ID: 1151582880

View in Genome Browser
Species Human (GRCh38)
Location 17:74990111-74990133
Sequence CTGGCTCCTTTCCCATTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151582880_1151582888 30 Left 1151582880 17:74990111-74990133 CCCAGAAATGGGAAAGGAGCCAG 0: 1
1: 0
2: 0
3: 33
4: 356
Right 1151582888 17:74990164-74990186 GCAGCTTCTTGAGAGAGAGAAGG 0: 1
1: 1
2: 2
3: 33
4: 339
1151582880_1151582886 -9 Left 1151582880 17:74990111-74990133 CCCAGAAATGGGAAAGGAGCCAG 0: 1
1: 0
2: 0
3: 33
4: 356
Right 1151582886 17:74990125-74990147 AGGAGCCAGGGCATAGAGGTGGG 0: 1
1: 0
2: 4
3: 52
4: 499
1151582880_1151582885 -10 Left 1151582880 17:74990111-74990133 CCCAGAAATGGGAAAGGAGCCAG 0: 1
1: 0
2: 0
3: 33
4: 356
Right 1151582885 17:74990124-74990146 AAGGAGCCAGGGCATAGAGGTGG 0: 1
1: 0
2: 3
3: 42
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151582880 Original CRISPR CTGGCTCCTTTCCCATTTCT GGG (reversed) Intronic
901568215 1:10136755-10136777 CTGGCTACTTTTGCATTTTTAGG - Intronic
903544863 1:24117748-24117770 CTGGGTCCGATCCCATTTCCAGG - Intergenic
903780875 1:25819560-25819582 CTGGCCCCCTTCCCAGTTCTTGG - Intronic
903806453 1:26009233-26009255 GTGGCCCCTTTCCCATGTCCAGG - Intergenic
906039290 1:42775187-42775209 CTGCCTCCTTTGCCTTCTCTAGG + Exonic
906941928 1:50263035-50263057 CTGGCTCTTTTCTCTTCTCTTGG - Intergenic
906953472 1:50352781-50352803 CAGGCTTCTGTCCCATTTCTCGG + Intergenic
907260667 1:53216133-53216155 CTGGCTCTTCTCACACTTCTGGG + Intronic
907394175 1:54178052-54178074 TTGGCTCCATTCTCATTCCTTGG + Intronic
907499357 1:54867067-54867089 CTGGGTTCTTTCCCATGTCCTGG - Intronic
907506278 1:54920894-54920916 CTTGCTCCTTTCCCCTGTGTGGG + Intergenic
910065176 1:83143368-83143390 TTTGCTCCTTTCCCAGTCCTGGG + Intergenic
910468475 1:87525420-87525442 TGGACTCCTTTTCCATTTCTAGG + Intergenic
912210895 1:107555838-107555860 CTGTCTCCTTGCCCATTTGCTGG - Intergenic
916733548 1:167587338-167587360 GTGGCTCCTCTCACACTTCTGGG - Intergenic
917083825 1:171285377-171285399 CTGGCTCCTTCCCATTTTCCTGG - Exonic
917171785 1:172184673-172184695 TTTCCTCCTTTCCCATTCCTGGG - Intronic
918079105 1:181192082-181192104 GTGGCTCCTTTCCCATGTATAGG - Intergenic
918153336 1:181818131-181818153 CTGGCTGCTTCCCCATCCCTTGG - Intergenic
920339669 1:205267964-205267986 CATGCTCCTCTCCCAATTCTCGG + Intronic
920457273 1:206110624-206110646 GTGACTCCTTTCCCCTCTCTAGG - Intronic
922380049 1:225013932-225013954 CTGGCTACATCCCCCTTTCTAGG + Intronic
924094356 1:240535916-240535938 CTGGCTCATTCCCTACTTCTTGG - Intronic
924430838 1:243995103-243995125 CTAGCTCCTTTCCTTTTCCTGGG - Intergenic
924554499 1:245107279-245107301 TTGCCTCCTTTCCGCTTTCTGGG - Intronic
1068946265 10:62732564-62732586 CTCTCTCCTTTCCCCTTTCCTGG - Intergenic
1069470990 10:68689342-68689364 ATGGCTGCTTTACCTTTTCTTGG + Intronic
1070423532 10:76262487-76262509 ATGAGTCTTTTCCCATTTCTGGG + Intronic
1071337576 10:84613490-84613512 ATGGATCCATTCCCATTTGTAGG + Intergenic
1074832332 10:117257742-117257764 CTGCCTCCTCTCTCATTTCCAGG - Intronic
1075020291 10:118947206-118947228 CTGGCTTGTTCCCCATTACTTGG + Intergenic
1075450627 10:122549591-122549613 CAGGGGCCTTTCCCTTTTCTAGG - Intergenic
1076405347 10:130208649-130208671 CTGGCTCCATTCCCTCATCTGGG - Intergenic
1076550928 10:131277838-131277860 CTGGCTCCTTTCCATTCTCCAGG - Intronic
1077258486 11:1601713-1601735 CTGGCTCCTTTTCCATCATTAGG - Intergenic
1077635398 11:3838569-3838591 TTGTCTCTCTTCCCATTTCTTGG - Intronic
1077761609 11:5105653-5105675 CTGCCTCCCTTCTCATTTCTGGG + Intergenic
