intergenic
1125182128 15:36888917-36888939 GTGAGGAGGCAGGAGGATCCTGG + Intergenic
1125916790 15:43494818-43494840 GGGAGGAAGCAGAAGCAGGCTGG - Intronic
1125999384 15:44195015-44195037 GAGCGGCAGCAGCAGGAGCCTGG - Exonic
1126244295 15:46486139-46486161 GAGAGGAAGCAGGATGTGCAAGG - Intergenic
1126297311 15:47154911-47154933 CAGAGGAAGTAGAAAGAGCTTGG + Intergenic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126755697 15:51923089-51923111 GTGAAGAGGCAGAAGGGGCCAGG + Intronic
1127069935 15:55279136-55279158 TAGAGACAGCAGAAAGAGCCAGG + Intronic
1127278938 15:57472344-57472366 GAGAGGAAGTAGAAGCAGATAGG + Intronic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1127798175 15:62455776-62455798 GAGAGATAGCAGAAGGGGACTGG - Intronic
1127904015 15:63362849-63362871 GAGAAGAGACAGAAGTAGCCAGG - Intronic
1128217486 15:65944516-65944538 GAGAGGCAGCAGCAGGAGCCTGG + Intronic
1128557463 15:68641466-68641488 GGGAGGAAGCAGAAGGAGCAGGG + Intronic
1128727792 15:70000594-70000616 GAGAAGAAGCAAGAAGAGCCAGG + Intergenic
1129271657 15:74422258-74422280 GATGGGAAGCAGGGGGAGCCAGG - Intronic
1129274193 15:74434479-74434501 GAGAGGGAGGGGAAGGAGCCAGG - Intergenic
1129718543 15:77865481-77865503 GAAGGGAAGCAGCAGGACCCGGG - Intergenic
1129773603 15:78218490-78218512 GACACAGAGCAGAAGGAGCCTGG + Intronic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1131862644 15:96670563-96670585 GGGAGGCAGCAGAAGGAGTTGGG + Intergenic
1132240267 15:100252483-100252505 GCCAGGAAGCAGGAGGAGCACGG + Intronic
1132784563 16:1648663-1648685 GGGCGGCAGCAGAAGGAACCAGG - Intronic
1132907801 16:2292191-2292213 GAGAAGAAGCAGAAAGAGCTGGG - Exonic
1132932308 16:2464890-2464912 GAGAGAAAACAGAGGGAGCCAGG - Exonic
1133327255 16:4949272-4949294 GAGAGCACGGAGGAGGAGCCAGG - Intronic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134567579 16:15264659-15264681 GAGAGAAGGAAGAAGGAGACAGG - Intergenic
1134734909 16:16492011-16492033 GAGAGAAGGAAGAAGGAGACAGG + Intergenic
1134932613 16:18220208-18220230 GAGAGAAGGAAGAAGGAGACAGG - Intergenic
1135116158 16:19725004-19725026 GAGGCAGAGCAGAAGGAGCCCGG - Intronic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135256103 16:20942637-20942659 GAGAGGAAGCGGGTGGAGTCAGG + Intronic
1136360818 16:29778581-29778603 GAGAAGTTGCAGAAGGAGTCGGG - Intronic
1136472479 16:30490509-30490531 GTGAAGAGGCAGGAGGAGCCAGG - Intronic
1136548178 16:30966932-30966954 AAGACGAAGCTGAAGGAGCCTGG + Exonic
1136709004 16:32217841-32217863 GAGAGGAAGCTGAGTAAGCCTGG - Intergenic
1136758905 16:32711583-32711605 GAGAGGAAGCTGAGTAAGCCTGG + Intergenic
1136809202 16:33158801-33158823 GAGAGGAAGCTGAGTAAGCCTGG - Intergenic
1136815678 16:33268881-33268903 GAGAGGAAGCTGAGTAAGCCTGG - Intronic
1137502478 16:49022247-49022269 GAGAGGAAGCAGGAGGAAAAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1137783162 16:51114677-51114699 TAGAGGAAGCAGTAGGAACCCGG - Intergenic
1137822108 16:51456062-51456084 GAGAAGAAGAAGGAGGAGCAGGG + Intergenic
1137840628 16:51637477-51637499 GAGAGGGAGAAGAAGGAGGGGGG + Intergenic
1137948179 16:52755975-52755997 CAGAGTAACCAGGAGGAGCCAGG + Intergenic
1137966567 16:52940030-52940052 GAGAGAAGGCAGAAAGAACCCGG - Intergenic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138554659 16:57764484-57764506 GAGAGAGAGCAGGAGGAGCTGGG - Intronic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1139237380 16:65354514-65354536 CAGAGGAAGGATAAGGAGCTGGG - Intergenic
1139356682 16:66371064-66371086 AGGAGGAAGCAGAAGGGGCCAGG + Intronic
1140134670 16:72195371-72195393 GAGAGGGAGCAGAAGCGGGCAGG - Intergenic
1140420839 16:74817518-74817540 CAGAGAAAGCAGCAGCAGCCAGG - Intergenic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141882195 16:86867492-86867514 GAGAGGGAGCAGAAAGAGCAAGG - Intergenic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142444980 16:90130630-90130652 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1203061061 16_KI270728v1_random:971908-971930 GAGAGGAAGCTGAGTAAGCCTGG + Intergenic
1142462530 17:104836-104858 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1142553255 17:753479-753501 GAGATGAGGAAGAAGGAGGCTGG + Intronic
1142796786 17:2314152-2314174 TTGAGAATGCAGAAGGAGCCGGG + Intronic
1142941083 17:3380210-3380232 GGGAGGAAGCAGAAGAATCATGG + Intergenic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143411702 17:6713253-6713275 GAGTGGCAGCAGCAGGAGCGGGG + Exonic
1143478913 17:7217629-7217651 GAGAGGAAGCAGGGGGAGGGAGG + Intronic
1143649909 17:8256960-8256982 GAGAGGAAGGAGATGGAACCTGG - Exonic
1144140265 17:12341216-12341238 GGCAGGAAGCAGGAGGAACCTGG + Intergenic
1144209726 17:13003901-13003923 GAGAGGGAGCAGGAGGAGGCAGG - Intronic
1144346555 17:14354785-14354807 GAGAGGAAGCAGAAGTGGGCAGG - Intergenic
1145000831 17:19303469-19303491 GAGAGGCAGCAGACAGATCCAGG - Intronic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1146184898 17:30718333-30718355 GAGACGAAGGAGAAGGTGTCGGG + Intergenic
1146224061 17:31050763-31050785 GTGAGGAAGCAGAGGGCCCCAGG + Intergenic
1146229660 17:31095873-31095895 GAGAGGAAGCTGAAGAAACTGGG - Intronic
1146380410 17:32323378-32323400 GGGAGGATGCAGAAGGAGTCAGG + Exonic
1146506024 17:33406053-33406075 GTCAGGAGGCAGAAGGAGCCAGG - Intronic
1146884110 17:36459504-36459526 ATGAGGAAGGAGATGGAGCCTGG + Intergenic
1147167054 17:38599132-38599154 GAGAGGAGGTAGAGAGAGCCTGG + Intronic
1147265036 17:39229511-39229533 GAGACGAGGCGGAAGCAGCCTGG + Intergenic
1147265378 17:39231454-39231476 GAGAGGGGGCAGCAGGAGCGAGG - Intergenic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1147426409 17:40347832-40347854 GAGCGGAAGCAGAGGGGGCGGGG + Intronic
1147677702 17:42219239-42219261 CACAGGACGCAGAAGCAGCCGGG + Intronic
1147688335 17:42300332-42300354 CACAGGACGCAGAAGCAGCCGGG - Intronic
1147917339 17:43896646-43896668 GAGAGGAAGAGAAAGGAGCGGGG - Intronic
1147977206 17:44254713-44254735 GGGTGGGAGCAGGAGGAGCCAGG + Intronic
1148127193 17:45242942-45242964 CAGGGGAAGCACAGGGAGCCTGG - Intronic
1148428357 17:47620522-47620544 GAGAGGAAGAAAAACAAGCCAGG + Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148705382 17:49625833-49625855 GGAAGGAAGGAGAAGGAGACTGG + Intronic
1148746130 17:49919577-49919599 CAGAGGAAGCAGGTGGAGCGTGG - Intergenic
1148748013 17:49929179-49929201 GTCAGGAAGCAGAGGGAACCAGG + Intergenic
1148841052 17:50497491-50497513 AAAAAGAAGCAGAAGGGGCCAGG + Intergenic
