ID: 1151603871

View in Genome Browser
Species Human (GRCh38)
Location 17:75124250-75124272
Sequence GTTCCCTGCCACTGCGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151603866_1151603871 2 Left 1151603866 17:75124225-75124247 CCCGCTAGGCAGAGGAGCTTCAG 0: 1
1: 0
2: 0
3: 16
4: 180
Right 1151603871 17:75124250-75124272 GTTCCCTGCCACTGCGGAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 144
1151603867_1151603871 1 Left 1151603867 17:75124226-75124248 CCGCTAGGCAGAGGAGCTTCAGG 0: 1
1: 0
2: 2
3: 11
4: 156
Right 1151603871 17:75124250-75124272 GTTCCCTGCCACTGCGGAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 144
1151603862_1151603871 30 Left 1151603862 17:75124197-75124219 CCGCCTTCTTCATCTCTAAGGGA 0: 1
1: 0
2: 0
3: 22
4: 269
Right 1151603871 17:75124250-75124272 GTTCCCTGCCACTGCGGAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 144
1151603863_1151603871 27 Left 1151603863 17:75124200-75124222 CCTTCTTCATCTCTAAGGGACAC 0: 1
1: 0
2: 0
3: 8
4: 166
Right 1151603871 17:75124250-75124272 GTTCCCTGCCACTGCGGAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151603871 Original CRISPR GTTCCCTGCCACTGCGGAGA GGG Intronic
900658242 1:3770698-3770720 GTTCCCTTCCTCTGCAGAGTGGG + Intronic
901809072 1:11755959-11755981 GTTCCCTGGTACTGATGAGAGGG - Intergenic
902809084 1:18878083-18878105 GCTCCCTCCCACTGGGGAAATGG - Intronic
902953633 1:19908493-19908515 GTTTCCTGACAGTGGGGAGATGG + Exonic
904808286 1:33146871-33146893 GTCCCCTGCCCCTGAGAAGATGG + Exonic
906157721 1:43623740-43623762 ATTCCCTGCTCCTGAGGAGACGG + Intergenic
906546628 1:46624060-46624082 GTTGCCTGCCTCTGGGAAGAGGG + Intergenic
906705224 1:47889769-47889791 GTACCCTGCCACTGCCCAGCTGG + Intronic
917179377 1:172278589-172278611 TTGCCATGCCACTGGGGAGAAGG + Intronic
917488671 1:175478700-175478722 GTTTCCTGCCACTGAGGAAAAGG + Intronic
917892983 1:179457134-179457156 CTCACATGCCACTGCGGAGAAGG - Intronic
920029351 1:203027157-203027179 CCGCCCTGGCACTGCGGAGATGG - Intronic
921877938 1:220220275-220220297 CTTCCCTGCCACTGTGAAGTGGG + Intronic
1063172521 10:3522304-3522326 TTTCCCTGCCACTCTGGAGTGGG - Intergenic
1064981970 10:21174205-21174227 GTTCCCTGCCACTTCGGTCCGGG - Intergenic
1067717555 10:48701089-48701111 GTTCCCAGAGACTGGGGAGAGGG - Intronic
1072693208 10:97584838-97584860 CTTCACTGCCACTGCAGAGGTGG + Exonic
1074341266 10:112632564-112632586 GTTGCCAGCCACTGCGGGCAGGG + Intronic
1075351803 10:121730932-121730954 TTTCCCTGCCACAGGGGAGAGGG - Intergenic
1076167641 10:128295102-128295124 GTTAACTGCCACTGAGGAAATGG - Intergenic
1076363448 10:129906458-129906480 GCCCCCTGCCAGTGCAGAGAGGG - Intronic
1079948910 11:26777510-26777532 GTTTCCTGGCACTGCTGACAAGG - Intergenic
1081199710 11:40201523-40201545 GTTCACTTCCACTGCTGAGGGGG - Intronic
1081642070 11:44762957-44762979 CATCCCTCCCACTGTGGAGATGG + Intronic