1078350602 11:10590023-10590045 CTAGCCCCTTTCCCAACTCTAGG - Intronic
1078432457 11:11298469-11298491 GTGGCCCCTTACCCATTCCTTGG + Intronic
1078857671 11:15219870-15219892 CTGCTTCCCTTCCCTTTTCTAGG + Intronic
1080624258 11:34014356-34014378 CTGTCTCCTTTACCAGCTCTTGG - Intergenic
1081640340 11:44748969-44748991 GTGGATCCATTCCCATTTTTGGG + Intronic
1081648837 11:44809466-44809488 ATGGCTCCTTCCCAATTCCTGGG - Intronic
1081795723 11:45818024-45818046 CTACCTCCTTTCCTATTTCTGGG - Intergenic
1084630106 11:70342323-70342345 CTGGCGACCTTCCCATTTCATGG - Intronic
1084803039 11:71558274-71558296 CTGGCTCCTTTTCCATCATTAGG + Intronic
1084804859 11:71571694-71571716 CTTTCTCTTTTCCTATTTCTCGG - Intergenic
1084901667 11:72314534-72314556 CTGGCCCCTTGTCCATCTCTAGG - Intronic
1085471705 11:76762707-76762729 CTTACTCCTCTCCCATCTCTCGG - Intergenic
1087915875 11:103810270-103810292 CTGGCTCCTTTTCCTATTCTAGG + Intergenic
1089093436 11:115897892-115897914 ATATCTCCTTTCCCATTGCTTGG + Intergenic
1089136849 11:116256111-116256133 GTGGCTCCTTGCCCATTTTGGGG - Intergenic
1089211148 11:116803724-116803746 ATCTCTCCTTTCCCATTTCCAGG - Intergenic
1090748296 11:129724437-129724459 CTGCCTGCTTTCCCAGGTCTTGG + Intergenic
1090817194 11:130308882-130308904 CTGACTCCTTTTCCCTTACTAGG - Intronic
1091312456 11:134584423-134584445 CTGGCTTCTCTCCCATGTGTGGG - Intergenic
1091347310 11:134864100-134864122 CTTGCGCCTCTCCCATTGCTCGG + Intergenic
1091970015 12:4779281-4779303 ATGGCACCTATCCCATATCTGGG - Intronic
1092131132 12:6114123-6114145 GGGGTTCCTTTCCCATTTCCAGG - Intronic
1092728205 12:11504864-11504886 CTGTGTCTTTTCCCATTTCATGG - Intergenic
1093566210 12:20607087-20607109 CAGTCTACTTTCCCATTTCCAGG - Intronic
1093722842 12:22464558-22464580 CTTCCTTCCTTCCCATTTCTGGG + Intronic
1094129764 12:27062624-27062646 CTGGCTCCTTTCCCCAATTTGGG + Intronic
1094213978 12:27921334-27921356 CTGGCTTCCTTGCTATTTCTGGG + Intergenic
1098547959 12:71731912-71731934 CTGGCTCTTTTCCGACTTCCTGG - Intergenic
1100617289 12:96240760-96240782 CTGGATCCTCTGCCATTTCAGGG - Intronic
1101349516 12:103915859-103915881 CTGGCTCATTTCTCTTTGCTTGG + Intergenic
1103270056 12:119666020-119666042 CTGGCTCCCATCCCTTTTCCTGG + Intergenic
1103270062 12:119666039-119666061 CTGGCTCCCATCCCTTTTCCTGG + Intergenic
1103899636 12:124296547-124296569 CTGGCTCCACTCCCCTTTCCTGG + Intronic
1104075130 12:125381990-125382012 CTGGATCTTAGCCCATTTCTGGG + Intronic
1106673907 13:31936838-31936860 ATGTCTCCTTTGACATTTCTAGG - Intergenic
1107552782 13:41492838-41492860 CTGGATCCCTTCCCCTCTCTGGG + Intergenic
1107859064 13:44643480-44643502 AGAGCTCCTTTCCCATGTCTGGG - Intergenic
1108087262 13:46806193-46806215 CTGGCTCGCTTCACATTTCATGG + Intergenic
1108912414 13:55572366-55572388 TTGGCTCCTTTGCCTCTTCTTGG - Intergenic
1110677193 13:78262951-78262973 CTGCCTCAGTTCCCATCTCTTGG + Intergenic
1112324924 13:98437767-98437789 CTGGCTCCTTTTCCCTTATTAGG + Exonic
1112671057 13:101639086-101639108 CTGTCTCCTATCTCATCTCTAGG + Intronic
1112813781 13:103249829-103249851 CTGGCTCCATTCCAGTTCCTTGG - Intergenic
1113458438 13:110465319-110465341 CTGTTTCCTTTCCCATTTCCCGG - Intronic
1113533546 13:111046419-111046441 GTGGCTCCTTCCCCAGGTCTGGG + Intergenic
1113606702 13:111613066-111613088 CTGTCTCCATTCCTATTTATAGG + Intronic
1114690998 14:24581142-24581164 TTGGCTCTTTTCCCAATCCTAGG + Intergenic
1115424062 14:33234309-33234331 CTTATTACTTTCCCATTTCTTGG - Intronic
1116049234 14:39782612-39782634 CAAACTCCTTTCCTATTTCTGGG - Intergenic
1117119178 14:52550523-52550545 CTGCCTCCTTTCTCTTTTTTGGG - Intronic
