ID: 1151595265

View in Genome Browser
Species Human (GRCh38)
Location 17:75074509-75074531
Sequence CAGGGACAGGATGCCTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151595252_1151595265 17 Left 1151595252 17:75074469-75074491 CCTCCCAGGACTCTGAGTGGATG No data
Right 1151595265 17:75074509-75074531 CAGGGACAGGATGCCTAGGTGGG No data
1151595254_1151595265 14 Left 1151595254 17:75074472-75074494 CCCAGGACTCTGAGTGGATGGCA No data
Right 1151595265 17:75074509-75074531 CAGGGACAGGATGCCTAGGTGGG No data
1151595255_1151595265 13 Left 1151595255 17:75074473-75074495 CCAGGACTCTGAGTGGATGGCAT No data
Right 1151595265 17:75074509-75074531 CAGGGACAGGATGCCTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151595265 Original CRISPR CAGGGACAGGATGCCTAGGT GGG Intergenic
No off target data available for this crispr