1084066490 11:66707377-66707399 GTTCCCTGCAACTGGGGACAGGG + Intronic
1086968268 11:93052831-93052853 GGTCACTGCCACTTCGGCGATGG + Intergenic
1090958866 11:131538100-131538122 GTTTGCTACCACTGGGGAGAAGG + Intronic
1091086711 11:132727989-132728011 GTTCCCTTCCACGGCTAAGAGGG + Intronic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1103912890 12:124362012-124362034 TTTCCCTGCCACTGTGGCCATGG + Intronic
1103926636 12:124427051-124427073 CTCCCCTCCCACTGCAGAGAAGG - Intronic
1104190594 12:126479105-126479127 CTACTCTGCCACTGCGGAAAGGG - Intergenic
1106264857 13:28100664-28100686 GGTCCCTGCCTCTGGGGAGAGGG - Intergenic
1106304163 13:28495268-28495290 CTTCCCTGCGGCTACGGAGAGGG + Intergenic
1111347983 13:86987944-86987966 ATTCTCTGCCACTGTGGAGGTGG + Intergenic
1111512818 13:89287912-89287934 GATCCCTGCCACTTCTGAGTAGG - Intergenic
1113094677 13:106651044-106651066 GTTCCCTGCCTATGGGGAGCGGG - Intergenic
1113220403 13:108094981-108095003 GTTCAGTGGTACTGCGGAGATGG - Intergenic
1119425841 14:74534219-74534241 GTTCCCTGTCACTTCTTAGAGGG + Intronic
1119746012 14:77044437-77044459 GTTCCCTGCCCTTCCGAAGATGG - Intergenic
1122165395 14:99819607-99819629 GTTCCTTGGCCCTGCGGTGACGG + Intronic
1122491068 14:102116623-102116645 GCCTACTGCCACTGCGGAGAGGG + Intronic
1124023282 15:25943079-25943101 CTTCCCTGACACTGCCGTGAGGG + Intergenic
1132673254 16:1110768-1110790 GTTCCCAGCATCTGGGGAGATGG - Intergenic
1132715489 16:1288139-1288161 GCTTCCTGCCGCTGCCGAGACGG - Intergenic
1137854773 16:51783411-51783433 GTTCCTGGCCACTGTGGACATGG + Intergenic
1137868753 16:51929312-51929334 GTGCCCAGCCACTGCTGAGTTGG - Intergenic
1137922081 16:52500044-52500066 GCTCCCTGTCTCTGCAGAGATGG - Intronic
1140764263 16:78141250-78141272 GTCCATTTCCACTGCGGAGATGG + Intronic
1142145506 16:88491318-88491340 GGTCCCTGCCACTGCGTGGGTGG - Intronic
1142555336 17:772068-772090 ATTCCCAGCCACTTCAGAGATGG + Intronic
1143955092 17:10661877-10661899 ATTCCCTGGCACTGAGGTGAAGG + Intergenic
1143966736 17:10760949-10760971 GTTCCCTGGCACAGGGGACATGG + Intergenic
1144891950 17:18499416-18499438 GTTCCCGGCCACTGGAGACAAGG + Intergenic
1145140272 17:20444901-20444923 GTTCCCGGCCACTGGAGACAAGG - Intergenic
1146202495 17:30871992-30872014 GTTCCCTGCCACCTCGAAGTGGG + Intronic
1150908236 17:69361525-69361547 GTTCCATGCCACAGTGGGGAAGG - Intergenic
1151500564 17:74485706-74485728 GTTCACTCCCATTGAGGAGAAGG - Intergenic
1151603871 17:75124250-75124272 GTTCCCTGCCACTGCGGAGAGGG + Intronic
1152094178 17:78263553-78263575 GTCCCCTGCCTCTGTGGAGCTGG - Intergenic
1152301487 17:79497592-79497614 GTTCTCTGGCAGTGAGGAGAGGG + Intronic
1152626901 17:81391945-81391967 CTTGCCTTCCACTGGGGAGAGGG - Intergenic
1157593535 18:48850442-48850464 AATCCCTGCCAGTACGGAGAGGG - Intronic
1164825758 19:31283888-31283910 GTTCCCAGTCACTGTGCAGATGG + Intronic
1166712435 19:44945860-44945882 GTTCCCTGTCACTTGAGAGAAGG + Intronic
