ID: 1151602032

View in Genome Browser
Species Human (GRCh38)
Location 17:75111897-75111919
Sequence CTGCTCTAAATGCTGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151602030_1151602032 -7 Left 1151602030 17:75111881-75111903 CCGTATATGCAAGCTACTGCTCT 0: 1
1: 0
2: 2
3: 6
4: 128
Right 1151602032 17:75111897-75111919 CTGCTCTAAATGCTGGAGTATGG 0: 1
1: 0
2: 1
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151602032 Original CRISPR CTGCTCTAAATGCTGGAGTA TGG Intronic
903937613 1:26907430-26907452 CTGTACTAGATGCTGGGGTAGGG - Intronic
904881104 1:33697774-33697796 CTATTCTCCATGCTGGAGTATGG + Intronic
908075769 1:60516273-60516295 ATGCCCCAAATGCTGAAGTACGG - Intergenic
910653561 1:89596838-89596860 CAGCTCTAAATACTGCAGGATGG - Exonic
910698566 1:90048197-90048219 CTGCTCTAATGACAGGAGTAAGG + Intergenic
910990144 1:93047489-93047511 CTCGTCTAAACCCTGGAGTATGG + Intergenic
913091346 1:115478775-115478797 CTGCTCAAAATCCTGGCCTAAGG + Intergenic
913273555 1:117117224-117117246 TTCATCTGAATGCTGGAGTAGGG - Intronic
914710937 1:150213229-150213251 CAGCTATAAATGGTGGAGTTAGG - Intergenic
916276749 1:163002249-163002271 ATGCTCTAAATTCTGGAGGATGG - Intergenic
917388779 1:174509097-174509119 CTAGTCTCAATGTTGGAGTAAGG + Intronic
917803119 1:178588196-178588218 CTGCACTCGATGCTGGAGTTCGG - Intergenic
918413535 1:184284864-184284886 CTGATCTAAAGCCTGGAATAGGG + Intergenic
922314472 1:224430749-224430771 TTTTTCTAAATGCTGGAGTTTGG - Intronic
923305398 1:232683566-232683588 CAGCTCTGAGTGATGGAGTAGGG - Intergenic
1063261197 10:4391484-4391506 CTGCTCTATATGGTGGAGTCTGG + Intergenic
1067790820 10:49286385-49286407 CTGAACCAAATGCTGGAGTCAGG + Intergenic
1070440644 10:76439765-76439787 CTGTGCTAAATGCAGGCGTATGG + Intronic
1072376447 10:94821350-94821372 CAGGTTCAAATGCTGGAGTAGGG + Intronic
1073191807 10:101656656-101656678 TTGTTCTAAAAGCTGGATTATGG + Intronic
1073680509 10:105698554-105698576 CTGTTCTGAATGCAGGAGTTGGG - Intergenic
1073978452 10:109126773-109126795 CTGCTCCAGCTGCTGGTGTAAGG - Intergenic
1075821908 10:125321779-125321801 CTGTCCTAAGTGCTGGGGTATGG - Intergenic
1076115107 10:127890033-127890055 CTGCACTCACTGCTGGAGCATGG - Intronic
1079807663 11:24954695-24954717 CTTCCCTGAATGCTGGAGCAGGG - Intronic
1084294905 11:68206560-68206582 CTGCTCACACTGCTGGGGTAAGG - Intronic
1084753383 11:71219078-71219100 CTTCTCTAAATGCTGGTATGTGG - Intronic
1086172614 11:83852906-83852928 CTGCTCTAAGGGCAGGAGTCTGG - Intronic
1086728013 11:90212877-90212899 CTTCTCAAAGTGCTGGATTATGG + Intronic
1087613357 11:100460590-100460612 CTGCTCTGAGTGCTGGAATGGGG - Intergenic
1087916941 11:103822053-103822075 CTGTTCTATATGCTGGAGGTAGG + Intergenic
1088596546 11:111445264-111445286 CTGCATTAACTGCTGGATTAGGG - Intronic
1089555403 11:119313352-119313374 CTGGTCTAAGTGGTGGTGTATGG - Intronic
1091560649 12:1610350-1610372 CTGCTTTCACTGCTGAAGTAGGG + Intronic
