ID: 1151589705

View in Genome Browser
Species Human (GRCh38)
Location 17:75035100-75035122
Sequence AGCTGCAGCCGGAGACCGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151589698_1151589705 19 Left 1151589698 17:75035058-75035080 CCGGAGCGTTTAATGGCCATCAA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1151589705 17:75035100-75035122 AGCTGCAGCCGGAGACCGCGTGG 0: 1
1: 0
2: 0
3: 12
4: 133
1151589703_1151589705 -9 Left 1151589703 17:75035086-75035108 CCTCTCTAGGAGGTAGCTGCAGC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1151589705 17:75035100-75035122 AGCTGCAGCCGGAGACCGCGTGG 0: 1
1: 0
2: 0
3: 12
4: 133
1151589701_1151589705 3 Left 1151589701 17:75035074-75035096 CCATCAAATTGGCCTCTCTAGGA 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1151589705 17:75035100-75035122 AGCTGCAGCCGGAGACCGCGTGG 0: 1
1: 0
2: 0
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151589705 Original CRISPR AGCTGCAGCCGGAGACCGCG TGG Intronic
900160979 1:1223696-1223718 AGTGTCAGCCGGAGACCCCGAGG - Intronic
901235358 1:7664700-7664722 ACCTGCAGCCGGAGACCAACGGG + Exonic
901436067 1:9248148-9248170 AGCTGCAGCGGGAGCACCCGAGG + Intronic
901530010 1:9846838-9846860 TGCTGCAGCCAGAGACAGCAGGG - Intergenic
902509902 1:16960888-16960910 AGCTGAAGCTGGAGGCGGCGCGG + Exonic
904585471 1:31577382-31577404 GGCAGCAGTCGGAGACCGTGCGG - Exonic
906535231 1:46547745-46547767 AGCTGAAGCCGGGGACCCGGGGG - Exonic
906637118 1:47416986-47417008 ACCTGCAGCCGGAGCTAGCGGGG + Exonic
911208559 1:95117319-95117341 AGCGGGAGCCGGAGCCCGAGCGG + Exonic
911311535 1:96297901-96297923 AGCTGCAGCAGGTGACAGCAAGG + Intergenic
916170237 1:161996438-161996460 AGCTGCTGCCAGAGACAGAGCGG - Intronic
916174180 1:162023939-162023961 AGATGCAGCCAGTGACCGCGCGG + Intergenic
920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG + Intergenic
920372232 1:205486259-205486281 AGCTGCAGACAGAGACAGAGGGG - Intergenic
1064014761 10:11763315-11763337 AGCTGCAGGAGGAGACCATGCGG + Exonic
1064553049 10:16521398-16521420 GGCTGCAGCCGGCGCCGGCGCGG + Exonic
1065140382 10:22714103-22714125 AGCTGCAGCCGGAGGAGGAGGGG + Intronic
1070579910 10:77711393-77711415 AGCAGGAGCCCGAAACCGCGGGG + Intergenic
1070786784 10:79166571-79166593 AGCTGGAGCAGGAGAACGAGAGG + Intronic
1070825947 10:79390778-79390800 AGCTGCAGCTGGAGGCCGACAGG + Intronic
1072968854 10:99999020-99999042 AGCTGCAGACAGAAACCACGTGG - Intronic
1073299298 10:102461306-102461328 AGCTGCGCCCGGGGGCCGCGCGG + Intergenic
1075166291 10:120071052-120071074 AGCTGCAGCCTGAGCCAGAGGGG + Intergenic
1075642748 10:124076514-124076536 AGCTGCAGCCCGTGCCCCCGGGG + Intronic
1075684377 10:124353577-124353599 TGCTGCAGCCAGAGACCCTGAGG + Intergenic
1076334013 10:129692868-129692890 AGCTGCAGCCCCAGACCTCGCGG + Intronic
