ID: 1151584911

View in Genome Browser
Species Human (GRCh38)
Location 17:75003137-75003159
Sequence CGGGGTGGGGGCGGAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5042
Summary {0: 1, 1: 1, 2: 26, 3: 296, 4: 4718}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151584911_1151584923 8 Left 1151584911 17:75003137-75003159 CCCTCTCCTCCGCCCCCACCCCG 0: 1
1: 1
2: 26
3: 296
4: 4718
Right 1151584923 17:75003168-75003190 CTCACTACCCGCCAGGTGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 111
1151584911_1151584922 1 Left 1151584911 17:75003137-75003159 CCCTCTCCTCCGCCCCCACCCCG 0: 1
1: 1
2: 26
3: 296
4: 4718
Right 1151584922 17:75003161-75003183 TGCGACTCTCACTACCCGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151584911 Original CRISPR CGGGGTGGGGGCGGAGGAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr