ID: 1151594176

View in Genome Browser
Species Human (GRCh38)
Location 17:75066833-75066855
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151594170_1151594176 -6 Left 1151594170 17:75066816-75066838 CCTCACTCCTGGGACCTGAGAAC No data
Right 1151594176 17:75066833-75066855 GAGAACAGTGGGAAGACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151594176 Original CRISPR GAGAACAGTGGGAAGACATT GGG Intergenic
No off target data available for this crispr