1148913222 17:50954449-50954471 CAGAGGAAGCAGCAGGAACTGGG + Intergenic
1149571477 17:57675321-57675343 GTGATGGAGCAGAAGGAGCATGG + Intronic
1149853089 17:60053199-60053221 GAGAGGAAGCAAGAGATGCCAGG - Intronic
1150125613 17:62632669-62632691 GGGAGGACGCTGAGGGAGCCTGG + Intronic
1150452053 17:65277458-65277480 GTGAGGAAGCAGCAGAAGCTTGG - Intergenic
1150702273 17:67458183-67458205 AGGAGGAAGCAGGAGGAGGCAGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1151437164 17:74104925-74104947 GAGAGGAAGCAGGAGCCTCCAGG + Intergenic
1151467481 17:74296758-74296780 AAGAGGGAGCAGAATGAGGCTGG - Intronic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1151704396 17:75758945-75758967 AAGAGGGGGCAGAAGCAGCCAGG + Intronic
1151911257 17:77084855-77084877 GAGAGGAAGCAGGTGGGGGCAGG - Intergenic
1151933111 17:77245216-77245238 GAGAGGGAGCAGAGGGAGTTGGG + Intergenic
1152117614 17:78398368-78398390 CACAGGAAGCAGGAGGGGCCAGG - Intronic
1152190345 17:78884133-78884155 GGCAGGAGGCAGAGGGAGCCTGG + Intronic
1152494611 17:80662217-80662239 GATAGGAGGCAGAAGGCGGCTGG - Intronic
1152635985 17:81430722-81430744 GGGAGGAAGCAGCAGGTCCCTGG - Intronic
1152743448 17:82028632-82028654 GAGAAGATGCAGACAGAGCCTGG + Exonic
1153716580 18:7855920-7855942 TAGAAAAAGCAGAAGGTGCCTGG + Intronic
1153893844 18:9541601-9541623 GAGGGGAGGGAGAGGGAGCCAGG - Intergenic
1154330862 18:13428199-13428221 GAAAGGAGGTAGGAGGAGCCGGG + Intronic
1154977692 18:21475210-21475232 GAGAGGAAGGAAAAGAAGCAAGG - Intronic
1155044350 18:22090705-22090727 CAGAGGAAGCAGAATAAACCAGG + Intronic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155252881 18:23968334-23968356 GAGAGGGAGAGGAAGGAGCTAGG + Intergenic
1155745549 18:29352730-29352752 GGGAGGAAGAAGAAGGAGCATGG - Intergenic
1155932804 18:31724493-31724515 GGGAGGAAGCAGAAGACCCCAGG - Intergenic
1155988604 18:32256445-32256467 GAGAGGCAGGAGAAGGTGGCTGG - Intronic
1156638234 18:39057279-39057301 AAGAAGAAGAAGAAGAAGCCAGG - Intergenic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1156952272 18:42916862-42916884 GAAAGGAAGGAGAAGGAAGCAGG + Intronic
1157322910 18:46647786-46647808 CAGAGGAAGCTGTAGAAGCCAGG - Intronic
1157394909 18:47333479-47333501 GAGAGGATGCAGAAGTGGGCAGG - Intergenic
1157562667 18:48659749-48659771 GAGAGGAAGGAGAAGCAGCCTGG + Intronic
1157737992 18:50067660-50067682 GAGAGGAAGCAAGAGAAGCAGGG - Intronic
1157904996 18:51561892-51561914 GAGAGGCATCTGAAGGAGACTGG - Intergenic
1157995910 18:52555636-52555658 CACAGGAAGCAGAAGGACTCAGG + Intronic
1158403476 18:57141214-57141236 GAGAGACAGCAGGAGGTGCCAGG - Intergenic
1158472688 18:57751728-57751750 GTGAGGGAGCAGAAGGTGGCTGG - Intronic
1158592425 18:58788957-58788979 GAGGGGAAGCAGAAATTGCCAGG + Intergenic
1158618605 18:59010640-59010662 GAGAGAAAGCATAAGGAACTAGG + Intergenic
1158694527 18:59691835-59691857 GAGAGAAATCAGAATGGGCCTGG + Intronic
1158933894 18:62347084-62347106 GGAAGGAAGCAGAAGCAGCCAGG - Intronic
1159040468 18:63319602-63319624 GAGGGGACGATGAAGGAGCCGGG + Exonic
1159134265 18:64318638-64318660 GAGAGGAAGGAGAAAGAGGGAGG - Intergenic
1160297559 18:77651619-77651641 GTCAGGGAGCAGCAGGAGCCGGG - Intergenic
1160374531 18:78401452-78401474 GAGATGAAGAAGATGGAGCCTGG + Intergenic
1160524349 18:79526275-79526297 GGAAGGCACCAGAAGGAGCCCGG - Intronic
1160652237 19:237212-237234 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1160863303 19:1246661-1246683 CACTGGAAGCAGAATGAGCCTGG + Intergenic
1160901851 19:1432746-1432768 GGGAGGAAGCAGAAGAAGGCAGG - Intronic
1160969611 19:1761721-1761743 GAGAGGCTGAACAAGGAGCCAGG + Intronic
1161080256 19:2307010-2307032 GAGAGGATGCAGAAGGTGTGAGG - Intronic
1161218484 19:3106559-3106581 GAGAGGTTGCAGAGGGAGGCAGG - Intronic
1161351505 19:3794756-3794778 GAGAGGATGAAGAGGGATCCTGG - Intronic
1161704896 19:5815047-5815069 GAGGGGAAGCAGATGGGGCCGGG - Intergenic
1161957893 19:7506483-7506505 GAGAGGATGGAGAAGGGGCAGGG - Intronic
1161963760 19:7536379-7536401 GAGAAGAGGCAGACGGATCCAGG - Intronic
1162570983 19:11472767-11472789 GAGAAGGAGAAGAAGAAGCCAGG + Intronic
1162967703 19:14163862-14163884 GAGAAGAGGGAGAAGGGGCCGGG - Intronic
1163110670 19:15159499-15159521 AAGAGGAAGCATAAGTAGACTGG + Exonic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1164521193 19:28981635-28981657 GGGAGGAAGGTGAAGGAGGCGGG + Intergenic
1164521289 19:28982174-28982196 GAGAGGGAGGAGAAGGAGGAAGG + Intergenic
1164558117 19:29269089-29269111 GAAAGGAAACAGAAGGCTCCAGG + Intergenic
1164588304 19:29491501-29491523 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG + Intergenic
1164650765 19:29889934-29889956 CAGAGGAAGCTGAAGGGCCCAGG + Intergenic
1164657935 19:29938339-29938361 GAGAGGAAGGAGGAGGTGCCAGG + Intronic
1164813223 19:31174787-31174809 GATGAGAACCAGAAGGAGCCAGG + Intergenic
1164883274 19:31754583-31754605 GAGAGCAAGGAGCAGGTGCCAGG + Intergenic
1164932370 19:32185559-32185581 GAGAGAAAGCATATGGAGCTGGG + Intergenic
1165731856 19:38151036-38151058 GAGAGGAGGCAGAAGGAATCTGG - Intronic
1165740036 19:38199486-38199508 GTGAGAAAGCTGAGGGAGCCTGG + Intronic
1166465478 19:43027333-43027355 GAGACGCAGGAGGAGGAGCCTGG + Intronic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1167112323 19:47469703-47469725 GAGAGGGAGAGGCAGGAGCCAGG - Intronic
1167713249 19:51125092-51125114 GAGGGGTAGGAGAAGGAGCAGGG - Exonic
1167728633 19:51236246-51236268 GTCAGGAAGCAGAGGGAGCAAGG + Intronic
1167888593 19:52522152-52522174 AAGAGGAAAGAAAAGGAGCCAGG + Intergenic
1168049917 19:53821747-53821769 GCGAGGAATCAGAAGGAGTGGGG + Intronic
1168241012 19:55088879-55088901 GGAAGGAACCAGAAGGAACCAGG - Intergenic
1168310448 19:55457242-55457264 GACAGAAAGCAGATGGGGCCGGG + Intronic
1168406316 19:56112387-56112409 GAGAGGAAGCACCTGGAGCACGG + Intronic
1168433839 19:56302447-56302469 GGGAGGAAGCAGACGGAGAGAGG - Intronic
1168589289 19:57619187-57619209 TAGAGGAAGCGGGTGGAGCCTGG - Intronic
1168651879 19:58097258-58097280 GAGAGGAAGGAGCAAGAGCAGGG + Intronic
925086988 2:1116311-1116333 GAAAGGAAACAGAAGCTGCCAGG + Intronic
925185063 2:1841610-1841632 GGGAGGGAGCAGAAGCAGTCGGG + Intronic
925279231 2:2671105-2671127 AAGAGGAAGCAGAGGGGTCCAGG + Intergenic
925469409 2:4142823-4142845 GAGAGGAAGCAGGCTGAGGCCGG - Intergenic
925541440 2:4971989-4972011 GAGAGGGAGGAGAAGGAGGAAGG - Intergenic
925657001 2:6159813-6159835 GAGAGGAAGAAAAGGAAGCCAGG + Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
