ID: 1151579115

View in Genome Browser
Species Human (GRCh38)
Location 17:74968267-74968289
Sequence TGGCAAGGTCAGGGACTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151579115_1151579120 -10 Left 1151579115 17:74968267-74968289 CCCATCAGTCCCTGACCTTGCCA 0: 1
1: 0
2: 3
3: 22
4: 173
Right 1151579120 17:74968280-74968302 GACCTTGCCAGTAAGGCATATGG 0: 1
1: 0
2: 1
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151579115 Original CRISPR TGGCAAGGTCAGGGACTGAT GGG (reversed) Intronic
900408043 1:2500989-2501011 TGGCAAGGACAGGGAGGGAGTGG - Intronic
900740427 1:4327672-4327694 TGGCAAGGGCAGTGGGTGATGGG - Intergenic
905447039 1:38034281-38034303 TGGAAAGGACAGGGCCTGAAGGG + Intergenic
905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906165711 1:43684618-43684640 GGGCAAGGCCAGGGAGTGATAGG + Intronic
907309434 1:53530858-53530880 TGGCTGGGACAGGGACAGATGGG - Intronic
908169419 1:61489637-61489659 TGGCAAGGACAGTGATTGAGAGG - Intergenic
911512240 1:98821252-98821274 TTGCAAGGTCAGTGAATTATTGG - Intergenic
912962469 1:114208332-114208354 TGACAAATTCAGGGACTGAAGGG - Intergenic
914442875 1:147722427-147722449 TCCCCAGGTCAGGGACTGAATGG - Intergenic
915736800 1:158090341-158090363 TGGCAAGGCAAGGGGCTGGTAGG - Intronic
915907214 1:159887746-159887768 GGACAAGGCCAGGGACTGGTGGG - Intronic
916193393 1:162200285-162200307 AGCCAAGTTCTGGGACTGATGGG - Intronic
916928924 1:169553806-169553828 TGGCAAGGTCATGGAGAGAAAGG + Intronic
919593012 1:199527732-199527754 TGGCTAGCTCAGGCACTGATGGG - Intergenic
920757535 1:208748583-208748605 TGGGAAGGTCAAGGACAGAAAGG - Intergenic
923230857 1:231984858-231984880 TGGCAAGGACATGAACTGAACGG + Intronic
1064003396 10:11681920-11681942 TGGGAAGTTCACGGACTGATGGG - Intergenic
1064021490 10:11812989-11813011 TGAGAAGGTGAGGGGCTGATGGG - Intergenic
1064139233 10:12776570-12776592 TGAAAAGGTCATGTACTGATTGG - Intronic
1064527094 10:16268282-16268304 TGGTAAGGTCATTGACAGATGGG - Intergenic
1066243899 10:33563407-33563429 AGGCTGGGTCAGGGACAGATGGG + Intergenic
1067808318 10:49408315-49408337 TGGGAAGGGCAAGGACTGGTGGG - Intergenic
1068193213 10:53681531-53681553 TGGAAAGGGCAGGGAGTGAAGGG - Intergenic
1068531143 10:58187799-58187821 TGAGGAGGTCAGGGACTGAGAGG + Intergenic
1068945119 10:62722164-62722186 TGGCAAGGTCTGGACTTGATGGG + Intergenic
1070564301 10:77591752-77591774 GGGCAAGGTGGGGGATTGATGGG - Intronic
1071002978 10:80852144-80852166 AGGCAGGGACAGGGACTGTTGGG + Intergenic
1071551564 10:86570073-86570095 TGGAAAGCTCAGGGTCAGATGGG + Intergenic
1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG + Intronic
1073459868 10:103660377-103660399 AGGCAAGGTCCGGCACTGACAGG - Intronic
1075832705 10:125424817-125424839 TGGCAAGGGCACAGACTCATTGG - Intergenic
1075914622 10:126156806-126156828 TGTCAAGGTCAGGGCCTGAAAGG + Intronic
1079242035 11:18728283-18728305 TGGCAAGGTAGGGGGCAGATGGG - Exonic