1076765510 10:132630907-132630929 AGCTGCTGCCGGAGACGCCACGG - Intronic
1076797010 10:132803276-132803298 AGCTGCAGCTGGAGCCCCCGCGG - Intergenic
1076993589 11:288231-288253 CGGTGCAGCCGGAGACGCCGGGG - Intergenic
1081854600 11:46295631-46295653 AGCAGCAGCCGGTGGCGGCGTGG - Intronic
1085796805 11:79548896-79548918 AGGGGCAGCCGGAGATCGTGAGG + Intergenic
1089046323 11:115504312-115504334 AGCCGGAGCCGGAGCCCGGGAGG + Exonic
1098519750 12:71421497-71421519 AGCTGCAGCAGGGGACAGTGTGG - Intronic
1100468808 12:94873084-94873106 AGCAGCAGCCGCAGCCCCCGAGG + Intergenic
1102058017 12:109911187-109911209 AGCTGCAGCTGGAGCGGGCGCGG + Exonic
1102651754 12:114447434-114447456 GGGCGCAGCCGGAGACCGCCCGG + Intergenic
1110436462 13:75482103-75482125 CGCTGGAGCCGGCGGCCGCGGGG - Exonic
1112041452 13:95552522-95552544 AGCTGCAGATGGAGAACCCGGGG + Intronic
1112494898 13:99896523-99896545 AGCTGCACCGGGAGCCTGCGGGG - Exonic
1113493786 13:110712987-110713009 AGCTGCGGCCGCAGAGTGCGCGG - Intronic
1118299414 14:64601884-64601906 CGGTTCAGCCGGAGACCGCTGGG + Intergenic
1124629268 15:31327613-31327635 AGCGGGAGCCGGGGCCCGCGGGG + Exonic
1128454256 15:67823690-67823712 AGCTGCAGGAGCAGAGCGCGGGG - Intronic
1129817249 15:78565741-78565763 AGCAGCAGGCGGAGCGCGCGGGG - Exonic
1132365266 15:101252112-101252134 AGCTCCAGTCGCAGACCGCGCGG - Intergenic
1132750993 16:1457646-1457668 AGCTGGAGCCTGAGGCCGCCGGG - Intronic
1140859800 16:79008816-79008838 ACCTGCAGCCGGAGACCAGGGGG + Intronic
1141586660 16:85038266-85038288 ACCTTCAGCCGGAGAAAGCGGGG - Intronic
1142374866 16:89701637-89701659 CGCGGCGGCCGGAGACCGCTGGG - Exonic
1142393450 16:89817040-89817062 TTCGGCAGCCGGAGACCGCGCGG + Intergenic
1143063373 17:4222239-4222261 AGCTGCAGTCGGCGGCCGCGGGG + Intronic
1143166775 17:4900772-4900794 AGGTGAAGCCGGAGCCCCCGCGG - Exonic
1143443918 17:6996224-6996246 AGCTGCAGCTGCGGCCCGCGCGG + Exonic
1148787191 17:50151082-50151104 GGCGGCTGCCGGAGACCGAGCGG + Intergenic
1151589705 17:75035100-75035122 AGCTGCAGCCGGAGACCGCGTGG + Intronic
1151854309 17:76710549-76710571 AGCGGCAGCCGGAGCCCCGGGGG + Intronic
1158395685 18:57077153-57077175 AGCTGCAGCCTGAGTCTGTGGGG + Intergenic
1159158296 18:64610970-64610992 AGCTACAGCCTGAGACTGCAAGG + Intergenic
1159948708 18:74463068-74463090 AGCTGCAGCCCAAGAACGTGGGG + Intergenic
1160025445 18:75211826-75211848 AGCCGCCGCCGGAGTTCGCGGGG - Intronic
1160718863 19:589061-589083 AGCTGCACCCGGAGTCCGAGGGG + Intergenic
1160720332 19:594386-594408 AGCAGCAGCAGGAGACGGCAGGG - Intronic
1160927929 19:1555939-1555961 AGCTCCAGGCGGAGGCCGCCGGG + Exonic
1160935598 19:1593011-1593033 AGCTGTGCCCGGAGTCCGCGCGG + Intergenic
1161171169 19:2813133-2813155 AGCTGCATCCTGAGACCCGGCGG + Exonic
1161400403 19:4064673-4064695 AGCTGCCTCCGGAGAGGGCGTGG - Intronic
