ID: 1151580921

View in Genome Browser
Species Human (GRCh38)
Location 17:74978178-74978200
Sequence CAAGGTGGAGTCTTGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151580912_1151580921 25 Left 1151580912 17:74978130-74978152 CCAAAGCAGTCACAGATAGATGG No data
Right 1151580921 17:74978178-74978200 CAAGGTGGAGTCTTGGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151580921 Original CRISPR CAAGGTGGAGTCTTGGAACT TGG Intergenic
No off target data available for this crispr