ID: 1151584911 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:75003137-75003159 |
| Sequence | CGGGGTGGGGGCGGAGGAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 5042 | |||
| Summary | {0: 1, 1: 1, 2: 26, 3: 296, 4: 4718} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1151584911_1151584923 | 8 | Left | 1151584911 | 17:75003137-75003159 | CCCTCTCCTCCGCCCCCACCCCG | 0: 1 1: 1 2: 26 3: 296 4: 4718 |
||
| Right | 1151584923 | 17:75003168-75003190 | CTCACTACCCGCCAGGTGCAAGG | 0: 1 1: 0 2: 1 3: 11 4: 111 |
||||
| 1151584911_1151584922 | 1 | Left | 1151584911 | 17:75003137-75003159 | CCCTCTCCTCCGCCCCCACCCCG | 0: 1 1: 1 2: 26 3: 296 4: 4718 |
||
| Right | 1151584922 | 17:75003161-75003183 | TGCGACTCTCACTACCCGCCAGG | 0: 1 1: 0 2: 0 3: 0 4: 50 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1151584911 | Original CRISPR | CGGGGTGGGGGCGGAGGAGA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||