926174265 2:10575050-10575072 AAGAGGAGGCAGAAGCACCCAGG - Intronic
926500675 2:13649181-13649203 GAGAGGATGGAGAAGGAAACAGG + Intergenic
926934315 2:18072066-18072088 GAGAGAAAGGAAAAGGAACCAGG - Intronic
927459939 2:23289815-23289837 GAGAGGAAGCAGTGGGAAGCTGG - Intergenic
927486901 2:23494812-23494834 GAAAGAAGACAGAAGGAGCCCGG - Intronic
928373072 2:30755166-30755188 GAGAGGAGGAAGAGGGCGCCAGG - Intronic
928665577 2:33547838-33547860 GAGAGGAAGGAGGAGAAGCGGGG + Intronic
929040343 2:37738417-37738439 GTCAGGAGGCAGAAGGAGCCAGG + Intronic
929194115 2:39167178-39167200 GAGAGGGAACAGAAGCTGCCAGG + Intergenic
929245496 2:39697737-39697759 CAGAGGAAGCAGGAGAACCCTGG + Intronic
929570002 2:43016715-43016737 GAGAGAAGGGAGAAGGTGCCAGG - Intergenic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930661943 2:54063509-54063531 GAGAGGCATCAGCAGGAGACTGG + Intronic
930844373 2:55885891-55885913 GAGAGAAAGCAGCATGAGTCAGG - Intronic
932125947 2:69145705-69145727 GAGAGGAATTAGTGGGAGCCTGG - Intronic
932220790 2:69997496-69997518 GGGAGGAAGGAGGAGAAGCCCGG - Intergenic
932221132 2:69999877-69999899 GGGAGGAAGGAGGAGGAGCCCGG - Intergenic
932433092 2:71686998-71687020 GAGAGGAGGCAGAGGAGGCCGGG - Intergenic
932437407 2:71710732-71710754 GGCAGGGAGGAGAAGGAGCCAGG - Intergenic
933224454 2:79729447-79729469 GAGAGGAAGCAGCACGGGTCAGG - Intronic
933291286 2:80441160-80441182 GGGTGGAAGGAGAAAGAGCCAGG + Intronic
933727201 2:85433702-85433724 CAAGGGAAGCAGATGGAGCCAGG - Intronic
934299109 2:91766497-91766519 GGGAGGTGGCAGAAGGAGACAGG + Intergenic
935064127 2:99633446-99633468 GGGAGGAAAGAAAAGGAGCCAGG + Intronic
935099107 2:99975592-99975614 AGGAGGAAGCAGTAGGAGGCAGG + Intronic
935618202 2:105107121-105107143 GTGGGGAGGCAGAAGGAGCGAGG - Intergenic
935702570 2:105825086-105825108 GAGAGGAGGAGGCAGGAGCCAGG - Intronic
935866400 2:107392281-107392303 GAGAGGCACCAGCAGGAACCAGG + Intergenic
936059265 2:109283786-109283808 GAGAACAAACACAAGGAGCCAGG - Intronic
936398580 2:112149100-112149122 TAGAGAAAGCAGAAGATGCCAGG - Intronic
936674528 2:114699787-114699809 CAGAGGAACCAGAAGGGGCAAGG + Intronic
937123274 2:119455464-119455486 TACAGGAAGCAGAAGGAACTTGG + Intronic
937148903 2:119672389-119672411 GGAGGGAGGCAGAAGGAGCCAGG + Intergenic
938128396 2:128690712-128690734 GAGAGGGATCAGAAGGAGACAGG + Intergenic
938249898 2:129806508-129806530 GTGGGGAAGCTGAAGGAGGCTGG - Intergenic
939373847 2:141338305-141338327 AAGAGGAAGCAGAAGAAAGCAGG + Intronic
939445266 2:142302070-142302092 GAGAGGGGGTAGGAGGAGCCAGG - Intergenic
939703398 2:145421557-145421579 GACAGGAAGGAGAATGAGCACGG + Intergenic
940276892 2:151948996-151949018 GAGAGCAAGCAGAAAGAGGTAGG - Intronic
940411789 2:153372666-153372688 GAAAGAAAGCAGAAGAAACCTGG + Intergenic
940859958 2:158761200-158761222 GAGAGGAGGCAGCAGTGGCCAGG + Intergenic
942495320 2:176534044-176534066 CAGAGGAAGCAGAAGGGATCAGG + Intergenic
942514997 2:176742526-176742548 GAGAGACAGCAGAAGCAGGCTGG + Intergenic
942602681 2:177657672-177657694 GAGAGAAAGCAGAAAGAGGCGGG + Intronic
942802646 2:179893172-179893194 CAGAAGAAGCAGAAGCTGCCAGG + Intergenic
943051266 2:182916074-182916096 GAGAGGGAGGAGCAGGAGCAGGG - Intronic
943309406 2:186308055-186308077 GAGAGGGAGAAGAGGAAGCCTGG + Intergenic
943910539 2:193560961-193560983 GTCAGGAAGCAGACGGAGCTAGG + Intergenic
944469350 2:200036304-200036326 GTAAGGAAGCAGCAGGACCCTGG - Intergenic
945029597 2:205650855-205650877 GGGAGGAAGCAAAGGGAGCCCGG + Intergenic
945106093 2:206316261-206316283 GGGAGGAAGCACAAGCATCCAGG - Intergenic
945128279 2:206537538-206537560 GAAAGGAAGCAGAAAGAGGTGGG - Intronic
946202190 2:218076807-218076829 GGGAGGCAGCAGAGGGAGGCAGG - Intronic
946308553 2:218870319-218870341 GAGAGCAGGAAGAAGGAGCTGGG - Intronic
947718198 2:232352253-232352275 GCGAGGAAGTAGATGAAGCCAGG + Intergenic
947741673 2:232487616-232487638 GAGAGGACGCAGACAAAGCCGGG + Intronic
947908575 2:233785568-233785590 GTGAGGAGGCAGAGGGAGTCAGG + Intronic
948091833 2:235301892-235301914 GAGAGGAGGGAGAAGGAGGGAGG - Intergenic
948293223 2:236842763-236842785 GGGAGGCAGGAGAAGAAGCCAGG - Intergenic
948369963 2:237482614-237482636 GAGAGCAAGCGGAGGCAGCCAGG + Intergenic
948426915 2:237894404-237894426 GGAAGGAGGCAGGAGGAGCCGGG + Intronic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948748194 2:240110734-240110756 GAGGGGAAGGAGAAGGAGAGTGG - Intergenic
948753276 2:240144585-240144607 GTGAGTCAGCAGCAGGAGCCTGG - Intergenic
948807099 2:240457724-240457746 GAGAGGCAGGAGAGGGAGCCAGG - Intronic
948807155 2:240457940-240457962 GAGAGGTGGAAGCAGGAGCCTGG - Intronic
948855452 2:240728201-240728223 GGAAGGAAGCAGAAGGACCAGGG + Intronic
949060442 2:241953579-241953601 GAGTGGAAGCTGGAGGACCCAGG + Intergenic
1168846960 20:951897-951919 ACCAGGAAGCAGAAGGAGCCAGG - Intergenic
1168955461 20:1831551-1831573 GAGAGGGAGCAGGAGAAGGCAGG + Intergenic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1169660996 20:7978232-7978254 GAGAGAAAGAAGAGGGAGGCTGG - Exonic
1170030117 20:11935749-11935771 GAGAGGAGTCAGGAGGGGCCTGG - Intergenic
1170528280 20:17262942-17262964 GACAGGAAGGAGAAGGAAGCTGG - Intronic
1170581672 20:17704052-17704074 GAGAGGAAGCAGAGGCTGCCAGG + Intronic
1170706520 20:18749108-18749130 GAGGGGAAGCTGAAGGCCCCTGG + Intronic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1170843516 20:19943115-19943137 AACAGGCAGAAGAAGGAGCCAGG - Intronic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171437718 20:25136010-25136032 CAGAGGGAGCAGACCGAGCCAGG + Intergenic
1171983914 20:31646086-31646108 GAGAGGAAGCAGGAGTAGGTTGG + Intergenic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1172301297 20:33852388-33852410 GAGAGAAACCAGAAAAAGCCAGG - Intronic
1172429224 20:34876357-34876379 GAGTGAAAGCAGAAGGGGCGGGG - Intronic
1172804837 20:37604331-37604353 TAGAGGAAGCTCAGGGAGCCGGG - Intergenic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1173049515 20:39545842-39545864 GAGTGGCAGCTGGAGGAGCCTGG + Intergenic
1173251072 20:41364577-41364599 GAGAGGAAGCCGGAGCAGCAGGG - Intronic
1173614681 20:44395001-44395023 GAGAGGAAGATGAGGGAGCTTGG - Intronic
1173689534 20:44949498-44949520 GAGAGGAAGCAGAGGGAACATGG + Intronic
1173736449 20:45364809-45364831 GAGAACAAGCAGCAGGAGCAAGG - Intronic
1173875502 20:46368087-46368109 CAGAGGAAGCAGGAAGAGTCAGG - Intronic
1174075997 20:47937439-47937461 TAGAGGAAGAATAAGGGGCCGGG - Intergenic
