ID: 1151588672

View in Genome Browser
Species Human (GRCh38)
Location 17:75028519-75028541
Sequence ACTTGGGCCACATGTCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151588668_1151588672 15 Left 1151588668 17:75028481-75028503 CCTTTGTTCATGTTTCAGTAGAT No data
Right 1151588672 17:75028519-75028541 ACTTGGGCCACATGTCAAACAGG No data
1151588671_1151588672 -9 Left 1151588671 17:75028505-75028527 CCTATTCACATTTTACTTGGGCC No data
Right 1151588672 17:75028519-75028541 ACTTGGGCCACATGTCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151588672 Original CRISPR ACTTGGGCCACATGTCAAAC AGG Intergenic
No off target data available for this crispr