1080680408 11:34470367-34470389 TGGCAAGGTCAGGGAGTGTCTGG - Intronic
1083265661 11:61545792-61545814 TGGCAAAGGAAGGGACTGATGGG + Intronic
1084164828 11:67370729-67370751 TGTCCAGGCCAGGGACTGAGGGG - Intronic
1084177968 11:67433279-67433301 GGGCAAGGGCAGGGCCTGGTGGG + Intronic
1084285808 11:68129702-68129724 TGGCAAGGTCAGTGAATGGAAGG - Intergenic
1084890642 11:72235338-72235360 TAGGAAGGTCAGGAACTGTTGGG - Exonic
1085405366 11:76258549-76258571 TGACATGCTCAGGGGCTGATGGG + Intergenic
1086241040 11:84691939-84691961 TGGCATGTTCAGGGAATGTTAGG - Intronic
1087309261 11:96521314-96521336 TGGAAGGGTAAGGTACTGATGGG + Intergenic
1088226826 11:107629812-107629834 TGACAAGGCCAGGGAATGTTAGG + Intronic
1088576707 11:111279251-111279273 TGGCAGGGTCAGGGAAAGATGGG - Intronic
1088933266 11:114373663-114373685 TCACATGTTCAGGGACTGATGGG - Intergenic
1091214245 11:133890789-133890811 TGCCAAAGTCAGGGTCTAATAGG - Intergenic
1091544444 12:1492014-1492036 TGGGAAGTTCCTGGACTGATGGG - Exonic
1093754533 12:22837798-22837820 TGTTAAGGACAGAGACTGATTGG - Intergenic
1096634730 12:52950922-52950944 TGGCCAGGCCAGGGATTGAGGGG + Intronic
1097884854 12:64718643-64718665 TGGCATGGTCAGGGACTGTTTGG + Intronic
1103049790 12:117769039-117769061 TGGCAAGCTCAGGGTCAGACAGG + Intronic
1103344208 12:120238463-120238485 TGGCTATGCCAGGGATTGATGGG + Intronic
1104088731 12:125496657-125496679 TGGCAAAGGCAGGGAGTGACAGG - Intronic
1104288086 12:127443660-127443682 TGTTAAGTTCAGGGACTCATGGG + Intergenic
1111950144 13:94703430-94703452 TGGCCAGGTCAGGGAGGGAGGGG - Intergenic
1112328433 13:98459400-98459422 TGGCAAGTTCAGGGCCCGGTGGG - Intronic
1115882189 14:37932146-37932168 AGCTAAGGTCAGGGACTGAGGGG + Intronic
1116763569 14:49043999-49044021 TGGCAAAGACAGGGACTGACAGG + Intergenic
1116826431 14:49677516-49677538 CGGCAGGGTCAGGGCCTGGTGGG - Intronic
1118607383 14:67514343-67514365 TGGCAAGGGCAGGGAGACATTGG - Intronic
1121960869 14:98258261-98258283 TGGCAAGTTCAGAGTCTGGTGGG + Intergenic
1122277950 14:100604898-100604920 TGGCAAGGACAGGGACGGGGAGG - Intergenic
1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123165999 14:106325213-106325235 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG + Intergenic
1123637769 15:22375979-22376001 TGGCAAGTGCAGGAACTGATGGG - Intergenic
1130483911 15:84387095-84387117 TGGCAAGGGCAGGGACTGAGCGG - Intergenic
1132296003 15:100734968-100734990 TGCCAAGGTCAAGGACAGGTGGG - Intergenic
1133306247 16:4811507-4811529 GGCCAGGGTCAGGGACTGACTGG + Intronic
1135181306 16:20276849-20276871 GGGCAAGGTATGGGAATGATGGG - Intergenic
1135980498 16:27143225-27143247 TGGAAAAGTCAGGGAGTGAGAGG - Intergenic
1136619417 16:31418235-31418257 TGGCAGAGTGAGGGACAGATTGG - Intronic
1139522426 16:67491894-67491916 TGGAAACTTCAGGGCCTGATAGG - Intergenic
1142221971 16:88859860-88859882 TGGCAAGGTCATGGTTTGCTGGG + Intronic