1174979399 20:55376162-55376184 GAGAAGCTGCAGGAGGAGCCAGG - Intergenic
1175026656 20:55909761-55909783 GCCAGGAAGCAGGAGGAGCCTGG + Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175219357 20:57408127-57408149 GAGAGGCAGGAGAAGGTGCAAGG - Exonic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176214416 20:63941502-63941524 AAGAGGAAGCAGAAGTGGGCCGG + Intronic
1176287965 21:5028780-5028802 GAGAGGCAGAAGATGGAGGCAGG + Intronic
1176893551 21:14348341-14348363 GAGAGGGAGCAGAAGAAGGCTGG + Intergenic
1177112181 21:17041962-17041984 CAGAGGACGTAGAAGGAGACAGG + Intergenic
1177978874 21:27885506-27885528 GAGAGGTGCCAGCAGGAGCCGGG - Intergenic
1178711082 21:34917280-34917302 AAGAGAAAGCAGATGGAGACAGG + Intronic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1179564766 21:42240321-42240343 AAGAGCAAACAGGAGGAGCCAGG - Intronic
1179869216 21:44234695-44234717 GAGAGGCAGAAGATGGAGGCAGG - Intronic
1179959328 21:44759330-44759352 GAGCCTCAGCAGAAGGAGCCAGG - Intergenic
1179982960 21:44905966-44905988 GAGAGGGTGCAGACGGGGCCAGG - Intronic
1180057582 21:45366921-45366943 GAGAGAGAGCAGAAGGTGCTGGG + Intergenic
1180800402 22:18629171-18629193 AAGAGGAAGCATCAGCAGCCAGG + Intergenic
1180851636 22:19024727-19024749 AAGAGGAAGCATCAGCAGCCAGG + Intergenic
1181221317 22:21366091-21366113 AAGAGGAAGCATCAGCAGCCAGG - Intergenic
1181462894 22:23095715-23095737 CAGAGGAAAAAGAAGCAGCCCGG + Exonic
1182015934 22:27039680-27039702 GAGAGGAAAGAGGATGAGCCCGG + Intergenic
1182763946 22:32745114-32745136 GCTAGGAACCAGGAGGAGCCAGG + Intronic
1183080691 22:35454202-35454224 GAAGGGGAGCAGAGGGAGCCAGG - Intergenic
1183093825 22:35540739-35540761 GAGGTGAAGGAGGAGGAGCCGGG + Intergenic
1183162343 22:36123338-36123360 GAGGGGAATGAGGAGGAGCCGGG + Intergenic
1183187421 22:36300023-36300045 GACAGGAAGCAGCAGCAGCGGGG + Intronic
1183302034 22:37063218-37063240 GAGAGGCAGCAGAAGGGGCTGGG + Exonic
1183392274 22:37552388-37552410 GAGGGGCAGCAGAAGGGGTCAGG - Intergenic
1183714867 22:39527748-39527770 GTGGGGAAGCAGCAGGACCCTGG + Intergenic
1184196979 22:42936382-42936404 GAGATGGAGCAGAATGACCCCGG + Intronic
1184321436 22:43744823-43744845 GAGAGGAAGCAGAAAGAAGGAGG + Intronic
1184369971 22:44076031-44076053 GAGAGGATGCTGAAGGGGGCAGG + Intronic
1184587799 22:45459535-45459557 GGGTGGAGGGAGAAGGAGCCAGG + Intergenic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1184913294 22:47550260-47550282 GGAAGGAAAGAGAAGGAGCCGGG - Intergenic
1184959365 22:47917906-47917928 GGGAGGAAGGAGAAGGAGGAAGG - Intergenic
1185152747 22:49175223-49175245 GGGAGGCAGCAGGATGAGCCGGG - Intergenic
1185155764 22:49192534-49192556 GAGGGAAAGCCGCAGGAGCCCGG + Intergenic
1185168816 22:49279380-49279402 AAGAGGAAGAAGAAGGAGAAGGG - Intergenic
1203292614 22_KI270736v1_random:9959-9981 GTCAGGAGGCAGAAGGATCCAGG + Intergenic
949330847 3:2920296-2920318 GAGGGGAGGTAGAAGGAGGCTGG + Intronic
949648995 3:6133046-6133068 GAGAGGGAAAAGAAGGACCCTGG + Intergenic
949980587 3:9499852-9499874 GAGAGGAGGATGAAGGAGCCAGG - Exonic
950089757 3:10287231-10287253 GAGAGAAAGGAGAAAGAGCTGGG - Intronic
950290382 3:11779323-11779345 GAGAGGAGGAGGAAGGTGCCAGG + Intergenic
950713119 3:14828028-14828050 GAGAGGGAGCAGGAAGACCCAGG + Intronic
950773365 3:15330028-15330050 GCAGGGAAGCAGAAGGAGGCGGG + Intronic
950842354 3:15979692-15979714 GGGAGGAAGCAGAAGCTGCCAGG + Intergenic
950929358 3:16773718-16773740 GAGAGGCAGGAGCAGGAACCGGG + Intergenic
951713324 3:25609567-25609589 AAGAGGGAGAAGAAGGAGCCTGG - Exonic
951913763 3:27777926-27777948 GTCAGGAAGCAGAAGGAGGGAGG + Intergenic
952027677 3:29102907-29102929 GGGAGGCAGCAGAAGGAGAGAGG - Intergenic
952288260 3:31989104-31989126 AAGAGGAAAGAAAAGGAGCCAGG + Exonic
953507700 3:43502440-43502462 GAGAGGAAGCAGGAGAAGCGGGG - Intronic
953577157 3:44122013-44122035 GAGTGGAAGCACAAGCAGCAAGG + Intergenic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954794026 3:53152356-53152378 GAGAGGAGGAAGAAGATGCCTGG - Intergenic
955004477 3:54956061-54956083 GAGGGGAGGGAGAAGGAGACAGG - Intronic
955070882 3:55571630-55571652 GTCAGAAAGCAGAGGGAGCCAGG - Intronic
955177498 3:56631321-56631343 TAGAGGAAGCAGAGGGACCATGG - Intronic
955789331 3:62572244-62572266 ATGAGGAAACAGAAGGACCCAGG - Intronic
956067648 3:65414026-65414048 GAGAGAAAGCAAAAGGATCTTGG - Intronic
956188945 3:66589921-66589943 GAAAGAGAGCAGAATGAGCCAGG - Intergenic
956713075 3:72055523-72055545 GAGAGGAAGAAGAGGGACCATGG + Intergenic
957376767 3:79368684-79368706 GAGAGGAAGGAGCAGCAGCAGGG - Intronic
957404942 3:79765358-79765380 AAGAGGAAGCAGCAGCAGCTCGG - Intronic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960545192 3:118906273-118906295 GAGAGGAAGCTGCAGAAGGCAGG + Intronic
960937631 3:122913166-122913188 GAGAGGAAGGAGGGGGCGCCGGG + Intronic
961006085 3:123406302-123406324 GTCAGGAGGCAGAGGGAGCCAGG - Intronic
961043348 3:123692833-123692855 GAGACGGAGCAGAGTGAGCCTGG + Exonic
961370273 3:126424403-126424425 GAGAGGCAGCAGGAGAAGTCAGG + Intronic
961478143 3:127161375-127161397 GAGAGCAGACAGAAGGGGCCAGG - Intergenic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
962129759 3:132660276-132660298 GGAAGGAAGCCGAAAGAGCCAGG + Exonic
962389182 3:134957402-134957424 GAGGGGATGAAGAAGGAGTCTGG + Intronic
962500013 3:135981763-135981785 GAGAGTAATGAGAAGGGGCCAGG + Intronic
963707003 3:148699478-148699500 GAGAGGAAGGAGAAGGTACCAGG - Intronic
964602989 3:158523769-158523791 GAGAGGAATGAGCAGGAGCATGG + Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
965814284 3:172620623-172620645 GAGAGGAAGAGGAAATAGCCTGG + Intergenic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
967330279 3:188283088-188283110 GACAGGATTAAGAAGGAGCCTGG - Intronic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
967904470 3:194488476-194488498 ATGAGGAAGCAGAGGCAGCCAGG - Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968230423 3:197002406-197002428 GCGAGGCAGCAGAAAGCGCCCGG - Exonic
968288174 3:197520173-197520195 GAGAGGGAGGAGAGGGAGACGGG + Intronic
968365596 3:198182760-198182782 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
968384114 4:121513-121535 GAGAGGAAGCAGTCAGAGGCTGG + Intergenic
968555783 4:1245810-1245832 GGGAGGGTGCAGAAGGGGCCTGG + Intronic
968810700 4:2798536-2798558 GAGAGGAAGCAGCTGGGGTCAGG - Intronic
968916658 4:3499707-3499729 GAGGGGATGCAGAGGGAGCGTGG + Intronic
968981364 4:3851543-3851565 GAGAGGAAGGAGAAGATGTCTGG + Intergenic