1091834246 12:3574173-3574195 CTGTGCTAAATGCTGTACTATGG + Intronic
1093394734 12:18667498-18667520 CTGCTCTATAAGCTAGAGTTTGG + Intergenic
1094159696 12:27377470-27377492 CTGCTGTACATCCTGGAGTCAGG + Intronic
1097273073 12:57790961-57790983 CTCCTCAAAGTGCTGGATTATGG + Intronic
1099012077 12:77303281-77303303 GTGTTCTAAATGCTGTAGGAAGG + Intergenic
1099389959 12:82068190-82068212 ATGCTGTAAATACAGGAGTATGG + Intergenic
1102955727 12:117057518-117057540 CTGCTCTAAATACTGACCTAGGG - Intronic
1103844786 12:123893725-123893747 CTGCTCTAAAGGCTGGCATGAGG - Intronic
1105741847 13:23333747-23333769 CTGCTCTAAATGTTGAAGTTTGG + Exonic
1106943013 13:34797567-34797589 CAGCTAGAAGTGCTGGAGTAGGG - Intergenic
1110832421 13:80046450-80046472 CTGGTCTAAGTGCTGGAGAAAGG - Intergenic
1112042170 13:95557603-95557625 CTGCTGTTCATGCTGGAGAAAGG + Intronic
1117520240 14:56544338-56544360 CCCCTCTAAATTCTGGAGTGAGG - Intronic
1122747319 14:103906235-103906257 CTCCTCTGGATGCTGGAGCAAGG + Intergenic
1125810018 15:42530875-42530897 ATGCTTTAAATGCTGCAGTCTGG + Intronic
1126250136 15:46557633-46557655 TGGCTGTAAATGCTGGAGTCAGG + Intergenic
1129194886 15:73957867-73957889 CTGCTCTAAATGCTCTACAAAGG + Intergenic
1130150720 15:81309499-81309521 CAGCTCTAACTGATGGAGTATGG - Exonic
1131294935 15:91139526-91139548 CCGCTATCAATGCTGTAGTAAGG + Intronic
1134744918 16:16580594-16580616 CGGCCCAAAATGGTGGAGTAGGG + Intergenic
1135000566 16:18773175-18773197 CGGCCCAAAATGGTGGAGTAGGG - Intergenic
1135754545 16:25086178-25086200 CTGCACGACATGCTGGAGTGAGG + Intergenic
1141684220 16:85561296-85561318 GTGCGCTAAATGGTGGAGCAGGG + Intergenic
1148763894 17:50026459-50026481 CTGCTCTAAATGGCAGAGTGTGG + Intergenic
1150650756 17:67008555-67008577 CTGCTCCAAATCCTGGGTTATGG + Intronic
1151602032 17:75111897-75111919 CTGCTCTAAATGCTGGAGTATGG + Intronic
1152842425 17:82578865-82578887 CTGCTCACATGGCTGGAGTATGG + Intronic
1154113946 18:11594396-11594418 CACCCCTAAATGCTGGAGGAAGG - Intergenic
1157096696 18:44691924-44691946 CAGCTCTAAATGGTGGAGGAGGG + Intronic
1161310569 19:3591777-3591799 CTGGTCTGAATCCTGGAGTTGGG - Exonic
1161678619 19:5667547-5667569 CTGCTCTCAGTGCTGGAATGAGG + Intronic
1161749884 19:6087923-6087945 CTGCTCTAGATGATGATGTAAGG - Intronic
1162578596 19:11513956-11513978 CTGCGCAAGATGCGGGAGTATGG - Exonic
926038522 2:9654386-9654408 CAGCTCTAAGTACTGGGGTACGG + Intergenic
926374049 2:12209296-12209318 CTGCCCTATATTCTGGAGGAAGG + Intergenic
926814718 2:16789043-16789065 CTACTCTAGAGGCTGGAGCAGGG - Intergenic
926884359 2:17583894-17583916 CTGCTCCAAATGATGGAGAGGGG - Intronic
930203453 2:48565713-48565735 GTGTTCTAAAGGCTAGAGTAGGG + Intronic
930640846 2:53853294-53853316 CTGTTATAGATGCTGTAGTAAGG + Exonic
935558091 2:104532502-104532524 CTGCTCTAAATCCTACTGTAAGG + Intergenic
935582904 2:104774264-104774286 CTGCCCTCAGTGCTGGTGTAGGG + Intergenic