1117197985 14:53360381-53360403 CAGGCTCGTTTCAAATTTCTGGG + Intergenic
1117277751 14:54206726-54206748 CTGGCTGCTTTTCCTGTTCTTGG - Intergenic
1118550748 14:66947100-66947122 CTGGCTCCTCCCTGATTTCTAGG + Intronic
1119253525 14:73178482-73178504 CTGGCTCTTTACCCTCTTCTGGG + Intronic
1119501515 14:75132007-75132029 CTGGTGCCTTTCCCCTTTTTAGG - Exonic
1119568321 14:75647493-75647515 CAGGCTCAATTCCCATTTCAAGG - Exonic
1119600304 14:75971491-75971513 CTGGTTCCTTTGCCATATCAGGG - Intronic
1121128557 14:91425277-91425299 CTAGCTCCTTTTCCCTTACTAGG + Intergenic
1121318564 14:92976911-92976933 AAGGCTCCTTTCCCACTTCAGGG + Intronic
1121319945 14:92986488-92986510 CTGGCTCCGATCACTTTTCTAGG - Intronic
1121638674 14:95471020-95471042 AAGTCTCCTTTCACATTTCTGGG - Intronic
1121793120 14:96713679-96713701 CTGGCCCCCTTCCCTCTTCTGGG + Intergenic
1122391098 14:101385190-101385212 CTCAATCATTTCCCATTTCTTGG + Intergenic
1123404138 15:20010371-20010393 GTGGCTGCATTCCCATATCTGGG + Intergenic
1123513476 15:21017017-21017039 GTGGCTGCATTCCCATATCTGGG + Intergenic
1123583597 15:21737951-21737973 CTTGCTTCTTTCAAATTTCTTGG + Intergenic
1123620247 15:22180554-22180576 CTTGCTTCTTTCAAATTTCTTGG + Intergenic
1126509239 15:49448893-49448915 CTGGATACTTTCTCATATCTAGG + Intronic
1129262797 15:74378174-74378196 CTCTCTCCTTACCCTTTTCTGGG - Intergenic
1129317681 15:74755252-74755274 CAGGCTGCTTTCCAATTCCTGGG - Exonic
1130079518 15:80720271-80720293 CTGAGGCCTTTCCCCTTTCTTGG + Intronic
1130311381 15:82758530-82758552 CTAGGTTTTTTCCCATTTCTTGG + Exonic
1131351516 15:91705062-91705084 CTGGCTCTTTTGCCATCTCTGGG + Intergenic
1131731247 15:95283671-95283693 CTGCCAGCTCTCCCATTTCTGGG - Intergenic
1132105133 15:99058029-99058051 CTGGCTTCCTTCCCACCTCTGGG + Intergenic
1132781961 16:1632109-1632131 CTGTCTCCTTTCTCCTTTCTCGG + Intronic
1133080099 16:3311761-3311783 CTGCCTCCTTTCCCAGCTCATGG - Exonic
1133458284 16:5962449-5962471 CTGCCTCCTTTCCCATTATGTGG + Intergenic
1133787700 16:8986010-8986032 CTTGCTCCCTTCCCATTTGCAGG + Intergenic
1134114603 16:11538715-11538737 CCGGCACTTTTCCCATTTCTTGG + Intergenic
1135298044 16:21300624-21300646 TTGGCTCCTTTCCCAGTTTGGGG + Intronic
1135394218 16:22118821-22118843 CTGGCTGCTTGCCCCTTCCTGGG + Intronic
1135499290 16:22979868-22979890 TTGGCTCCTTTGCCACTTCCAGG - Intergenic
1135824371 16:25713617-25713639 CTGGATCCTGGCCCATTCCTTGG - Intronic
1136088720 16:27903423-27903445 CTGTCTCCTCTCCCCTGTCTTGG - Intronic
1136690025 16:32022324-32022346 TTGGCTCCTCTCCCAGTTTTTGG + Intergenic
1136710689 16:32234370-32234392 CTGCCTCCTTTCTCTTTCCTGGG + Intergenic
1136757222 16:32695041-32695063 CTGCCTCCTTTCTCTTTCCTGGG - Intergenic
1136790614 16:32965885-32965907 TTGGCTCCTCTCCCAGTTTTTGG + Intergenic
1136810886 16:33175334-33175356 CTGCCTCCTTTCTCTTTCCTGGG + Intergenic
1136817362 16:33285414-33285436 CTGCCTCCTTTCTCTTTCCTGGG + Intronic
1136823926 16:33341943-33341965 CTGCCTCCTTTCTCTTTCCTGGG + Intergenic
1136879201 16:33888047-33888069 TTGGCTCCTCTCCCAGTTTTTGG - Intergenic
1137032019 16:35532543-35532565 CTGCCTCCTTCCTCTTTTCTGGG - Intergenic
1137711379 16:50569183-50569205 GTGGATGCTTTCCCATGTCTGGG + Intronic
1137914761 16:52417318-52417340 CCTGTTCCTTTCCCTTTTCTGGG + Intergenic
1137970009 16:52975545-52975567 CTGGCTTCTGCCCCATTTCCAGG + Intergenic
1138256620 16:55569443-55569465 CTGGCAGCTTTCCCCTTTCTTGG - Intronic
1138416556 16:56874930-56874952 TTGGCTCCTCTCCTTTTTCTGGG + Intronic
1139684554 16:68592759-68592781 CTGGCTCCTTCCCCACTTTCAGG + Intergenic