970007951 4:11428547-11428569 GAGTGGATGCAGAGGGAACCAGG - Intronic
970170386 4:13283505-13283527 GAGAGGCCGGAGAAGGTGCCTGG + Intergenic
970193206 4:13534012-13534034 TAGATGAAGCTGAAGGATCCTGG + Intergenic
970386112 4:15558461-15558483 GAGAGGATGGAGAAGGGTCCTGG - Intronic
970661572 4:18291566-18291588 GAGAAGAAGGAAAAGCAGCCAGG + Intergenic
971337840 4:25740538-25740560 GAGAGCAAGCTGGAGCAGCCTGG - Intergenic
971869721 4:32219057-32219079 GAGTGAAAGCAGAAGCAGTCAGG + Intergenic
972217817 4:36916709-36916731 GAGAAGGAGCAGTAGGAGGCAGG - Intergenic
972418225 4:38863304-38863326 AAGAGGACCCAGAAGGAGACTGG - Intergenic
972850437 4:43042542-43042564 GAGAGACAGGAGGAGGAGCCAGG - Intergenic
973321707 4:48817134-48817156 GAGAGTAAGCAGAAGCAGTGTGG + Intronic
975112033 4:70639251-70639273 GAAAGGAAGCAGAAAGATCCAGG + Intronic
975749758 4:77510652-77510674 TAGAGGAACCAGATGCAGCCGGG + Intergenic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976132915 4:81904061-81904083 GAGAGGGAGGAGAAGGATACAGG - Intronic
976953334 4:90862464-90862486 GAGAGGAAGCATAAAAAACCAGG - Intronic
977994381 4:103484615-103484637 GCCAGGAAGCAGAAGGGGTCAGG + Intergenic
979240464 4:118442847-118442869 GAGAGGAGCAAGAAGAAGCCAGG + Intergenic
979254630 4:118597927-118597949 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
979288259 4:118951026-118951048 GGGAGGAGGCAGATGGAGGCAGG + Intronic
979334331 4:119448104-119448126 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
980080412 4:128338165-128338187 GAGAGGAAGCCTAAGGAGCCAGG + Intergenic
980295759 4:130914035-130914057 GAGAGGAAGGTGAAGGATACAGG - Intergenic
980315377 4:131192635-131192657 GAGAGGAAGCAGTTAGAGGCTGG - Intergenic
980875415 4:138657497-138657519 GAGAGAGGGCAGAAGGAGCAGGG - Intergenic
981788173 4:148504564-148504586 GAGGGGAACCAGAAGTGGCCAGG + Intergenic
981825488 4:148935905-148935927 GAGAGAGAGGAGGAGGAGCCGGG - Intergenic
982164925 4:152605523-152605545 GAGAGGAAGGACAGAGAGCCCGG + Intergenic
982325770 4:154126999-154127021 GACAGGCAGGAGCAGGAGCCAGG + Intergenic
982497572 4:156110029-156110051 GTGAGGAGGCAGAAGGAGTTGGG + Intergenic
983299100 4:165902541-165902563 CCCAGGAAGCAGAAGGAGTCAGG - Intronic
983523389 4:168734761-168734783 GAGAAGGAGGAGGAGGAGCCAGG + Intronic
984949283 4:184994744-184994766 GAGAGGAAGAAGACGGATGCAGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985659689 5:1150883-1150905 GAGGGCACGCAGAAGCAGCCTGG + Intergenic
985898072 5:2762239-2762261 GAGGGGAGGCAGCAGGAGGCTGG + Intergenic
986251236 5:6060304-6060326 AATAGGAAGCAGGAGGAGCCTGG + Intergenic
986417902 5:7546834-7546856 CCAAGGAAGAAGAAGGAGCCAGG - Intronic
986618650 5:9646654-9646676 GAGAGGCAGCAGCAAGACCCAGG - Intronic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
987039603 5:14049527-14049549 GAGAGGCAGCAGGAGCAGCCAGG + Intergenic
987546385 5:19315366-19315388 GAAATAAAGAAGAAGGAGCCAGG + Intergenic
988787619 5:34579138-34579160 GGGAGGAAGGAGAAGGAGAAAGG + Intergenic
989160249 5:38384117-38384139 GAGAGGAAGGAGAAGGAATAAGG + Intronic
989337506 5:40336084-40336106 TAGAGGAAGCACAAGGAGTTGGG + Intergenic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
990047050 5:51445367-51445389 GAGAGGAAGGGGAAGGAGCTGGG + Intergenic
990832846 5:59979712-59979734 GAAAGGAAGTAGATGGAGCCGGG - Intronic
990995711 5:61730392-61730414 GAGAGAGAGCAGAAGGTGTCAGG + Intronic
991386795 5:66100315-66100337 GAGAGGAAGAGGAAGGATCATGG + Intergenic
991589196 5:68231324-68231346 CAGAGGCTGCAGGAGGAGCCAGG - Intronic
992442412 5:76808500-76808522 GAGAGGAAGCAGAGGCAGAGGGG - Intergenic
992937160 5:81719721-81719743 GTCAGGAGGCAGAAGGAGACAGG + Intronic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993847844 5:92967476-92967498 GATAGGAAGCAGAAGCTTCCAGG - Intergenic
994082023 5:95717602-95717624 CAGAGGCAGCAGAATGAGACAGG - Intronic
994302722 5:98165079-98165101 GAAAGGAAGCAGAAGCAGAAGGG - Intergenic
995054630 5:107745547-107745569 GAGAGGAACTGGCAGGAGCCAGG + Intergenic
995713431 5:115057775-115057797 GAGAGGAAGAAGGATGAGCTAGG - Intergenic
995856355 5:116597067-116597089 GAGAGAGAGGAGGAGGAGCCAGG - Intergenic
996174102 5:120333281-120333303 AAAAGGAGGAAGAAGGAGCCAGG - Intergenic
996613304 5:125410353-125410375 AAAATGAAACAGAAGGAGCCAGG + Intergenic
996669375 5:126099422-126099444 GAGAAAAAGCAGCAGGATCCTGG - Intergenic
996815267 5:127567067-127567089 AAAAGGAACCGGAAGGAGCCAGG + Intergenic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
997518531 5:134507230-134507252 GGGAGGAAGCTGAAGGGGGCAGG + Intergenic
998295656 5:140966828-140966850 GAGAGGCAGTAGCAGCAGCCAGG - Exonic
998388325 5:141771258-141771280 GAGGGGAAGCAAGAGGAGCTGGG + Intergenic
998927566 5:147142833-147142855 GAGAGGGAGCAGAAGCAGGGTGG - Intergenic
998946255 5:147342510-147342532 GTGAGGAGGCAAAAGGAGACAGG + Intronic
999365056 5:151017995-151018017 GAGGGCAATCAGAAGCAGCCTGG + Intergenic
999470984 5:151855297-151855319 GAGAGGAAAAAAAAGGAACCTGG - Intronic
999863094 5:155669400-155669422 GAGACAAAGCAGAAGGAGAGGGG + Intergenic
1000097375 5:157983900-157983922 GAGAGGAAGGAGAAGGAACAGGG + Intergenic
1000590886 5:163156222-163156244 AAGAGGAAGCATAAGGAACAAGG + Intergenic
1000644398 5:163743247-163743269 GGGAGGAAACAAAAGGAGGCAGG + Intergenic
1001138611 5:169123980-169124002 GAGAGGAATGAGCAGGAGCATGG - Intronic
1001141351 5:169146584-169146606 CAGTGGAGGCAGGAGGAGCCGGG - Intronic
1001434292 5:171687244-171687266 GAGAGGAAGAAGAAAGGGCAAGG + Intergenic
1001532988 5:172477800-172477822 GAGAGGGAGCAGAAGGCAGCAGG - Intergenic
1001594287 5:172887894-172887916 GAGTGGAAACAGGAGGAGGCAGG + Intronic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1001904853 5:175463180-175463202 GAGAGGAAGCAGGATTAGGCAGG + Intergenic
1002045105 5:176537100-176537122 GAGAGGCCCCGGAAGGAGCCGGG - Exonic
1002163131 5:177328515-177328537 CAGAGGGTGCAGAAGGACCCAGG + Intergenic
1002257475 5:177968797-177968819 GAGAGGAAGCAAGAGGGTCCAGG + Intergenic
1002468767 5:179422268-179422290 GAGAGGAGGCAGAATGAGCTTGG + Intergenic
1002740720 5:181433426-181433448 GAGAGGAGGAAGAAGAAGCCAGG + Intergenic
1002806091 6:575475-575497 GAGAGGATGGAGAGGGAGCGAGG - Intronic
1002806097 6:575498-575520 GAGAGGATGGAGAGGGAGCGAGG - Intronic
1002815333 6:675062-675084 GTCAGGAGGCAGAGGGAGCCAGG - Intronic
1003170547 6:3718683-3718705 GTCAGGAGGCAGAAGGAGCAGGG - Intergenic
1003311164 6:4971037-4971059 GACAAGGACCAGAAGGAGCCTGG + Intergenic