943529402 2:189060195-189060217 ATGCTCTAAATGCTATAATAAGG - Intronic
945131230 2:206574934-206574956 CTGCTGTAAATGCTGGGACATGG + Intronic
1169161384 20:3381962-3381984 CTGTACTAGATGCTGGGGTATGG + Intronic
1172759507 20:37312071-37312093 CGGCTCTAAAAGCTGAGGTAGGG + Intronic
1173941510 20:46914926-46914948 CTGCCTTCAAAGCTGGAGTATGG + Intronic
1174534937 20:51244008-51244030 CTGCACTAAGTTCTGGGGTAAGG - Intergenic
1176053399 20:63132623-63132645 CTGCTGTACATCCTGGAGTTGGG - Intergenic
1181135927 22:20766321-20766343 CTGCTCCAAATGCTGGGGGGAGG + Intronic
1184761404 22:46546855-46546877 CTGCTGAAACTGCTGGAGTCAGG - Intergenic
950003772 3:9678067-9678089 CTGCCCTCAATGCTTGAGTCAGG - Intronic
950680229 3:14580144-14580166 CTGCTCTGGGTGCTGGGGTATGG - Intergenic
950854869 3:16095587-16095609 CTGCTCTAGTGGCTGGAGGAAGG + Intergenic
951152713 3:19311069-19311091 CTGCACTAAATGGTGAAGAATGG - Intronic
951156866 3:19365640-19365662 CTGTTCTAGATGCTGGAGATAGG + Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955820104 3:62887669-62887691 CTGCTGTAACTACTGGACTATGG + Intergenic
957148071 3:76449458-76449480 CTACCCTACATGCTGGGGTAGGG + Intronic
958696329 3:97532002-97532024 CTGTTCTCAATGCTGAAATATGG - Intronic
963597628 3:147347628-147347650 CTGTTGCAAAGGCTGGAGTACGG - Intergenic
967538137 3:190631376-190631398 CTGCTCTAAATGGTGTAATAAGG + Intronic
971068754 4:23066415-23066437 CTCCTCTATATGCTGGAGAAAGG - Intergenic
972964191 4:44488948-44488970 CTTCTCAAAATGCTGGAAGAGGG + Intergenic
974638736 4:64601084-64601106 ATGCTCTAAATGAGAGAGTAGGG - Intergenic
976565380 4:86546677-86546699 CTGGTCTTAATTTTGGAGTAGGG - Intronic
976752550 4:88464805-88464827 CTGCTGCAAAGGCTGGAGTGCGG + Intronic
977390569 4:96403599-96403621 TTTCTCTAAAGGCTTGAGTAGGG - Intergenic
977415749 4:96730701-96730723 ATGCTATCAATGCTGGAGAAGGG - Intergenic
977753276 4:100634837-100634859 CTTCTCTAGATGCTGGAGGAGGG + Intronic
981093791 4:140758381-140758403 CTGCTCTAAACCCAGGAGGAGGG + Intergenic
984151241 4:176134349-176134371 CTATTCTAAATGCTGGGGAATGG - Intronic
984281498 4:177675938-177675960 CTTCTCACAATGCTGAAGTAGGG - Intergenic
988658544 5:33238905-33238927 CCTCTGTAAATGCTGGAGAAAGG + Intergenic
988809294 5:34768544-34768566 CTGTTCTACATACTGGAGTCTGG + Intronic
989365519 5:40651482-40651504 CTGCTCTATACCCTGGAGGAAGG + Intergenic
995604253 5:113834279-113834301 CAGATCTAAATGCTGGAGCATGG + Intergenic
996618639 5:125472477-125472499 ATCCTTAAAATGCTGGAGTAAGG - Intergenic
1000787360 5:165561839-165561861 TTGCTCTAGAGGCTGAAGTAGGG + Intergenic
1002445246 5:179286590-179286612 CTGCTGTGAATGCTGGGGGACGG - Intronic
1003373786 6:5554874-5554896 CTGTGCTAGATGCTAGAGTAAGG + Intronic
1003540837 6:7016771-7016793 CTGCTCTGAGTGCTGAAATACGG + Intergenic
1006340099 6:33442193-33442215 CTGCTCTAAGTGCTGGATCATGG - Intronic