1167853470 19:52219774-52219796 GCTCCCTGCCATTGTGGAGCTGG + Exonic
1168579267 19:57540196-57540218 GTTTATTGCCACTGCTGAGAAGG + Exonic
928333220 2:30373713-30373735 GTTCTCTGCCACTCCTGAGCTGG + Intergenic
931276225 2:60746130-60746152 GTCCCCTGCAAGTGTGGAGAAGG - Intergenic
932773895 2:74515772-74515794 GTACCTGGCCTCTGCGGAGAGGG + Exonic
937178096 2:119962676-119962698 GTTACCTGCCACTCTGAAGAAGG + Exonic
937232457 2:120406032-120406054 CTTCCCTGCCCCTGCGTGGATGG + Intergenic
937326704 2:120993734-120993756 GTTACCTGACACAGAGGAGATGG - Intergenic
937428339 2:121817917-121817939 GCTCCATGCCAGTGCAGAGAAGG - Intergenic
937686856 2:124707223-124707245 ATTCACTGACACTGAGGAGAGGG + Intronic
939710402 2:145509891-145509913 GTTCCTGGGCACTGGGGAGAGGG - Intergenic
946322079 2:218960129-218960151 GATCCCGGCCCTTGCGGAGAAGG - Exonic
947960890 2:234236301-234236323 GTCCCATGCCAGTGTGGAGAGGG - Intergenic
948900719 2:240955697-240955719 CATCCCTGCCACTGGGGAGGAGG - Intronic
1171033004 20:21693540-21693562 ATGCCCTGCCACTCCGGAAAGGG + Intergenic
1173595188 20:44254449-44254471 GCTCCCTCCCACTGCCGAGGAGG + Intronic
1176428138 21:6561148-6561170 TTCCCCTGGCACTGGGGAGAGGG + Intergenic
1179674385 21:42972128-42972150 GGCCCCTGCCCCTGCTGAGAAGG + Intergenic
1179703629 21:43169465-43169487 TTCCCCTGGCACTGGGGAGAGGG + Intronic
1180178110 21:46099838-46099860 GTTCCCCGCCACTTCTGGGATGG - Intronic
1182676643 22:32044023-32044045 GTGACCTGGCACTGGGGAGAGGG + Intronic
1183412945 22:37666033-37666055 GTGCCCAGCCACTGCTGGGAGGG - Exonic
1184854246 22:47137795-47137817 GGTCCCTGCCAGTGGGGAGTCGG + Intronic
1184932659 22:47692757-47692779 GTTCCCACCCACTGCCCAGAAGG - Intergenic
952927308 3:38329449-38329471 GGTCCCTGGCTCTGTGGAGAGGG + Intergenic
955327626 3:58021369-58021391 CCTCCCTGCCTCTGCTGAGAGGG - Intronic
958841865 3:99215635-99215657 CTTCACTGCCACAGCTGAGAAGG - Intergenic
967220676 3:187245573-187245595 TTTCCCTGCCACTGTGGACTTGG - Intronic
968434924 4:579488-579510 GAGCCCTGCCACTGGGGAGCTGG + Intergenic
968437326 4:600547-600569 GCTCCGTGCCACTGCTGAGTGGG + Intergenic
969967716 4:11014206-11014228 GTGTCCTGCCACTGTGGAGCTGG - Intergenic
971538942 4:27791109-27791131 GTTTCCTGACTCTGCTGAGACGG + Intergenic
971825833 4:31621583-31621605 GCTCCCTGCCACTGTTGATAGGG + Intergenic
973807090 4:54536856-54536878 GTTCCCTGCCACAGTAAAGAAGG - Intergenic
973978814 4:56289100-56289122 GTTACCAGGGACTGCGGAGAGGG + Intronic
975844832 4:78514124-78514146 GCTCCCTGCCATGGCCGAGATGG - Intronic
976095872 4:81507660-81507682 GTTCCCTCCCACTCCTGGGAGGG + Intronic
978334609 4:107652231-107652253 ATTCCCACCCACTGCAGAGATGG - Intronic
980874764 4:138650450-138650472 GTGCTCTGCCACTGTGGGGATGG - Intergenic
983816137 4:172128850-172128872 TTTCCCTGCCACATAGGAGAGGG - Intronic
986232583 5:5880242-5880264 GTTACATGCCACTGCGGAAGGGG + Intergenic
