ID: 1151580466

View in Genome Browser
Species Human (GRCh38)
Location 17:74974779-74974801
Sequence GAGCGGGTGTGGAGGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151580457_1151580466 6 Left 1151580457 17:74974750-74974772 CCATCTGGGAGCAAAAGTGTGGC No data
Right 1151580466 17:74974779-74974801 GAGCGGGTGTGGAGGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151580466 Original CRISPR GAGCGGGTGTGGAGGGAAAG AGG Intergenic
No off target data available for this crispr