1140045475 16:71437752-71437774 CTGGCTTCTTTCTCATTCATTGG + Intergenic
1141355334 16:83340036-83340058 CTGTGACCTTTCCCATCTCTGGG + Intronic
1141857986 16:86697819-86697841 CTCTCCCCTTTCCCATCTCTAGG + Intergenic
1203059372 16_KI270728v1_random:955392-955414 CTGCCTCCTTTCTCTTTCCTGGG - Intergenic
1203092816 16_KI270728v1_random:1227343-1227365 TTGGCTCCTCTCCCAGTTTTTGG + Intergenic
1142653573 17:1373930-1373952 CTGGCTTCTTTCCCATAGCATGG + Intronic
1143541375 17:7571506-7571528 ATGTCTCCCTTCCCATTTATGGG - Exonic
1144276865 17:13678531-13678553 CTGGCTTCTGTCCCTTTCCTTGG + Intergenic
1144420567 17:15094191-15094213 CTGCCTCCCTCCCCATTTCTTGG - Intergenic
1145933675 17:28702924-28702946 CTGGCTCCCTTTCCTTTGCTTGG + Intergenic
1146682020 17:34815289-34815311 CTGGCTCCTTCCCCACACCTTGG - Intergenic
1147152881 17:38528470-38528492 TTGGCTCCTCTCCCAGTTTTTGG + Intergenic
1147410076 17:40244330-40244352 CTGGCTCTTTTCTCATTTTGGGG + Intronic
1149863317 17:60136517-60136539 CTGGCTCCTTTCAGATCTGTGGG - Intergenic
1149981126 17:61312264-61312286 CTTGCTCCCTTCCCCTTCCTTGG - Intronic
1150508853 17:65727100-65727122 CAGGCTCGTGCCCCATTTCTGGG - Intronic
1151171372 17:72249112-72249134 CTTCCCCCTTTCCCATTGCTTGG - Intergenic
1151419445 17:73987580-73987602 TGGGCTCCTTTCTCATTTCCTGG - Intergenic
1151439780 17:74120664-74120686 CTGGCTGCCTTCCCTTCTCTGGG - Intergenic
1151582880 17:74990111-74990133 CTGGCTCCTTTCCCATTTCTGGG - Intronic
1152947079 17:83203759-83203781 GTGGCTCCTTTTCCCTTCCTAGG + Intergenic
1153389827 18:4544002-4544024 CTTGCTCCCTTCCAAATTCTTGG - Intergenic
1154172767 18:12063181-12063203 GTGGCTCCTTTGGCTTTTCTTGG + Intergenic
1155253958 18:23978524-23978546 GTGGCTCCTACCCCAATTCTAGG - Intergenic
1155846766 18:30717879-30717901 CTTTCTCCTTTCTCATTTCAGGG + Intergenic
1156626884 18:38920229-38920251 CTGGCTTCAGTCCCCTTTCTAGG + Intergenic
1156723804 18:40103069-40103091 CTGTCATCTTTCCCATATCTGGG + Intergenic
1157282002 18:46352239-46352261 CTGGCTGCCTTCCCATTTTCTGG - Intronic
1157692243 18:49692884-49692906 CTGGCTACTCACTCATTTCTTGG - Intergenic
1157698527 18:49744451-49744473 TTTTCTCCTTTCCCATCTCTTGG - Intergenic
1158095631 18:53767199-53767221 CTGGCTGCTTTGTCAGTTCTTGG - Intergenic
1159657535 18:71050526-71050548 TTGCCACCTATCCCATTTCTGGG + Intergenic
1160615091 18:80120104-80120126 CTGCCTCCTTTACCCTTTCCAGG - Intronic
1161382950 19:3976159-3976181 CGTGTTCCTTTCCCCTTTCTGGG + Exonic
1161401860 19:4069410-4069432 CTTGCTCCTTGTCCATCTCTGGG - Intergenic
1161624410 19:5317741-5317763 CTGGCCCCTTACTAATTTCTAGG - Intronic
1162077148 19:8195555-8195577 CTGGCTCGGTGCCCATCTCTGGG - Intronic
1163092723 19:15032243-15032265 TTGGGCCCTTTCCCATTTCTAGG - Intergenic
1163218440 19:15897506-15897528 CTGGCTCCTGGCCCATGTCCTGG - Exonic
1163827562 19:19532268-19532290 CATGCTCCATTCCCCTTTCTTGG + Intronic
1166694924 19:44846874-44846896 CTGTCCCCCTCCCCATTTCTCGG + Intronic
1166777437 19:45321788-45321810 CTGGGTCCCTTCTCCTTTCTGGG - Intronic
1167102303 19:47411230-47411252 CAGGCCCATTTCACATTTCTAGG + Intronic
1167758597 19:51428806-51428828 CGGGCTCATGGCCCATTTCTTGG - Intergenic
1167912769 19:52717456-52717478 CAGGCTGCTTTCCTATTCCTGGG - Intronic
1167932187 19:52874907-52874929 CAGGCTTCTTTCCTTTTTCTGGG - Intronic
1168501152 19:56894633-56894655 CTGGGTCCTTTTCCCTTTCCTGG + Intergenic
925909669 2:8565595-8565617 CTGGCTCCCTGCCCTGTTCTGGG + Intergenic
927270596 2:21205661-21205683 ATGGCTCCTTTCCTATATATAGG + Intergenic
927458489 2:23277546-23277568 CTGGCAACTTTGCCATTCCTTGG - Intergenic