1163437769 19:17305542-17305564 AGCTGCGCCCGGCCACCGCGGGG + Intronic
1163851923 19:19669102-19669124 AGCTCCACCCGGCGACCGAGGGG - Intronic
1164572698 19:29385675-29385697 GGCTGCAGCCAGAGACAGGGAGG - Intergenic
1164835086 19:31350784-31350806 AGCGGGAGCCGGAGCCCGAGCGG + Intergenic
1165944807 19:39435734-39435756 AGCTGGAGCCGGAGCTCACGGGG - Intronic
1166234717 19:41447262-41447284 AGCTGAAGCCTCAGACAGCGTGG - Intergenic
1167080807 19:47275089-47275111 GGGTGCCGCGGGAGACCGCGTGG - Exonic
1167251076 19:48398678-48398700 AGCTGCAGCACGAGGCTGCGCGG - Exonic
1167306703 19:48713944-48713966 AGCTGCAGCAGGAGCCGGAGTGG + Exonic
1167313960 19:48753149-48753171 GGCTGCCGCCGGAGCGCGCGAGG + Intronic
1167341891 19:48921314-48921336 AGCTGCAGCAGGTGACAGCGGGG + Exonic
927279080 2:21287832-21287854 AGCTGCAGCCAGAGACAGGGCGG + Intergenic
927310858 2:21629792-21629814 TGCTGCAGCCAGAGACTGGGAGG + Intergenic
927781534 2:25943268-25943290 AGCTGCAGCCTCAGACCCCATGG + Intronic
932699680 2:73984599-73984621 GGCTGCAGCCGGGGCCGGCGAGG - Intergenic
933666908 2:84971402-84971424 CACTGCAGCCGGAGCCCGGGAGG + Exonic
933776122 2:85772266-85772288 AGCTGCAGCCAAAGGCCGCCAGG - Intronic
934763729 2:96869390-96869412 CGCTCCAGCCGGGGACGGCGCGG + Intronic
940272602 2:151908060-151908082 AGCTGCAGGAGGAGACCGTGAGG + Intronic
942947142 2:181683708-181683730 AGCGGCAGCCGGAGCGCCCGCGG + Intergenic
946354873 2:219178319-219178341 AGCCGCCGCCCGAGCCCGCGAGG - Exonic
948402019 2:237691780-237691802 AGCTGCGGCCGGAGCCTGAGGGG + Intronic
948705617 2:239790450-239790472 AGCTTCAGCAGGAGTCAGCGGGG - Intronic
1170222075 20:13951865-13951887 AGCTGCAGCTGGAGATTGCTTGG - Intronic
1173353320 20:42264547-42264569 AGCTACAGCTGGAGGCCACGAGG - Intronic
1174598758 20:51707058-51707080 AGCTGCAGCCTGTGACGGCTGGG - Intronic
1178487131 21:33026268-33026290 TGCTGCATCTGGAGACCACGGGG - Exonic
1180219990 21:46352427-46352449 AGCCAGAGCCGGAGCCCGCGGGG - Intronic
1182555601 22:31126900-31126922 ACCTGCAGCGGGAGGCCACGTGG - Exonic
1182801965 22:33038875-33038897 AGCTGCAGGCGGAAGCCCCGGGG + Intronic
1183411039 22:37655309-37655331 AGCGGGAGCCGGAGACCTGGGGG - Exonic
1183464730 22:37973810-37973832 AGGTGAAGACAGAGACCGCGGGG - Exonic
1185030988 22:48442825-48442847 AGCTGCAGCAGGAGCTCCCGGGG + Intergenic
950831198 3:15877990-15878012 AGCAGCAGCGGGCGGCCGCGTGG + Intergenic
953221296 3:40974073-40974095 AGCTGGAGCTGGAGCCCGCAGGG - Intergenic
962301833 3:134250472-134250494 AGCTGCAGTCGGCTTCCGCGGGG - Exonic
966298747 3:178454959-178454981 AGCTGCAGCAAGAGACCCAGTGG - Intronic
968353325 3:198080718-198080740 AGCGGCTTCCGGAGTCCGCGCGG - Intergenic
968598092 4:1495681-1495703 AGCTGCAGCCTCTGACCTCGGGG - Intergenic
969484563 4:7464952-7464974 CGCTGCAGCCTGAGGCCACGTGG + Intronic