1003331651 6:5134853-5134875 GAGAGGAAGGAGAAGGAATAGGG - Intronic
1003427106 6:6004779-6004801 GAGAGGACAGGGAAGGAGCCAGG - Intronic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1006155342 6:32010390-32010412 GAGAGGAGGTAGAGGGAGCCAGG - Intergenic
1006161648 6:32043124-32043146 GAGAGGAGGTAGAGGGAGCCAGG - Intronic
1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG + Exonic
1006192745 6:32219714-32219736 CAGAGGCAGTTGAAGGAGCCAGG + Exonic
1006352126 6:33528713-33528735 GAAAAAAAACAGAAGGAGCCTGG + Intergenic
1006449841 6:34099525-34099547 GGGAGGCAGCAGAGGGAGCAGGG + Intronic
1006846756 6:37067550-37067572 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1006954574 6:37856288-37856310 GAGAAGAAACAGAACCAGCCAGG - Intronic
1007090113 6:39178866-39178888 GAGAGGAAGAGACAGGAGCCAGG - Intergenic
1007417346 6:41699489-41699511 GAGAGGAAACAGAGGGCTCCTGG - Intronic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1009402294 6:63271167-63271189 TAGAGGAAGTAGAAAGAGCAAGG + Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011003718 6:82620585-82620607 GGGAGGAAGGAGCAGGAGACAGG + Intergenic
1011215925 6:85005568-85005590 AAGAGGAAGCAGGAGGATCAGGG + Intergenic
1011745502 6:90403925-90403947 GAGAGGAAGCCAAATGAGCATGG - Intergenic
1012054953 6:94394507-94394529 GAGAAGAAGCAGAAGAAGTCAGG + Intergenic
1012447516 6:99321948-99321970 GTGAGGAAGGGGAAGAAGCCAGG + Intronic
1012526337 6:100182446-100182468 GACAGGAAGTAGGAGAAGCCTGG - Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013078444 6:106791595-106791617 GTGAGGAAGCACAAGGACCTCGG - Intergenic
1013258074 6:108409442-108409464 GGGAGGAAGGAGCAGGAGCGGGG + Intronic
1013359712 6:109382596-109382618 GGGAGGAAGCCGAAGGAACCTGG + Intergenic
1013366540 6:109441713-109441735 GAGAGGAGGCTGGAGGAGACTGG - Intronic
1013460508 6:110370861-110370883 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1013788901 6:113813734-113813756 TACAGGAAGCAGAAACAGCCTGG + Intergenic
1014758013 6:125323231-125323253 TAGAGGATGAAGAAGGAGCTTGG + Intergenic
1015190308 6:130465015-130465037 GAGAGAAAGGAGAAGGTTCCAGG + Intergenic
1015793357 6:136986314-136986336 GAGAGGAAGCAGAGAGAAGCAGG - Intergenic
1015937883 6:138420769-138420791 AAGAGGAAGCAGGACGAGGCAGG - Exonic
1016731573 6:147433160-147433182 GAGAGGAGGAGGATGGAGCCTGG - Intergenic
1016794118 6:148099645-148099667 AAGAAGAAGAAGAAGAAGCCTGG - Intergenic
1017123565 6:151045789-151045811 GAGAGGAAGCAGTGGATGCCTGG - Intronic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017781467 6:157718858-157718880 GAGAGGAGGAAGAAGGAGTTGGG - Intronic
1017988542 6:159466182-159466204 AAGAAGAAGAAGAAGAAGCCGGG - Intergenic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018376706 6:163219732-163219754 GGGAGGCAGCAGGAGGAGGCAGG - Intronic
1018648966 6:165975050-165975072 TGGAGGCAGGAGAAGGAGCCCGG + Intronic
1018791430 6:167151229-167151251 AAGAGAAAGCACAAGGGGCCAGG + Intronic
1018931594 6:168243641-168243663 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1018931602 6:168243681-168243703 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1019049229 6:169170372-169170394 GAGAGGGAGCGGAAGGAGGAAGG - Intergenic
1019100629 6:169626411-169626433 CAGAGAAGGCAGCAGGAGCCTGG - Intronic
1019109501 6:169698593-169698615 GGGAAGAAGCAGAAAGAGCTTGG - Intronic
1019170140 6:170129220-170129242 GAGCCGAAGCAGCAGCAGCCGGG + Intergenic
1019245829 6:170709022-170709044 GAGAGGAGGAAGAAGAAGCCAGG + Intergenic
1019266800 7:121644-121666 GGAAGGAAGGAGAAGGAGCAGGG + Intergenic
1019284625 7:217326-217348 TAGAGAAAGCAACAGGAGCCAGG - Intronic
1020011513 7:4808084-4808106 GAGAGGAAGAAGGAGGAGGGAGG - Intronic
1020074865 7:5251223-5251245 GAGAGGAGACAGACAGAGCCTGG - Intergenic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1021089138 7:16461404-16461426 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1021122908 7:16816900-16816922 GCGAGGCAGCAGGAAGAGCCTGG + Intronic
1021194519 7:17660466-17660488 GTGAGCAAGCAGTAAGAGCCAGG - Intergenic
1021625439 7:22588689-22588711 GAGAGGAAGAAAAAAGATCCTGG - Intronic
1021842171 7:24729657-24729679 GACTGGAGGTAGAAGGAGCCTGG + Intronic
1021909191 7:25367146-25367168 GACAGGAAGTAGAAGGAAGCGGG + Intergenic
1021921769 7:25492453-25492475 GAGGGGGACCAGAAGGAGCTGGG + Intergenic
1021975487 7:26007813-26007835 GGGAGGGAGCAGTAGGAGCCAGG + Intergenic
1022503458 7:30896669-30896691 GAGGGGAGGCAAAAGGAGGCAGG - Intergenic
1022550063 7:31229525-31229547 GCAAGGAAGGAGAAGGAACCAGG - Intergenic
1022609271 7:31852920-31852942 GAGAGGAGGTAGAGGGAACCAGG - Intronic
1022800969 7:33776941-33776963 CAGATGAAGCAGATGGTGCCAGG + Intergenic
1022886617 7:34653338-34653360 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1023026590 7:36056396-36056418 GAGAAGAAGCAGGAGGAAGCAGG + Intergenic
1023338295 7:39192934-39192956 GAGAGGAAGGACAAGGAGAAAGG + Intronic
1023632587 7:42178929-42178951 AAGAGGAAGAAGAAAGAGCCAGG + Intronic
1023765607 7:43507883-43507905 GAGAGGAAAGAGCAGGACCCAGG - Intronic
1023854534 7:44174265-44174287 GAGAGGAAGCACGAGGGGGCAGG - Intronic
1023882282 7:44327106-44327128 CTGAGGAAGCAGAGGGATCCTGG + Intronic
1024118322 7:46213353-46213375 CTCAGGAAGCAGAAGGAGCAGGG + Intergenic
1024294786 7:47833399-47833421 GGGAGGAAGCACAGGCAGCCTGG + Intronic
1024645014 7:51363602-51363624 GAGAAGAAGCAGAGGCAGCTAGG - Intergenic
1024710737 7:52011841-52011863 GAAATGAAGCAGAAAGAGCTGGG + Intergenic
1025835049 7:65086051-65086073 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1025904822 7:65775530-65775552 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1026299712 7:69086678-69086700 GACAGGATGCAGAAGGACCAGGG + Intergenic
1026955052 7:74371751-74371773 GAGAGGGAGGAGAAGGAGAGAGG + Intronic
1027129865 7:75583139-75583161 GAGAGGGAGCAGGAGGGGACTGG - Intronic
1027148556 7:75715944-75715966 GAGAGGGAACAGAGAGAGCCAGG + Intronic
1027743434 7:82041379-82041401 GAGTGGAAGCTGACCGAGCCAGG + Intronic
1028052701 7:86206430-86206452 GCAAGGAAGCGGAAGGTGCCTGG + Intergenic
1028117014 7:87009661-87009683 AAAAGGAAGCAGAAGAAGACTGG + Intronic
1028503881 7:91550181-91550203 GAGAGGAAGCAGCAGGGGCTAGG - Intergenic
1028826648 7:95281357-95281379 GACAGGAAGGAGGAAGAGCCAGG - Intronic
1028984908 7:97002134-97002156 GAGACAAAGAAGCAGGAGCCAGG + Intergenic
