ID: 1151601775

View in Genome Browser
Species Human (GRCh38)
Location 17:75110270-75110292
Sequence GTCCTCCGTCACCGCGGCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151601756_1151601775 15 Left 1151601756 17:75110232-75110254 CCCCTGCACCTTTCCCACCCTCC 0: 1
1: 0
2: 9
3: 197
4: 1205
Right 1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 73
1151601770_1151601775 -10 Left 1151601770 17:75110257-75110279 CCCGTCCCTGGGGGTCCTCCGTC 0: 1
1: 0
2: 1
3: 16
4: 162
Right 1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 73
1151601768_1151601775 -6 Left 1151601768 17:75110253-75110275 CCCGCCCGTCCCTGGGGGTCCTC 0: 1
1: 0
2: 4
3: 34
4: 275
Right 1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 73
1151601766_1151601775 -2 Left 1151601766 17:75110249-75110271 CCCTCCCGCCCGTCCCTGGGGGT 0: 1
1: 0
2: 2
3: 26
4: 217
Right 1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 73
1151601769_1151601775 -7 Left 1151601769 17:75110254-75110276 CCGCCCGTCCCTGGGGGTCCTCC 0: 1
1: 0
2: 3
3: 24
4: 276
Right 1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 73
1151601767_1151601775 -3 Left 1151601767 17:75110250-75110272 CCTCCCGCCCGTCCCTGGGGGTC 0: 1
1: 0
2: 1
3: 29
4: 271
Right 1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 73
1151601762_1151601775 1 Left 1151601762 17:75110246-75110268 CCACCCTCCCGCCCGTCCCTGGG 0: 1
1: 0
2: 3
3: 75
4: 751
Right 1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 73
1151601755_1151601775 16 Left 1151601755 17:75110231-75110253 CCCCCTGCACCTTTCCCACCCTC 0: 1
1: 0
2: 8
3: 93
4: 1010
Right 1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 73
1151601758_1151601775 13 Left 1151601758 17:75110234-75110256 CCTGCACCTTTCCCACCCTCCCG 0: 1
1: 0
2: 1
3: 46
4: 507
Right 1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 73
1151601757_1151601775 14 Left 1151601757 17:75110233-75110255 CCCTGCACCTTTCCCACCCTCCC 0: 1
1: 0
2: 9
3: 163
4: 1488
Right 1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 73
1151601759_1151601775 7 Left 1151601759 17:75110240-75110262 CCTTTCCCACCCTCCCGCCCGTC 0: 1
1: 0
2: 12
3: 155
4: 1355
Right 1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 73
1151601760_1151601775 2 Left 1151601760 17:75110245-75110267 CCCACCCTCCCGCCCGTCCCTGG 0: 1
1: 0
2: 4
3: 57
4: 551
Right 1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151601775 Original CRISPR GTCCTCCGTCACCGCGGCCA TGG Exonic
900203166 1:1420280-1420302 GTCCTCCGCCTCCGCTGCCGCGG + Exonic
901745905 1:11373288-11373310 TTCCTCCGTCAGTGTGGCCAGGG - Intergenic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
911837209 1:102635778-102635800 AGCCTCCATCACTGCGGCCATGG + Intergenic
1073481166 10:103786957-103786979 GACCTCAGTCCCAGCGGCCAAGG - Intronic
1074497917 10:113996193-113996215 GTCCTCCCTCACCTCCTCCAAGG + Intergenic
1075849203 10:125573768-125573790 CTCCTCCCTCACGGCAGCCATGG - Intergenic
1076583804 10:131532158-131532180 GTCCTCCGTGATCTGGGCCATGG + Intergenic
1077183927 11:1228199-1228221 GTCCTCCGTCCCCAGGCCCAGGG - Intronic
1077194913 11:1274657-1274679 GTCCTTAGTGACCGCTGCCACGG + Exonic
1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG + Exonic
1083667858 11:64285314-64285336 GTCCTCCCTCACCGGGTCCCCGG - Intronic
1096846593 12:54410630-54410652 ATTCTCCGTCACTGCAGCCAAGG - Intronic
1106695247 13:32165959-32165981 GTTCTCCATCACCGCAGACAGGG + Intronic
1108373352 13:49792295-49792317 GCCTCCCGTCACCGCGGCCCCGG - Intronic
1112580686 13:100674555-100674577 GTCCCCCGTGACCCCGGCCCGGG + Intronic
1114491424 14:23104627-23104649 GGCCTCTCTCACTGCGGCCAGGG + Intergenic
1119744677 14:77035553-77035575 TTCCTCCATCACCTCTGCCAAGG - Intergenic
1121638043 14:95466862-95466884 CTCCTCCTTCACCCCAGCCATGG - Intronic
1122577215 14:102750030-102750052 GGCCTCGGTCCCCGCGGCCTCGG + Intergenic
1122887327 14:104715917-104715939 GTCCTCCCACCCCGAGGCCATGG + Intronic