969615756 4:8251751-8251773 GGCTGCAGCAGGAGACAGGGCGG + Intergenic
980998260 4:139802298-139802320 TGCTGCAGCCAGACACTGCGGGG - Intronic
981782246 4:148442934-148442956 AGCTGCAGGTGGAGAGCGTGAGG - Intronic
982134309 4:152258900-152258922 AGCTGCAGCAGGAGAGGGTGGGG - Intergenic
983262124 4:165468689-165468711 AGTTACAGCAGGAGACCGTGGGG - Intronic
984922511 4:184778199-184778221 AGGTGCAGCCGGAGGCAGTGGGG - Intronic
984973422 4:185209921-185209943 AGCGGCGGCCGGAGTCCCCGGGG + Intronic
988934159 5:36066199-36066221 AGCTGCATCCGGAGCCAGGGTGG - Intronic
995533718 5:113115218-113115240 AGCTGCAGCCTGAGTAAGCGAGG + Intronic
995565880 5:113433163-113433185 AGCTGGAGTCGGAGCCCCCGAGG + Exonic
996378963 5:122845260-122845282 AGCTCCAGCCGGAGTCCGCAGGG + Intronic
996853890 5:127983108-127983130 AGCTGAAGCCCCAGACCTCGGGG - Intergenic
1005942455 6:30571023-30571045 AGCAGCTGCCGGAGCCCGAGTGG - Intergenic
1005942536 6:30571507-30571529 AGCAGCCGCCGGAGCCCGAGTGG + Exonic
1006366748 6:33620868-33620890 AGCTGGGCGCGGAGACCGCGCGG + Exonic
1006491712 6:34393083-34393105 AGCTGCAGCCTGAGACATCTGGG + Intronic
1006516068 6:34546425-34546447 AGCTGCATACGGAGGCTGCGCGG - Intronic
1007434587 6:41799842-41799864 AGGTGCAGCCGGAGAACCTGAGG + Exonic
1019198676 6:170296735-170296757 AGGTGCTGCAGGAGCCCGCGCGG + Intronic
1019276616 7:179259-179281 AGCTGGAGCCGGTGTCCCCGAGG - Intergenic
1019490025 7:1308173-1308195 ATATGCAGCCCGAGAACGCGTGG + Intergenic
1029375641 7:100175570-100175592 ACCTGCAGGCGGAGGCGGCGGGG + Exonic
1031982319 7:128135882-128135904 AGCGGGAGCGGGAGGCCGCGGGG + Intergenic
1033186540 7:139231738-139231760 CGCTGCAGCGGGAGCCCCCGCGG + Exonic
1036210003 8:6834312-6834334 CGCTGCAGCTCTAGACCGCGGGG + Intronic
1043354997 8:79401701-79401723 AGCTGCAACCAGAGACCTGGCGG + Intergenic
1047203163 8:122782707-122782729 AGGTGCAGGGGGAGTCCGCGCGG + Intronic
1053569374 9:39288277-39288299 AGCTGCGGCGCGAGTCCGCGGGG - Intronic
1054127771 9:61330733-61330755 AGCTGCGGCGCGAGTCCGCGGGG + Intergenic
1054595291 9:67059312-67059334 AGCTGCGGCGCGAGTCCGCGGGG + Intergenic
1061283592 9:129610388-129610410 CACTGAAGCCGGAGTCCGCGTGG - Intronic
1061472227 9:130835559-130835581 AGCAGCAGCGGGAGGGCGCGCGG - Intronic
1061971102 9:134045968-134045990 AGCTGCCGCTGGACACAGCGTGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1185511343 X:667090-667112 AGCTGCAGCCGGAAGACGCAAGG + Intergenic
1189961301 X:46327338-46327360 AGCAGCAGCAGGAGACCTGGTGG + Intergenic
1192263428 X:69523047-69523069 AGCTGCAGCCGCAGAGCCTGTGG - Intronic
1196683976 X:118495541-118495563 AGCTGCGGGCGGAGCCCGAGCGG + Intergenic
1196707399 X:118727862-118727884 AGCCGCAGCCGCCGAGCGCGGGG - Intronic
1200070669 X:153527510-153527532 AGCTGCAGAAGGAGAGAGCGAGG - Intronic