1148093311 17:45035547-45035569 GGGCAAGGTCAGGTGCTGTTAGG + Intronic
1149506493 17:57198210-57198232 TGTCAATGTCTGGGACAGATTGG + Intergenic
1151579115 17:74968267-74968289 TGGCAAGGTCAGGGACTGATGGG - Intronic
1153773106 18:8431191-8431213 TGACCAGGTCAGGGCTTGATTGG + Intergenic
1158966984 18:62630686-62630708 TGGCAAGGTTATGCCCTGATGGG - Intergenic
1161849957 19:6733067-6733089 TGGGAGGGTCAGGGAGAGATGGG + Intronic
1162734816 19:12740794-12740816 TGCCAGGGTCAGGGACTGGGAGG + Intronic
1162797792 19:13095588-13095610 GGGCAGGGGCAGGAACTGATGGG - Exonic
1163848207 19:19649415-19649437 TGGCAAGGTCAGGGGCTTTGAGG - Intronic
1164682519 19:30145138-30145160 TGGCAAGAGCAGGGACAGAAGGG + Intergenic
1165577841 19:36836912-36836934 TTGCAAGATCAGTGTCTGATAGG - Intronic
1202647982 1_KI270706v1_random:158520-158542 GGCCCAGCTCAGGGACTGATGGG - Intergenic
925481801 2:4283779-4283801 TGCCAGGGGCAGGAACTGATGGG - Intergenic
926145144 2:10392764-10392786 TGGCAAGGCCAGGGGCTGCATGG - Intronic
931209842 2:60182107-60182129 TGGCCAGGTCAGGGAGGGACAGG + Intergenic
931668190 2:64625003-64625025 TGGCATGGGCAGGGGCTGCTTGG - Intergenic
933096099 2:78183180-78183202 TCCCAAGGTTAGGGCCTGATTGG - Intergenic
935599415 2:104907306-104907328 TAGAGAGGTCAGGGACAGATGGG - Intergenic
936785928 2:116094362-116094384 TGGCATGCTCAGGCACTGGTGGG + Intergenic
938579162 2:132630748-132630770 TGGCAAGCTTAGGGATCGATTGG + Intronic
940286901 2:152041502-152041524 TGGCCAGGCCAGGGGCTGAAGGG + Intronic
940630421 2:156230721-156230743 TGGAAAGATCTGGGACTGAAGGG - Intergenic
942134314 2:172910058-172910080 TGGCAAGGGGCTGGACTGATGGG - Intronic
943506876 2:188771455-188771477 TTGTCAGGTCAGGGACTGTTGGG - Intronic
946238807 2:218341624-218341646 TGCCTAGGTCAGGGACTTACTGG - Exonic
1169890747 20:10449461-10449483 TGCCAAAGTCAGTGACTAATTGG - Intronic
1171482925 20:25467601-25467623 TGGCAACAGCAGGGACTGAGAGG - Intronic
1172449205 20:35009959-35009981 TGTCAAGTGCAGGTACTGATGGG + Intronic
1173905642 20:46626680-46626702 TGGGAAGGTCAGGGGATGAGGGG - Intronic
1173965005 20:47106028-47106050 TGGCAATGGCAGGAACAGATTGG + Intronic
1176125714 20:63473576-63473598 TGGCAGGGGCAGGGACTGGAGGG + Intergenic
1176414324 21:6466402-6466424 TCGCAAGGTAAGGGACTGCCGGG + Intergenic
1176603864 21:8814209-8814231 GGCCCAGCTCAGGGACTGATGGG + Intergenic
1176709995 21:10142472-10142494 TGGAAAAGTCAGGGAGTGTTGGG - Intergenic
1178624547 21:34204056-34204078 TGCCAGGGTCAGAGGCTGATGGG + Intergenic
1179557173 21:42187131-42187153 TGGCAGGGTCAGGGTCTGGTGGG + Intergenic
1179594522 21:42433462-42433484 GGGCAAGGTCAGGTCCTGATGGG - Intronic
1179689822 21:43074724-43074746 TCGCAAGGTAAGGGACTGCCGGG + Intronic
1180346149 22:11705786-11705808 GGCCCAGCTCAGGGACTGATGGG + Intergenic
1181581254 22:23829303-23829325 TGGCCAGGGCAGGTGCTGATGGG + Intronic
1185148441 22:49151497-49151519 TGGCAAGGGCAGGAAGTGACAGG + Intergenic