1029536849 7:101162404-101162426 GGCAGGAAGCAGGAGGAGACGGG + Intergenic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1029859201 7:103551198-103551220 GAGGGGCAGCAGAAGGTGCCAGG + Exonic
1030362665 7:108611098-108611120 GAGAGAAAGCACAAGGATTCTGG - Intergenic
1030704450 7:112676753-112676775 TAGAGGAAGTAGAAGGAGATTGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1032063404 7:128744670-128744692 GTGAGGAAGCAGAGGCAGCAGGG + Intronic
1033048208 7:137981224-137981246 GAGAGGAGGAAAAGGGAGCCTGG + Intronic
1033220247 7:139522923-139522945 GGGAGGGAGCAGGAGGAGCTGGG + Intergenic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034372767 7:150614860-150614882 GTGAGGACTTAGAAGGAGCCTGG - Intergenic
1034404745 7:150895982-150896004 TAGAGGTTGCAGAAGGAGCGTGG + Intergenic
1034671480 7:152862183-152862205 GAGAGGAAGTACAGGGTGCCAGG + Intergenic
1034838372 7:154373054-154373076 GAGAGGAAGCGGATGGTGCAGGG - Intronic
1034865079 7:154634672-154634694 GAGACGAAGGAGAAGGAGAAGGG - Intronic
1034900061 7:154902609-154902631 GAGAGCAAGCAGATGCTGCCTGG + Intergenic
1034903077 7:154919928-154919950 GAGAGGGAGGAGGAGGTGCCAGG + Intergenic
1035344614 7:158190000-158190022 GAGAGGAATCAGAGGGCGCCAGG - Intronic
1035502294 8:99176-99198 GAGAGGAGGAAGAAGAAGCCAGG - Intergenic
1035670373 8:1412342-1412364 GAGATGGAGGAGAAAGAGCCCGG - Intergenic
1035675581 8:1453268-1453290 GGGGAGAAGCAGGAGGAGCCTGG + Intergenic
1036198291 8:6743158-6743180 GAAATGAAGCAGAAAGAGGCTGG - Intronic
1036453955 8:8892517-8892539 GAGAGGCAGGAGAGGGAGTCAGG + Exonic
1036518643 8:9469445-9469467 GAGAGGAAGAAGGAGGAGAGAGG - Intergenic
1036608224 8:10327015-10327037 AAGAGCTGGCAGAAGGAGCCAGG - Intronic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037234106 8:16696210-16696232 GAAGGGAAGGAGAAAGAGCCAGG - Intergenic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037858363 8:22387759-22387781 CAAAGGAAGCAGGAGGAACCTGG - Intronic
1037889712 8:22617460-22617482 GAGAGGAAGAAGAAAAACCCCGG + Exonic
1037916641 8:22777191-22777213 GAGGGGAAGCAGAAGGAAAGAGG - Intronic
1037939978 8:22944035-22944057 GTCAGGAGGCAGGAGGAGCCGGG - Intronic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1038075581 8:24069688-24069710 GACAAGAAGCAGAAGGAGATAGG + Intergenic
1038213480 8:25540903-25540925 GACAGGGAGCAGGAGGAGGCAGG - Intergenic
1038546210 8:28427497-28427519 AAGAGGGTGAAGAAGGAGCCGGG - Intronic
1038843807 8:31210515-31210537 GAAAGGAAGGAGAAGGGACCAGG - Intergenic
1038848530 8:31252026-31252048 GAGAGAAAGCAGATGGAGAGCGG - Intergenic
1039411733 8:37360463-37360485 GAGAGGCAGCAGCAGGAGAGAGG + Intergenic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1040350268 8:46559531-46559553 GAAAAGAGGCTGAAGGAGCCAGG + Intergenic
1040543013 8:48376564-48376586 GTTAGGAAGCAGAAGGCCCCGGG + Intergenic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1040696968 8:50011654-50011676 CAAAGGAAACAGAAGGAACCAGG - Intronic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041051627 8:53940096-53940118 GCGATGAAGTAGAGGGAGCCTGG + Intronic
1041277706 8:56179991-56180013 CAGAGGCAGAATAAGGAGCCAGG + Intronic
1041326171 8:56667680-56667702 GAAGGGAAGCAGCAGGGGCCAGG - Intergenic
1042110836 8:65379781-65379803 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1043012145 8:74894221-74894243 GTGAGGAAGCAGAGGTAGGCAGG - Intergenic
1043384370 8:79733366-79733388 GAGAAGTAGAAGAGGGAGCCAGG + Intergenic
1043404226 8:79914489-79914511 GAGAGGGAGCAGGAGTAGACGGG - Intergenic
1043813104 8:84767197-84767219 GAGATGAAGCAAATGGAGACGGG - Intronic
1044004281 8:86922873-86922895 GGAAGGAAGCAAGAGGAGCCAGG + Intronic
1044584014 8:93852141-93852163 GAGAGGGAGGAGGAGGTGCCAGG + Intergenic
1044717345 8:95112719-95112741 GAGAGGAATCGGCAGGAGCATGG - Intronic
1044875885 8:96666020-96666042 GTTAGGAAGCAGAAGGAGTGAGG + Intronic
1044941322 8:97347188-97347210 GAGAGGGAGGAGGAGGATCCAGG + Intergenic
1045085437 8:98677861-98677883 AAGAGGTTGCAGAAGGAGTCAGG + Intronic
1045119012 8:99015106-99015128 AAGAGGAAAAAGAAGCAGCCAGG - Intronic
1045252890 8:100496128-100496150 GAGTGGAAGGAGAAGGGGCTGGG + Intergenic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045851454 8:106703796-106703818 GAAAGGAAGGAGAAGTAGCAAGG + Intronic
1046120458 8:109839952-109839974 TAGAGGAAGAAGAGGGATCCAGG - Intergenic
1046747226 8:117889170-117889192 GCAACAAAGCAGAAGGAGCCTGG + Intronic
1047174552 8:122528134-122528156 GAGAGTAAGGAGAATGAGCTGGG + Intergenic
1047222276 8:122928130-122928152 GAGATGGAGGAGATGGAGCCTGG - Intronic
1048026604 8:130592849-130592871 GGGAGGGAGCAGAAGGTCCCAGG - Intergenic
1048045186 8:130766397-130766419 GTGAGGATGCAGGAGGAGTCAGG + Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048495649 8:134933633-134933655 GGGAGGAAGCAGAAGTTGCCAGG + Intergenic
1048518916 8:135136116-135136138 GAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1048609594 8:136007767-136007789 GAGATGAAGCTGATGGAGCCAGG - Intergenic
1048838900 8:138547461-138547483 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1048880558 8:138869099-138869121 GAGAGGAAGGAGACAGAGCTGGG + Intronic
1048906527 8:139094547-139094569 GAGAGGAAGCAGCAGTTACCTGG - Intergenic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049070373 8:140351023-140351045 GCGAGAAAGCAGAAGCAGGCTGG + Intronic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049386861 8:142347250-142347272 GAGAGGGAGCAGCCGCAGCCTGG + Intronic
1049424763 8:142533090-142533112 GAGAGGGTGCAGACGCAGCCTGG + Intronic
1049872452 8:144991093-144991115 GAGAGGGAGCAGAAGCAGGGAGG - Intergenic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1049958280 9:713136-713158 GACAGCCAGCAGAAGGAGCGTGG + Exonic
1050043414 9:1519280-1519302 GAGAGGGAGCAGGAGGATGCTGG + Intergenic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1051329630 9:16010598-16010620 GTGAGGAAGCTGAAGAAGCGTGG - Intronic
1051464141 9:17357035-17357057 GACAGAAAGCAGAAAGAGACAGG - Intronic
1051544947 9:18263401-18263423 CGGAGGAAGCAACAGGAGCCAGG - Intergenic
1051746430 9:20299138-20299160 GAGAGGGAGCAGGAGCAGGCAGG + Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052995200 9:34548178-34548200 GAGAGGGGGCAGCAGAAGCCAGG + Intergenic
1053157121 9:35789311-35789333 AAAAGGAAGTGGAAGGAGCCTGG - Intergenic
1053174810 9:35915046-35915068 CAGAGGAAGCACAATGTGCCTGG - Intergenic
1053284745 9:36842869-36842891 GAGATGAAGCAGAAGGACTGGGG - Intronic
1054891436 9:70256778-70256800 GAGAGGAAGCAGCAGAGACCTGG + Intergenic
