ID: 1151595825

View in Genome Browser
Species Human (GRCh38)
Location 17:75077567-75077589
Sequence GTGGCGCTCGACTGCGACGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151595824_1151595825 -10 Left 1151595824 17:75077554-75077576 CCGCACGCTGGGCGTGGCGCTCG 0: 1
1: 0
2: 1
3: 1
4: 53
Right 1151595825 17:75077567-75077589 GTGGCGCTCGACTGCGACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1151595818_1151595825 12 Left 1151595818 17:75077532-75077554 CCGTGCTGCACGGCGCCTACCAC 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1151595825 17:75077567-75077589 GTGGCGCTCGACTGCGACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1151595821_1151595825 -3 Left 1151595821 17:75077547-75077569 CCTACCACCGCACGCTGGGCGTG 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1151595825 17:75077567-75077589 GTGGCGCTCGACTGCGACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1151595823_1151595825 -7 Left 1151595823 17:75077551-75077573 CCACCGCACGCTGGGCGTGGCGC 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1151595825 17:75077567-75077589 GTGGCGCTCGACTGCGACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151595825 Original CRISPR GTGGCGCTCGACTGCGACGC CGG Intergenic
905546493 1:38804285-38804307 GCGGCCCTCGGCTGCGCCGCCGG + Intergenic
912619362 1:111139893-111139915 GTCTCGCGCGCCTGCGACGCGGG + Exonic
1062795207 10:339932-339954 GTGGCGCACGAGGGCGAGGCGGG + Intronic
1064622553 10:17229928-17229950 GTCGCGCTCCACCTCGACGCGGG - Exonic
1065050444 10:21786608-21786630 GTGGCGCACGCCTGCTACGCGGG - Intronic
1081492699 11:43580102-43580124 GTGGCGCTGCACTGCGAAGAAGG + Intronic
1113104456 13:106757942-106757964 GTGGCTCTCTACTGCGTCCCAGG - Intergenic
1116360118 14:43983893-43983915 GTCTCGCTCTACTGCCACGCTGG + Intergenic
1122558389 14:102593304-102593326 GTGGTGCCCGACTTCGACCCCGG + Exonic
1148060146 17:44830360-44830382 GTGGCGCTCGAGTGGGAGGGGGG + Intronic
1148462669 17:47847350-47847372 GGGGGGCTCCACTGCGCCGCCGG + Exonic
1151595825 17:75077567-75077589 GTGGCGCTCGACTGCGACGCCGG + Intergenic
1165150488 19:33757254-33757276 GTGGCGCACGCCTGCTACTCTGG + Intronic
1167383494 19:49151271-49151293 CAGTCGCTCGACTGCGACGCAGG - Exonic
1171013792 20:21522565-21522587 CTGGAGCGCGACTGCGCCGCTGG + Intergenic
1179585798 21:42373429-42373451 GAGGAGCTCGTCTGTGACGCTGG - Intronic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
955210331 3:56934774-56934796 GTGGCGCTCGTCGGGGAGGCTGG - Intronic
957560124 3:81812060-81812082 GTGGCGCTCGTCAGGGAGGCTGG + Intergenic
968199393 3:196739771-196739793 GTGGCGCTCGTCTCCGCCCCGGG + Intergenic
977206570 4:94170154-94170176 GCGGCGCTCGTCTGGGAGGCTGG - Intergenic
990753197 5:59039748-59039770 GTGGCGCCCGGCTGCGCCGGGGG - Intronic
993500505 5:88661022-88661044 TTGGCGCGCGACTGGGAGGCCGG - Intergenic
998307832 5:141096564-141096586 GTGGCGGTGGACGGCGACTCGGG + Exonic
998308469 5:141102417-141102439 GTGGCGGTGGACGGCGACTCGGG + Exonic
998310378 5:141123763-141123785 GTGGCGGTGGACGGCGACTCGGG + Exonic
998312819 5:141152019-141152041 GTGGCGGTGGACGGCGACTCGGG + Exonic
998315003 5:141174603-141174625 GTGGCGGTGGACGGCGACTCGGG + Exonic
998315579 5:141179805-141179827 GTGGCGGTGGACGGCGACTCGGG + Exonic
998316120 5:141184327-141184349 GTGGCGGTGGACGGCGACTCGGG + Exonic
998316676 5:141189086-141189108 GTGGCGGTGGACGGCGACTCGGG + Exonic
998317310 5:141194320-141194342 GTGGCGGTGGACGGCGACTCGGG + Exonic
998317982 5:141201542-141201564 GTGGCGGTGGACGGCGACTCGGG + Exonic
998319509 5:141215891-141215913 GTGGCGGTGGACGGCGACTCGGG + Exonic
998320483 5:141225273-141225295 GTGGCGGTGGACGGCGACTCGGG + Exonic
998321494 5:141236322-141236344 GTGGCGGTGGACGGCGACTCGGG + Intergenic
998322723 5:141247346-141247368 GTGGCGGTGGACGGCGACTCGGG + Exonic
1006740664 6:36306117-36306139 GTGGGACTTGACTGAGACGCAGG - Intronic
1007390656 6:41547913-41547935 GTGGCGCTAGAATGCGACCTGGG + Intronic
1012851029 6:104446597-104446619 GTGGCGCTCGTCGGGGAGGCTGG - Intergenic
1049761481 8:144333783-144333805 GCGGCCCCCGACGGCGACGCCGG - Exonic
1060305339 9:122406250-122406272 GTGGCGCTCGACGGGGAGGCTGG + Intergenic
1061864122 9:133483755-133483777 GTGGGGATGGACTGCGAGGCTGG + Intergenic
1062528978 9:136991687-136991709 GTGGCGCACGCCTGTGAGGCAGG - Intergenic
1198972551 X:142298297-142298319 GTGGCGCTCGTCGGGGAGGCTGG + Intergenic