927748865 2:25648170-25648192 CTGTCACCTTTCACTTTTCTTGG + Intronic
927824306 2:26297443-26297465 CTGGCTGCTTTCCCTTTACTAGG + Intergenic
927962176 2:27247711-27247733 ATGGCTCCTTTCTCTCTTCTAGG - Intergenic
929435608 2:41926437-41926459 CTGGCTCCTTTCCTCTTACCTGG - Intergenic
930034173 2:47075243-47075265 CTGGATCCTTTGCCTCTTCTTGG + Exonic
932144484 2:69306191-69306213 TTGGCTCCTTTCCTTTTTTTTGG - Intergenic
934473676 2:94578142-94578164 CTGGCCCCTGTGCCCTTTCTGGG - Intergenic
934576072 2:95402433-95402455 CTGGCGCCTTTCCCATTGTTGGG - Intergenic
934638249 2:96010290-96010312 CTGGCGCCTTTCCCATTGTTGGG - Intergenic
934775305 2:96933563-96933585 CTGGCTCCTGCCCCCCTTCTGGG + Intronic
934795403 2:97095120-97095142 CTGGCGCCTTTCCCATTGTTGGG + Intergenic
934985535 2:98882136-98882158 CCGGCTGAGTTCCCATTTCTAGG - Intronic
937844621 2:126566009-126566031 CTGGCTTCTTCTCCATCTCTAGG - Intergenic
938317339 2:130339303-130339325 CTGAAGCCTTTCCAATTTCTGGG - Intronic
938611630 2:132953594-132953616 CTCCCTCCTTTGGCATTTCTAGG - Intronic
938639424 2:133264848-133264870 CAGCCTCCCTTCCCTTTTCTGGG - Intronic
938948889 2:136239320-136239342 CTGTCTCCTTTCCCATCCTTGGG + Intergenic
940753854 2:157659395-157659417 TTTGTTCCTTTCCCATTCCTAGG - Intergenic
941300453 2:163794835-163794857 CTGGCACCTGTCCTCTTTCTTGG + Intergenic
941758756 2:169217592-169217614 CTTTCTCCTCTCCCATTTCAGGG + Intronic
942029395 2:171943935-171943957 CAGGCTCGTATCCAATTTCTGGG - Intronic
942762584 2:179417089-179417111 CTCTCTCCTTTCCCCCTTCTGGG - Intergenic
944867791 2:203879627-203879649 CTAGCTGCTTTCCCATTTACTGG + Intergenic
945603447 2:211895930-211895952 CTGGCTTCGTTCCAGTTTCTTGG + Intronic
946959871 2:224973342-224973364 CACGCTCCTCTCCCATCTCTAGG - Intronic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
948063833 2:235062007-235062029 CTGTCTGCCTTCCCATTCCTGGG - Intergenic
948074733 2:235156927-235156949 CTGGGTGCTCTCTCATTTCTTGG - Intergenic
948139387 2:235661495-235661517 CAGCCCCCTTTCCCATTCCTAGG - Intronic
948682921 2:239648601-239648623 CTGCCACCTTTCCCAACTCTGGG + Intergenic
1169312897 20:4562201-4562223 CTAGTTTATTTCCCATTTCTGGG - Intergenic
1170828822 20:19821620-19821642 CTTGCTCCTTTCTCACTTCTAGG + Intergenic
1173239437 20:41280820-41280842 CCCTCTCATTTCCCATTTCTTGG - Intronic
1173558321 20:43983561-43983583 CTGGCTCTTTTTCCCATTCTGGG - Intronic
1173558501 20:43985028-43985050 CTGGCTTCATTTCCACTTCTTGG - Intronic
1174089572 20:48036261-48036283 CTGGCTCCTCTCCTATGTCCAGG - Intergenic
1174555517 20:51392653-51392675 CAGGTTCATTTCCCATTTCCTGG + Intronic
1174707246 20:52669430-52669452 CTGGCTCCTTTCCCTTCCCTGGG - Intergenic
1175263040 20:57686674-57686696 CAGGCTCCTTCCCCCTCTCTGGG + Intronic
1175752950 20:61511786-61511808 CTGGGTGCCTTCCCATATCTTGG + Intronic
1175815884 20:61883058-61883080 CGGGTTCATTTCTCATTTCTGGG - Intronic
1176364553 21:6024975-6024997 CTTGCTCTTCTCCCTTTTCTGGG - Intergenic
1176520088 21:7817910-7817932 CTGGCTTCTTCCCGACTTCTTGG + Exonic
1176938400 21:14894189-14894211 CTGGCTAATTTTCCATTTCTAGG + Intergenic
1177268461 21:18813608-18813630 TTGGTTCCTTAGCCATTTCTAGG + Intergenic
1177345771 21:19867557-19867579 CTTGCTACTTTCCCACTGCTTGG + Intergenic
1177440729 21:21120578-21120600 CAGGCTCCTTTTTCATTTCAGGG - Intronic
1178654115 21:34447922-34447944 CTGGCTTCTTCCCGACTTCTTGG + Intergenic
1179017734 21:37607621-37607643 TTGGCTCCTGTCCCATTTTTTGG - Exonic
1179758965 21:43513570-43513592 CTTGCTCTTCTCCCTTTTCTGGG + Intergenic
1180964859 22:19782755-19782777 CTAGCTCCTTCCCTGTTTCTGGG + Intronic