1132162588 15:99556754-99556776 GTACTCCATCACCCTGGCCATGG + Intergenic
1132893139 16:2214373-2214395 GGCCTCCAGCTCCGCGGCCAGGG + Exonic
1136555217 16:31003549-31003571 GTCCTCAGGCACCCGGGCCAGGG - Intronic
1138087954 16:54151076-54151098 GTCCTCTGTCCCCACGGCCCTGG + Intergenic
1140043723 16:71425997-71426019 GTCCTCCGTCTCCAGGGCGACGG - Intergenic
1140481765 16:75266027-75266049 CCCCACCGTCTCCGCGGCCAGGG + Intronic
1142114867 16:88351364-88351386 GGCCTCCATCACCCCAGCCATGG + Intergenic
1142753760 17:2003435-2003457 GTCCTCTATCACTGCAGCCATGG - Intronic
1142977788 17:3655995-3656017 GTCCTCCTTCCCCGTGGCCTGGG + Intronic
1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG + Exonic
1152814902 17:82401900-82401922 TTCCTCTGTCACAGCGGGCATGG + Intronic
1159955132 18:74513610-74513632 CTCTTCCGTGACGGCGGCCACGG - Exonic
1160256293 18:77250922-77250944 GTCCACGGACATCGCGGCCAGGG - Exonic
1160501826 18:79405325-79405347 GCCCTCCGACACGGCAGCCAGGG + Intronic
1160735622 19:661154-661176 GTCCTCCGTGTCCAAGGCCACGG + Intronic
1161234820 19:3192629-3192651 GTCCTGGGGCACGGCGGCCATGG - Exonic
1166850407 19:45757425-45757447 GCTCTCCGCCACCGCTGCCACGG + Intronic
1167071765 19:47226268-47226290 GCCCTCAGTCCCCGCGGCCGCGG + Intronic
932397079 2:71455654-71455676 GTCCTCCCTCCCCTCCGCCAAGG - Intronic
947372954 2:229467113-229467135 GTCCTGGGTCGCAGCGGCCAAGG + Intronic
948375889 2:237519996-237520018 GTCCTCAGTCCCTGAGGCCAGGG + Exonic
1176177195 20:63734328-63734350 GTCCTCCTTCACCAGGGACATGG - Intronic
1176221935 20:63973889-63973911 GTCCTCTGTCACGGCAGCCGCGG + Intronic
1178417035 21:32412575-32412597 TTCCTCCGGCACGGCGGCAACGG + Exonic
1179262686 21:39772396-39772418 GTCCTCCGTTACGGCAGCCATGG - Intronic
1180996028 22:19965771-19965793 GTCCTCCCTCTCCACGGCCAGGG - Intronic
1183677340 22:39306964-39306986 GTCTTCAGTAACAGCGGCCATGG + Intergenic
1184655853 22:45941773-45941795 GTGCTCCGTGACCCTGGCCAAGG + Intronic
951415200 3:22414778-22414800 GACCTCCCTCACCCCAGCCAAGG - Intergenic
961010215 3:123430462-123430484 GTCCTCCTTCTCCGAGGCCTCGG - Intronic
961061390 3:123831963-123831985 TTCCTCCCTCACCCCTGCCAGGG - Intronic
962876446 3:139539302-139539324 GTCCTCGGCCACCGCTCCCAGGG - Intronic
964509766 3:157437825-157437847 CTCCTCTAGCACCGCGGCCAGGG - Exonic
967914896 3:194571507-194571529 GACTTCGGTCACTGCGGCCAGGG + Intergenic
968619818 4:1599053-1599075 ACCCTTCGTCACCGAGGCCAGGG + Intergenic
979540080 4:121870665-121870687 CTCCACCCTCACCGCGGCCCAGG + Intergenic
979881168 4:125961945-125961967 GTGCTCAGTCACTGTGGCCATGG + Intergenic
985822649 5:2170485-2170507 GCCCTCCAGCACCGTGGCCAGGG - Intergenic
987234316 5:15927993-15928015 GTCCTCCATCACCGGGGAGACGG + Exonic
1007431525 6:41779914-41779936 GACCTCCGACCCCGCGGCCGCGG - Intronic
1008920904 6:56843583-56843605 GTCCTCCCGCACCGCTGCCGCGG - Intronic
1012412053 6:98969686-98969708 GTCCTCGGCCACCACTGCCATGG - Intergenic
1017826161 6:158083679-158083701 GTCCTCCGTCACTTCTGCAAGGG - Intronic
1018017898 6:159727904-159727926 GTCCTCCGTCCCCAAGGCCCGGG + Intronic
1019474993 7:1240224-1240246 GGCCGCCCTCACCGCGGCCTCGG - Intergenic
1029258904 7:99288007-99288029 ATGCTCCGTCAGCTCGGCCATGG - Intergenic
1029305898 7:99619941-99619963 GTCCTCCACCATGGCGGCCAGGG - Exonic
1034398979 7:150848891-150848913 GTCCTCTGTGACAGCAGCCATGG + Intronic
1034479502 7:151308589-151308611 GTCCTCCGCGACCCTGGCCAGGG - Intergenic
1035589549 8:802299-802321 GTCCTCTGTCATCACGGCCTGGG + Intergenic
1037902324 8:22695160-22695182 GTCCTCCGCCAGCGCGGCTCAGG + Intergenic
1039868854 8:41528951-41528973 GGCGCCCGCCACCGCGGCCAAGG - Intergenic
1043874018 8:85464392-85464414 GTCCTCGGGTCCCGCGGCCAGGG - Intronic
1062077784 9:134601281-134601303 GTCCTCTGTTCCCACGGCCATGG + Intergenic
1062439161 9:136561893-136561915 GTCCTCACTCACCCCGGCCACGG - Intergenic
1185472435 X:392214-392236 GCCATCCATCACCCCGGCCACGG - Intergenic