950431144 3:12951917-12951939 TGCCAAGGTCTGGGACGGAGGGG + Intronic
960695420 3:120391258-120391280 AGGCAGGGTAAGGGACTGAGGGG - Intergenic
964417326 3:156461083-156461105 AGGCAAGGTGAAGGACTGAGTGG - Intronic
964436143 3:156655908-156655930 GGGCAAGGTAAGGGACTGAGTGG - Intergenic
965101670 3:164306541-164306563 AGGGAAGGTCTGGGACTGAAGGG - Intergenic
968891498 4:3371794-3371816 TGGGAGGGTCAGGGAATGCTGGG + Intronic
971422758 4:26489167-26489189 TGGGAAGGTCTGGGGCTGAGTGG + Intronic
973374252 4:49276706-49276728 GGCCCAGCTCAGGGACTGATGGG - Intergenic
973383160 4:49333533-49333555 GGCCCAGCTCAGGGACTGATGGG + Intergenic
973386769 4:49518548-49518570 GGCCCAGCTCAGGGACTGATGGG + Intergenic
974245956 4:59317923-59317945 TGACAAGGTGAGGGACTACTTGG - Intergenic
975943766 4:79679924-79679946 TGGAAAGGTCATTGACTAATGGG - Intergenic
978632676 4:110765300-110765322 TGGCAAGGGAATGGAGTGATGGG + Intergenic
979037958 4:115749620-115749642 TAGCAAGGGCAGAAACTGATAGG - Intergenic
979400086 4:120238544-120238566 GGACAAGGTCAGGAACTGCTGGG + Intergenic
981652468 4:147075533-147075555 TGGCAAGGTCAGGTACAGTTGGG - Intergenic
983494494 4:168427960-168427982 TTGCAGGGCCAGGAACTGATGGG - Intronic
983533356 4:168832862-168832884 TGCCAAGGCCTGGGACTGAGGGG - Intronic
987215643 5:15734155-15734177 CAGCAAGGTCAGGGACTGGGCGG - Intronic
988990841 5:36669166-36669188 TGACAAGTTCAGGCACTCATGGG + Intronic
990175847 5:53107535-53107557 TGGAAAGGCCATGTACTGATTGG - Intronic
993092707 5:83446368-83446390 TGACTACCTCAGGGACTGATAGG + Intergenic
993124937 5:83822378-83822400 TGGCAGGGGCAGGGGATGATTGG - Intergenic
994379837 5:99057855-99057877 GGGCAAGGACAGAGACTGACAGG - Intergenic
999860195 5:155636555-155636577 TGACAGGGTCAGGGAAGGATGGG + Intergenic
1001574550 5:172754305-172754327 TGGGGAGGTTACGGACTGATTGG + Intergenic
1006673245 6:35743085-35743107 AGGGAAGGGCAGGTACTGATGGG + Intronic
1006840947 6:37027599-37027621 TGGGAAGGCCAGGGCCTGACGGG - Intronic
1007251711 6:40499747-40499769 CTGCAAGGTCAGAGGCTGATGGG + Intronic
1010496507 6:76539089-76539111 TGGCCAGGACATGGTCTGATGGG + Intergenic
1011957646 6:93043065-93043087 TGACAAGCTCAGGGTCTCATTGG + Intergenic
1012594419 6:101023468-101023490 TGGCATGCTCAGGCACTGGTAGG - Intergenic
1013400822 6:109794581-109794603 AGGGATGTTCAGGGACTGATTGG + Intronic
1018440834 6:163811526-163811548 TGGCAAGGTCATGTACTGCTAGG - Intergenic
1019304441 7:326322-326344 TGGGAAGGACAGGGAGTGAGTGG - Intergenic
1022055787 7:26732651-26732673 TGGCAAGGTCTAGTATTGATGGG - Intronic
1022625816 7:32034789-32034811 TTCCAAGGTCAGGAAATGATGGG - Intronic
1023847743 7:44132213-44132235 TGTAACTGTCAGGGACTGATGGG - Intergenic
1026376967 7:69761556-69761578 GTGCAGGGTCAGGGACTGAGGGG + Intronic
1026823501 7:73565977-73565999 TGGCAAGGTCAGAGGCTGTATGG + Intergenic
1027798598 7:82723948-82723970 TTGCAAGGTGAGGAACTGGTTGG + Intergenic