1182761168 22:32723491-32723513 CTGCCTCCATTCCCTTATCTGGG - Intronic
1183260257 22:36790251-36790273 CTTCCTCCTTTGCCATGTCTAGG - Intergenic
1183315288 22:37133690-37133712 GTGGATCCTGTCCCACTTCTGGG + Intronic
1184098117 22:42327484-42327506 GTGTCTCCTGTCCCATTTCCTGG - Intronic
1184110029 22:42389116-42389138 CAGTCTCCTTGCCCATGTCTCGG + Intronic
1184832101 22:46995377-46995399 TCGGCTCATTTTCCATTTCTAGG + Intronic
949625662 3:5863929-5863951 GGGGCTCTTTTCCCATCTCTGGG - Intergenic
953094622 3:39762713-39762735 TTGGGTCATTTGCCATTTCTAGG + Intergenic
953889521 3:46742067-46742089 CTGACTCTTTTCTCTTTTCTGGG - Intronic
954347077 3:50009056-50009078 CTGGCTCCTTATCCACCTCTTGG + Intronic
954859697 3:53677164-53677186 CTGCCTCCTTCTCCATTTCAGGG + Intronic
955653735 3:61222019-61222041 CTGGCTCCTGGCCCAGTGCTCGG + Intronic
955933023 3:64077018-64077040 CTTCCTCCTTTCCCACTTTTGGG - Intergenic
956158747 3:66325728-66325750 CTGGCTCATTTCCCATAACCGGG - Intronic
956623030 3:71240062-71240084 CTGCCTCCATTCTCATTTCTTGG - Intronic
957222853 3:77406753-77406775 CTTCATGCTTTCCCATTTCTCGG + Intronic
957284977 3:78206671-78206693 CTGGCCCCACTCCCATTTCGAGG + Intergenic
957776025 3:84757673-84757695 CTGTCTTATTTACCATTTCTTGG + Intergenic
959320836 3:104873092-104873114 CTGTCTCCTTTCTCATTAGTTGG - Intergenic
959659459 3:108849990-108850012 CTGGCTCTATTACCATTTCTAGG - Intronic
960180518 3:114570604-114570626 ATGGCTCCATAACCATTTCTTGG + Intronic
960596897 3:119415046-119415068 CTAGCTCCTTTCCCTCTGCTAGG - Exonic
961293334 3:125864856-125864878 CTGACCCCTTTCCCACTTTTCGG + Intergenic
962196407 3:133367496-133367518 CTGCCTAATTTCCCATTTCAAGG - Intronic
962371011 3:134820717-134820739 CAGGCTGCTTTCTCTTTTCTTGG + Intronic
964292066 3:155192602-155192624 CTGGCACCCTTCCCTCTTCTGGG + Intergenic
966037146 3:175432982-175433004 CTGGTTCATTTCACATTTCCTGG + Intronic
967954458 3:194867709-194867731 CTGGGTCCCCTCCCACTTCTGGG + Intergenic
969131754 4:4995440-4995462 CTGGGTCCTTTCCCCTGGCTTGG - Intergenic
971325781 4:25642488-25642510 CTGGGTCCCCTCCCAGTTCTTGG - Intergenic
972656603 4:41069369-41069391 CTTGCTCCTTTGGCATTACTGGG - Intronic
973122576 4:46540894-46540916 TTGGCTCCTTTCTCATTTTCAGG - Intergenic
975907746 4:79235020-79235042 CTGGCCCCTTTCTCCTTTCTTGG - Intronic
976764889 4:88589901-88589923 ATTGCTCCTATCCCATTTCTAGG + Intronic
978186082 4:105858387-105858409 CTGGCTTCTGTCCCCTTTCCAGG + Intronic
978592183 4:110336069-110336091 GTTGTTCTTTTCCCATTTCTAGG - Intergenic
978885344 4:113761399-113761421 CTGGCTGTTTTTCCATTTCCCGG - Intronic
979560744 4:122098994-122099016 CTGCCTCCTTGCTCATATCTTGG - Intergenic
979736827 4:124096921-124096943 CTGCCACCTTACCCCTTTCTTGG + Intergenic
979956882 4:126964529-126964551 CTTTCTCCTTTCCTATTTATTGG - Intergenic
980572066 4:134632284-134632306 TTGGCTCATTCCCCATTGCTAGG + Intergenic
982827800 4:160022292-160022314 CTGGCTAATTTCTCAATTCTAGG + Intergenic
983745643 4:171195938-171195960 CTGTCTCCTTTCACACTCCTGGG - Intergenic
984774858 4:183472664-183472686 TTCGCTTCTTTCTCATTTCTAGG + Intergenic
987769698 5:22284865-22284887 CTGGCTTCTTTCCCTTTTCCTGG - Intronic
987933009 5:24427015-24427037 GTCTCTCCTTTCCCTTTTCTAGG + Intergenic
988778171 5:34496005-34496027 CTGGACCCTTCCCCACTTCTCGG + Intergenic
989685179 5:44077568-44077590 CTGCCTCCTTTCCCCTTTAGTGG + Intergenic
991932527 5:71767876-71767898 CAGGTTGCATTCCCATTTCTTGG - Intergenic
993623761 5:90198773-90198795 CTGGGTCCTGCTCCATTTCTGGG - Intergenic
994451723 5:99951703-99951725 CTGGCTCCCTGCTTATTTCTTGG - Intergenic