1055452418 9:76442973-76442995 GAGAGGAAGCAGGAGATGTCAGG + Intronic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1056048480 9:82743752-82743774 GAGAGGAAGTAGAGGGTCCCAGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056332713 9:85534886-85534908 GAGAGAGAGGAGAAGGAGACAGG - Intergenic
1057222061 9:93262785-93262807 GGGAAGCAGCAGCAGGAGCCAGG - Intronic
1057457213 9:95225453-95225475 AAGAGGCATCAGAAGGGGCCTGG + Intronic
1057555069 9:96081575-96081597 GAGAGGAAGGATAAGGGGGCAGG - Intergenic
1057705130 9:97390465-97390487 GGGAGGAGGGAGAATGAGCCAGG + Intergenic
1057816458 9:98299499-98299521 GAGGAGATGCAGAAGGATCCTGG + Intronic
1057826973 9:98378753-98378775 GATAGGAACCAGAAGGAGACAGG + Intronic
1058219408 9:102278375-102278397 GAAAGGAGGCAAAAGGAGACAGG - Intergenic
1058265724 9:102897311-102897333 GACAGGAAGTACAAGGAGCAGGG + Intergenic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1058713178 9:107698633-107698655 GAGAGGAAGATGGAGGAGCAGGG + Intergenic
1058885326 9:109318645-109318667 GAGAGGAGGCCTGAGGAGCCGGG - Intronic
1058976237 9:110127673-110127695 GACAGGAAGGAGAAGGAGCTGGG - Intronic
1059627150 9:116079470-116079492 GAGGGGATGAAGAAGGAACCTGG - Intergenic
1059800085 9:117741458-117741480 GAGAGGTAGCAGAGGCAGGCTGG - Intergenic
1059812028 9:117865967-117865989 GGGAGGAAGCAGGAGAAGGCAGG + Intergenic
1060044994 9:120332874-120332896 AAGTGGAAGTTGAAGGAGCCGGG - Intergenic
1060053435 9:120392984-120393006 GAGAGGGAGAAGCAGGAACCAGG - Intronic
1060252163 9:121995195-121995217 GAGAGGAAGAAGAGGGCACCTGG + Intronic
1060510548 9:124229040-124229062 GAGAGGCCGCTGAAGGACCCCGG + Intergenic
1060785954 9:126451705-126451727 GAGAGGAGGCACAAGGGTCCTGG + Intronic
1060921341 9:127422623-127422645 GAGAGGAAGCATAACTAGACTGG - Intergenic
1060976296 9:127767089-127767111 GAGAGGGAGCAGAATGTGCTGGG - Intronic
1061572691 9:131487536-131487558 GAGAGGAGGAGGAAGGAGCAAGG - Intronic
1061848932 9:133403397-133403419 GAGAGGAAGCAGCACAGGCCAGG - Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1061995791 9:134182151-134182173 GAGAGAAAAAAAAAGGAGCCGGG + Intergenic
1062168012 9:135118087-135118109 GAGAAGGAGCTGAAAGAGCCAGG - Intronic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1062571420 9:137187431-137187453 GCGGGGAACCAGAAGGAGCAAGG + Intronic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1062749965 9:138245627-138245649 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1203606028 Un_KI270748v1:58233-58255 GAGAGGAGGAAGAAGAAGCCAGG + Intergenic
1185449551 X:275204-275226 GAGAGGATGGAGAAGGAGCAGGG + Intergenic
1185745563 X:2569932-2569954 GAGAGAGAGGAGGAGGAGCCAGG + Intergenic
1185851075 X:3489279-3489301 GAGAGGAGGCAGAGGGAGAGAGG + Intergenic
1185851085 X:3489330-3489352 GAGAGGAGGCAGAGGGAGAGAGG + Intergenic
1186532452 X:10310985-10311007 GGGAGGAAGCTGAGGGAGCAAGG + Intergenic
1186731969 X:12419843-12419865 GAGATAAAGGAGGAGGAGCCAGG - Intronic
1186875886 X:13817257-13817279 GAGAGCAAGGAGGAAGAGCCCGG - Exonic
1186974970 X:14892342-14892364 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1187293914 X:17980943-17980965 GAGAGGCAGGAGAAGGGGCAGGG - Intergenic
1187293950 X:17981069-17981091 GAGAGGGAGGGGAAGGAGCAGGG - Intergenic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1188261867 X:28032910-28032932 GGCTGGAAGCAGAAGGACCCTGG + Intergenic
1188592050 X:31849526-31849548 GACAGGAAGCAGAAGAAGTACGG + Intronic
1188820193 X:34765700-34765722 TAGAGGAAGAAGAAGAAACCTGG + Intergenic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188965374 X:36545145-36545167 GATAGCCAGCAGAAGAAGCCTGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1189007181 X:37008876-37008898 GAGAGGAAGCTGGAGGACGCAGG + Exonic
1189110638 X:38286203-38286225 GAGAGGAAGGAGAAGGGGAGGGG - Exonic
1189232106 X:39460608-39460630 GACAGGAAGGAGAATGAGACTGG - Intergenic
1189737780 X:44089096-44089118 GAGAGGAAGAACAAGGAGGAGGG + Intergenic
1189857548 X:45238455-45238477 GAGAGGAAACAGAACGGGGCAGG + Intergenic
1189976276 X:46463573-46463595 GAGAGGAATGAGAAGGGGCTTGG - Intronic
1189982793 X:46528046-46528068 GAGAGGAATGAGAAGGGGCTTGG + Intronic
1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG + Intronic
1190608601 X:52170975-52170997 CCCAGGAAGCACAAGGAGCCAGG + Intergenic
1190723652 X:53172102-53172124 GAGAGGAAGAAGAGGGAGGGAGG + Intergenic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191635094 X:63367630-63367652 CCGAGGAAGCACAAGGAGTCAGG + Intergenic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1194771714 X:97915103-97915125 GAGAGCAAGCCGAAGGAGGGTGG + Intergenic
1195216720 X:102711345-102711367 AAGAGGATTCAAAAGGAGCCAGG + Intergenic
1195404433 X:104497312-104497334 GAGAGGAAGCAGAGGCAACCAGG - Intergenic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1195568862 X:106377129-106377151 AAGAGGTAGCAGAGGGAGCCTGG - Intergenic
1195860672 X:109379905-109379927 GTGAGGAAGCTGAAGTAGCTTGG - Intronic
1197535222 X:127679030-127679052 TAGAGGAAGTAGAAGGAGAGTGG + Intergenic
1197766602 X:130063394-130063416 GAGTGGTGGCAGAAGGAGCAGGG + Intergenic
1197790770 X:130251816-130251838 CAGAGGTGACAGAAGGAGCCAGG + Intronic
1197831641 X:130649089-130649111 GAGAGGAAGCAAGAGGAGAGGGG - Intronic
1198100144 X:133415702-133415724 GAGGGGAGGAAGGAGGAGCCGGG - Intergenic
1199684647 X:150255273-150255295 GTGAGGAAGCACAAGGAAGCTGG - Intergenic
1199830608 X:151545915-151545937 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1199998080 X:153039386-153039408 GAGAGGACACAGAAAGAGGCAGG - Intergenic
1200119614 X:153784144-153784166 GAGAGGATGGAGCAGGAGGCAGG - Exonic
1200230948 X:154443722-154443744 TGGAGGAAGCAGAGGGAGCGGGG + Intergenic
1200243837 X:154512276-154512298 AAGAAGAAGAAGAAGAAGCCGGG + Intronic
1200395710 X:155986330-155986352 GTGAGGACTTAGAAGGAGCCTGG - Intergenic
1200753406 Y:6967773-6967795 GAGAGAGAGCAGAAGGAGTGAGG - Intronic
1200842192 Y:7793854-7793876 GAGAGGAAGCTCAAGGAGAATGG + Intergenic
1201546993 Y:15176264-15176286 GAGAGGAAGCAGTAGGTGGCTGG - Intergenic
1202058227 Y:20857987-20858009 GTGAGGAAGCACAAGGGGTCAGG - Intergenic
1202378867 Y:24259795-24259817 GAGGGGAAGCAGCAGGACCTGGG - Intergenic
1202388192 Y:24344670-24344692 GAGAGGAGCAAGAAGAAGCCAGG + Intergenic
1202482595 Y:25325458-25325480 GAGAGGAGCAAGAAGAAGCCAGG - Intergenic
1202491915 Y:25410326-25410348 GAGGGGAAGCAGCAGGACCTGGG + Intergenic