1027933521 7:84571121-84571143 TTGCAGGATCAGGGACGGATAGG - Intergenic
1031545168 7:123043808-123043830 TTGCCATGTCAGAGACTGATAGG + Intergenic
1032787247 7:135210921-135210943 TGGCCTCGTCAGGGACTCATCGG - Intronic
1033538294 7:142332193-142332215 TGGCAGGGTCAGGGCAGGATGGG - Intergenic
1033540634 7:142352844-142352866 TGGCAGGGTCAGGGCAGGATGGG - Intergenic
1033546702 7:142407667-142407689 TGGCAGGGTCAGGGCAGGATGGG - Intergenic
1033549505 7:142433934-142433956 TGGCAGGGTCAGGGAAGGATGGG - Intergenic
1033559962 7:142521792-142521814 TGGCAGGGTCAAGGAATAATAGG - Intergenic
1033560877 7:142529268-142529290 TGGCAGGGTCAGGGCAGGATGGG - Intergenic
1034079507 7:148263095-148263117 TGGTAAGATCAGAGACTGATCGG + Intronic
1034321279 7:150185043-150185065 TGGGATTGTCAAGGACTGATTGG + Intergenic
1034771471 7:153782221-153782243 TGGGATTGTCAAGGACTGATTGG - Intergenic
1035529365 8:338748-338770 TGGGAAGGTCAGGTCCTGAGCGG + Intergenic
1037882549 8:22580047-22580069 TGGCCAGGTGAAGGACTGGTGGG - Intronic
1039041231 8:33410589-33410611 TGGCAAGGTATGAGACTCATAGG + Intronic
1039050028 8:33484684-33484706 TGGCTAAGTCAGGGTCTGAGGGG + Intronic
1044907102 8:97016812-97016834 TGGCCTGTTCAGGGACTGGTAGG + Intronic
1047053285 8:121137421-121137443 TGGCAAATTCAGTGTCTGATGGG - Intergenic
1052622944 9:30937390-30937412 TAGCAATGTCAGGGACTGATCGG + Intergenic
1052996311 9:34553220-34553242 TGGCAAGGGCAGGGGGTGAGAGG + Intronic
1053148795 9:35730099-35730121 TGGCTAAGTCAGGGAATGATGGG + Intronic
1057096293 9:92313040-92313062 TGGCAGGGGAAGGGAGTGATAGG - Intronic
1058606087 9:106725004-106725026 AGGCGAGGTGAAGGACTGATTGG + Intergenic
1059789792 9:117628709-117628731 TGGCATGGTGAGGGGCAGATTGG - Intergenic
1061016499 9:127983771-127983793 GGGAAAGGTCAGAGAATGATTGG + Intergenic
1061054963 9:128217715-128217737 TGGCAAGGAAAAGGACTCATGGG - Intronic
1061672075 9:132194415-132194437 TGGAATGGTGAGGGACTGAGAGG - Intronic
1061952197 9:133942869-133942891 TGGCAGGGACAGGGACTGCACGG + Intronic
1062502539 9:136857598-136857620 TGGCAGGGGCAGGGATTGAGGGG + Intronic
1202794756 9_KI270719v1_random:111469-111491 TGGAAAAGTCAGGGAGTGTTGGG - Intergenic
1203697925 Un_GL000214v1:114617-114639 GGCCCAGCTCAGGGACTGATGGG - Intergenic
1203551281 Un_KI270743v1:166369-166391 GGCCCAGCTCAGGGACTGATGGG + Intergenic
1190253133 X:48742572-48742594 TAGAAAGGTCAGGGAGAGATGGG + Intergenic
1194790420 X:98141562-98141584 AGGTAAGGTCAGGGACTTTTAGG - Intergenic
1195916523 X:109941468-109941490 TGGTAAGTTCAGGGACTCACAGG + Intergenic
1196583673 X:117404938-117404960 TGTCAAGGTAAGGAACTGGTAGG - Intergenic
1202366338 Y:24168443-24168465 TGGCAAGGGCAAGGACTGAGTGG - Intergenic
1202374165 Y:24218201-24218223 TGGCAAGGGCAAGGACTGAGTGG + Intergenic
1202496616 Y:25451919-25451941 TGGCAAGGGCAAGGACTGAGTGG - Intergenic
1202504443 Y:25501680-25501702 TGGCAAGGGCAAGGACTGAGTGG + Intergenic