995461585 5:112409561-112409583 CTCTCTCCTTTCCGTTTTCTAGG - Intronic
996471357 5:123864636-123864658 CTGTCTTCTTATCCATTTCTGGG - Intergenic
996854990 5:127995734-127995756 CTGGCCGCTTTCCCAGTTCCAGG - Intergenic
997204180 5:132031986-132032008 CTGGGTCTTCTCCCATTTCCTGG - Intergenic
998646494 5:144067765-144067787 CAGGCCCCTTTCCCATAGCTGGG - Intergenic
999115618 5:149160951-149160973 TCAGCTCCTTTCCCATCTCTCGG + Intronic
999882392 5:155880600-155880622 CTGTCTCCTTTCCCAATACATGG - Intronic
1000194397 5:158943773-158943795 ATGCCTTCTTTCCCATTTCAGGG - Intronic
1000702761 5:164473722-164473744 CAGGCTCCCTTGCCATTTTTGGG + Intergenic
1001018783 5:168165383-168165405 CTGGCTCCCTTCCCCGTTCCTGG + Intronic
1001097806 5:168789321-168789343 CTGGCAGCTTTCCCAGTTATTGG - Intronic
1001549999 5:172595874-172595896 CTTGCTGCGTTCCCCTTTCTGGG + Intergenic
1001807682 5:174601953-174601975 CTGCATCTTTTCCCAATTCTGGG + Intergenic
1002090518 5:176802877-176802899 CTGCCTCCTCTCCCAGCTCTCGG + Intergenic
1003368995 6:5506517-5506539 CAGGCTCCTTCCCCATGTTTTGG + Intronic
1003398840 6:5775249-5775271 GGGCTTCCTTTCCCATTTCTTGG - Intergenic
1003619029 6:7681066-7681088 CTGGCTGATTGCCCATTGCTGGG + Intergenic
1005320144 6:24645684-24645706 CTGCCCTCTTTCCTATTTCTCGG + Intronic
1005473270 6:26182869-26182891 CTGCCACCATTCCCATTTCCCGG - Intergenic
1006806407 6:36792367-36792389 CTGGATGCTTTTCCAATTCTAGG - Intronic
1006963568 6:37959001-37959023 CTGGGTCATTACCCATTTGTTGG + Intronic
1009459727 6:63897859-63897881 CTGGCTCCTTATTCATCTCTGGG - Intronic
1010011486 6:71052244-71052266 CTGGCTCCTTTTCCTTTATTAGG - Intergenic
1010499060 6:76572418-76572440 CTGTGTCTTCTCCCATTTCTTGG + Intergenic
1012655516 6:101814202-101814224 CTTGCTCCTTTCACATTGTTTGG - Intronic
1013691791 6:112653281-112653303 CTTGCTCTGTTCTCATTTCTTGG + Intergenic
1015460105 6:133480926-133480948 CTTCCACCTCTCCCATTTCTTGG - Intronic
1015474797 6:133648365-133648387 CTTGCTCCTTCCCCAGTGCTTGG - Intergenic
1018446501 6:163863609-163863631 CAGGCTCCTTCCCCAATTTTGGG + Intergenic
1018669873 6:166168982-166169004 CTGCCTCCTTCCCCCTTCCTGGG - Intergenic
1018774894 6:167005527-167005549 CTGGCACCGTTCCAACTTCTCGG - Intronic
1019026232 6:168965434-168965456 CTGGCACCTTTCCCACTGCCAGG + Intergenic
1020964440 7:14847388-14847410 CTGCATCCTTTCCCATCCCTAGG - Intronic
1022141484 7:27496874-27496896 CTGGCTCCTTCACTATTTATAGG + Intergenic
1022382919 7:29876930-29876952 CTGGCTCCTTTTTTTTTTCTTGG + Intronic
1022456116 7:30559721-30559743 CTGGCTTCTTTCCTGTTTCCAGG + Intergenic
1022680875 7:32544717-32544739 GTGGCTCCATTTCCATTTCTGGG - Exonic
1022766671 7:33420329-33420351 CTGGCTCCCTTCCCTTTGCTAGG + Intronic
1023152377 7:37214155-37214177 GTGGCAGCTGTCCCATTTCTGGG - Intronic
1024082250 7:45865157-45865179 CTGCCTCCTCGCCCATTTCCTGG - Intergenic
1025101479 7:56138938-56138960 CTGGCTTCCTTCCCATTTGAAGG + Intergenic
1025186197 7:56861349-56861371 CTGGCTACTATAACATTTCTTGG - Intergenic
1025685723 7:63715560-63715582 CTGGCTACTATAACATTTCTTGG + Intergenic
1026229590 7:68471414-68471436 CTGGATCCTTTCAGAGTTCTGGG + Intergenic
1026624043 7:71976557-71976579 CTCGTTCATTTCCCATCTCTGGG - Intronic
1027206007 7:76099969-76099991 CTGGCTGCTGTAACATTTCTTGG - Intergenic
1027278932 7:76591380-76591402 TTTGCTCCTTTCCCAGTCCTGGG - Intergenic
1029910894 7:104146387-104146409 CTGGGTTCTTTCCCGTTTTTTGG - Intronic
1030146019 7:106356828-106356850 CTGACTCCTTTCCTATCTTTTGG + Intergenic
1030398517 7:109018930-109018952 CTGGCTCCTTCACCTTTTCTAGG + Intergenic
1030875950 7:114813483-114813505 CTTGCTCCTTTGCCTTCTCTTGG - Intergenic