1007653281 6:43436350-43436372 CAGCTCTAATTGCTGCAGGAGGG + Intronic
1013387124 6:109642663-109642685 CTGCTGTATATGCTGGTGAATGG + Intronic
1014439308 6:121455482-121455504 CTGTTCTAAATGTTAGAGCAAGG - Intergenic
1014778881 6:125540789-125540811 ATGCCTTAACTGCTGGAGTACGG + Intergenic
1018451435 6:163911839-163911861 CTGCTCAAAATGCAGGGGTTGGG + Intergenic
1018955372 6:168406522-168406544 CTGCATTTAATGCTGGAGTTTGG - Intergenic
1024526223 7:50351729-50351751 TTCCCCTAAATGCTGGATTAAGG - Intronic
1026211336 7:68308270-68308292 CTTGCATAAATGCTGGAGTAGGG - Intergenic
1026468264 7:70672951-70672973 CTTCTATGAATGCTGTAGTAGGG - Intronic
1031361282 7:120851725-120851747 CTTCTCTCCATGGTGGAGTAAGG - Intronic
1033107888 7:138546538-138546560 CTTCCCTAAATACTGCAGTATGG - Intronic
1034678585 7:152910745-152910767 CTGCTCTAACTGCTGGGGGCGGG + Intergenic
1036601516 8:10265158-10265180 CTGGTCTAACTTCTGGAATATGG - Intronic
1037579108 8:20234288-20234310 CTGTTCTAAAAGCTGGGGTTTGG - Intergenic
1042113958 8:65411485-65411507 CTGTTCTAAACACTGGGGTATGG - Intergenic
1042460448 8:69059219-69059241 ATGCTCTTAATGTTGGAGGATGG - Intergenic
1043172662 8:76985109-76985131 CTGGTCTATATACTGGATTATGG - Intronic
1043450752 8:80363803-80363825 CTGCTCTACATGCTGGCCTTTGG + Intergenic
1045418071 8:101986625-101986647 CTGCCCTTGATGCTGGAGAATGG - Intronic
1046182000 8:110661920-110661942 ATTCTCCAAATGCTGGAGCAGGG - Intergenic
1048742697 8:137579790-137579812 CTTCTCAAAACGCTGGATTAAGG + Intergenic
1049770715 8:144379696-144379718 CTGCTCTAAATGCTGTGATCAGG - Intronic
1050999546 9:12264262-12264284 ATGCTCTGGCTGCTGGAGTAGGG + Intergenic
1051681688 9:19613923-19613945 GTCCTCTGAATGATGGAGTAGGG + Intronic
1055107516 9:72527973-72527995 TTGCCCTAAATTCTGGAGTCGGG - Intronic
1055274269 9:74596551-74596573 GTGTTCTAAATGCAGGATTAGGG - Intronic
1056658373 9:88527051-88527073 CTGCTGCCAATGCTGGAGCAGGG + Intergenic
1057266877 9:93623027-93623049 CTGCTCCAGATGCTGCAGTGAGG + Intronic
1057877283 9:98767695-98767717 CTGTTCTAAATGCTGAGGTGTGG + Intronic
1058963422 9:110013859-110013881 TTACTAGAAATGCTGGAGTATGG + Intronic
1061226463 9:129283627-129283649 CTGCACTAAACGCTGGACAATGG - Intergenic
1189840630 X:45072618-45072640 CTGCTCTAACTGCTGGAGCAGGG + Intronic
1191586058 X:62827886-62827908 CTCCTCTAAAAGAAGGAGTAAGG - Intergenic
1194433785 X:93844577-93844599 CTGCTCAATCTGCTGAAGTAGGG + Intergenic
1196636409 X:118007762-118007784 CTTCTCTCAATGGTGGATTAAGG + Intronic
1196917283 X:120550465-120550487 CTCCCCTAAATGCTGGGTTAGGG - Intronic
1198507158 X:137312323-137312345 CTTCTGGAAATGCTGGAGTGGGG + Intergenic
1198732560 X:139748095-139748117 CAGCTCTGAAGGCTGGAGGAGGG + Intronic
1199074726 X:143514374-143514396 ATTTTCTAAAAGCTGGAGTAGGG - Intronic
1199543543 X:148983914-148983936 CTGTTCTAGATACTGAAGTATGG + Intronic
1201502029 Y:14655412-14655434 ATCCTCCAAATGCTGAAGTATGG - Intronic