1031435282 7:121725229-121725251 CTGTCTCCCTTCCCTTTGCTAGG + Intergenic
1031963411 7:128009853-128009875 TTGACTCCTTTCTCATTTCTTGG - Intronic
1032984360 7:137320409-137320431 CTGGATCATTTCACACTTCTAGG + Intronic
1034433670 7:151053146-151053168 CTGACTCCTTTCCCACATTTGGG + Intergenic
1035907211 8:3526529-3526551 CTGGGGCCGTTCCCATTCCTGGG - Intronic
1036236946 8:7047366-7047388 CTGGCTCATTTCCCAGACCTGGG - Intergenic
1036547638 8:9787477-9787499 TTGCCTCCTTCCCCATTACTTGG - Intergenic
1036761308 8:11510621-11510643 CTGTCTCTTTCCCCCTTTCTGGG + Intronic
1037519953 8:19671044-19671066 CTGGCTTCTGTCTCCTTTCTAGG - Intronic
1037585141 8:20270871-20270893 CTGGTTGATTTCACATTTCTGGG + Intronic
1041526335 8:58810561-58810583 CAGGCTCATTTCCAATTCCTGGG + Intronic
1043300810 8:78729244-78729266 CTGACTGTTTTCCCTTTTCTAGG + Intronic
1043378561 8:79678068-79678090 CTGACTCCTTTCCCCTTTCCAGG + Intergenic
1044018405 8:87074401-87074423 CTGGATTCTTCCCCATTCCTAGG + Intronic
1048006403 8:130422708-130422730 CTGGCTCCTGTCCCCTTTATGGG - Intronic
1048845846 8:138603021-138603043 GGGGCTCTTTTCCCATCTCTTGG + Intronic
1049242607 8:141545819-141545841 CTGGTTCCTTTCCGTTTCCTAGG + Intergenic
1049623939 8:143611820-143611842 CTGGCTCCTGGCCCAACTCTGGG - Intergenic
1052235723 9:26211661-26211683 CTGGCCCCTTTCAGAATTCTGGG - Intergenic
1052587495 9:30448145-30448167 TTGGCTCCTTTTGTATTTCTGGG + Intergenic
1052620448 9:30901794-30901816 CTTGGTCCTATCCCAATTCTTGG - Intergenic
1053684654 9:40510370-40510392 CTGGCCCCTGTGCCCTTTCTGGG + Intergenic
1053934620 9:43138648-43138670 CTGGCCCCTGTGCCCTTTCTGGG + Intergenic
1054279072 9:63114595-63114617 CTGGCCCCTGTGCCCTTTCTGGG - Intergenic
1054297748 9:63345832-63345854 CTGGCCCCTGTGCCCTTTCTGGG + Intergenic
1054395764 9:64650343-64650365 CTGGCCCCTGTGCCCTTTCTGGG + Intergenic
1054430408 9:65155538-65155560 CTGGCCCCTGTGCCCTTTCTGGG + Intergenic
1054499972 9:65865983-65866005 CTGGCCCCTGTGCCCTTTCTGGG - Intergenic
1054918016 9:70513683-70513705 CAGGCTGCTTTCAGATTTCTGGG + Intergenic
1055692861 9:78852301-78852323 CTGCTTCCTTTGACATTTCTGGG + Intergenic
1057397237 9:94691002-94691024 CTGGCTCCTGCCCTGTTTCTAGG + Intergenic
1057729251 9:97594554-97594576 CTGGCTCTTTGCCCATGGCTGGG + Intronic
1058643594 9:107110083-107110105 CTTGCTCTTTGCCCACTTCTTGG + Intergenic
1058794272 9:108483147-108483169 CTGCCTCCTTCCTCATTCCTGGG - Intergenic
1059410912 9:114131773-114131795 CTGGCTCTGTTCCCCTTTCTGGG + Intergenic
1060669382 9:125455793-125455815 CTTGCTCCTTCCCTTTTTCTTGG + Intronic
1060681998 9:125574498-125574520 CTGTGTCTTCTCCCATTTCTGGG - Intronic
1061195007 9:129102772-129102794 CTCCCTCCTTTCCCCTCTCTGGG + Intronic
1062437215 9:136551584-136551606 CTTCCTCCTTCCCCCTTTCTCGG + Intergenic
1186564793 X:10651096-10651118 CTGGCTCTTTTCGCAGATCTTGG + Intronic
1187037802 X:15560154-15560176 ATGGGTCCTTTGCCATGTCTGGG + Intergenic
1187249153 X:17581374-17581396 CAGTCTCTCTTCCCATTTCTGGG - Intronic
1188338176 X:28964710-28964732 CTGGATTTTTTCTCATTTCTTGG + Intronic
1188961071 X:36492072-36492094 CTGGCTCCTTTCACATACCATGG + Intergenic
1191683887 X:63869371-63869393 CTGGCTCCTTTGTCATCTGTGGG - Intergenic
1192052284 X:67735578-67735600 GTAGGTCCTTTCCCCTTTCTGGG + Intergenic
1193284643 X:79697262-79697284 CTGGCTTCTGTCCCCTTTCCAGG + Intergenic
1195272298 X:103243574-103243596 ATTACTCCTTTCACATTTCTTGG + Intergenic
1196899018 X:120365177-120365199 CTAGATCCTGTCCCATCTCTGGG + Intronic
1198296474 X:135292443-135292465 CTGCCTCCTTTCCCAGCTCATGG + Exonic