992888790 5:81185189-81185211 GTTCCCTACCACTATGGGGAAGG + Intronic
995720905 5:115131858-115131880 GTTACCAGCCTCTGGGGAGAGGG + Intronic
997589066 5:135061897-135061919 CTTCCATGGCACTGCGGGGAAGG - Intronic
998629314 5:143880814-143880836 GTTGCCTTCCACTGAGGACAGGG + Intergenic
999583040 5:153060860-153060882 ATTCCCTGGCACTTCAGAGATGG - Intergenic
1000976345 5:167768864-167768886 GTTCCCTGTAACTTGGGAGACGG + Intronic
1001104472 5:168841394-168841416 CTTCCATGCCACTACGGAGGAGG - Intronic
1002440436 5:179261810-179261832 CTTGCCTGCCACTGTGGGGAGGG - Intronic
1002922772 6:1585019-1585041 GTTCCTTGCCACCGAAGAGAGGG - Intergenic
1006979840 6:38138440-38138462 GTTCCCTCCAACTGCTGGGAGGG + Intronic
1007683483 6:43650402-43650424 GCCCCCTGCCACAGAGGAGATGG + Exonic
1015418327 6:132976278-132976300 TTTCCTTGCCATTGCTGAGAAGG + Intergenic
1018994979 6:168703726-168703748 GTTTCCTGCCAGTGCAGGGAAGG - Intergenic
1019104622 6:169658095-169658117 GTTCCCCACCACAGCGGACATGG + Intronic
1019314328 7:377479-377501 GTAACCAGCCTCTGCGGAGAGGG + Intergenic
1019868013 7:3731141-3731163 TCACCCTGCCACTGCGGTGATGG - Intronic
1020038106 7:4977895-4977917 CTTCCCTGCCAAGGCTGAGAAGG + Intergenic
1020157428 7:5737691-5737713 CTTCCCTGCCAAGGCTGAGAAGG - Intronic
1021816922 7:24456130-24456152 GTTCCCTGTCACCGCGTGGAGGG - Intergenic
1022509182 7:30924216-30924238 GGTCCCTGCCACTTTGCAGAAGG - Exonic
1024002081 7:45196706-45196728 GTTCCCTTCCTCTGAGGAGTTGG + Intergenic
1027907481 7:84204417-84204439 ATTCCCTGACACTGTGGAGTCGG + Intronic
1029327305 7:99821294-99821316 GGTCCCTGCCCCTTCAGAGATGG + Intergenic
1031757853 7:125668496-125668518 ATTCCCTGCCTCTGCTGAGATGG - Intergenic
1033456081 7:141505211-141505233 GTGCCCTGCCACTGATGAAATGG - Intergenic
1034677238 7:152900705-152900727 TCTCCCTGCCACTGCTCAGAAGG + Intergenic
1035663109 8:1362160-1362182 CTCCCCTGCCAGTGCCGAGACGG - Intergenic
1037373580 8:18205585-18205607 GTGCCCTGCCACTGCTGTGGCGG - Intronic
1053002699 9:34586030-34586052 GGTCCCTCCCAATGCTGAGATGG - Intronic
1053036708 9:34832576-34832598 GTTCTCTGCCACTGTGAAGGTGG - Intergenic
1056263069 9:84868230-84868252 ATTCCCTGCCACTAAGGAGTGGG + Intronic
1060260666 9:122071152-122071174 GTTCCCTTCCCCTTAGGAGAGGG + Intronic
1061215317 9:129218389-129218411 ATGCCATGCCACTGCGGTGACGG + Intergenic
1061537742 9:131260022-131260044 TATCCCTGCACCTGCGGAGAGGG - Exonic
1061885944 9:133591193-133591215 GGTGCCTGCCACTGCGGAAGAGG - Intergenic
1061993404 9:134172349-134172371 GTTCCCTGCTTCTGCAGAGAGGG + Intergenic
1062137804 9:134938891-134938913 CTTCCCTGCCACTGCAGACGAGG - Intergenic
1062260132 9:135657930-135657952 ATTCCCTGCCACCGAGGAGCTGG + Intergenic
1062331226 9:136045804-136045826 GGTCCCTGCAACAGCCGAGACGG - Intronic
1062360463 9:136185718-136185740 GTGGCCGGCCACTGCGAAGAAGG - Intergenic
1190440234 X:50469542-50469564 CCTCCCTGCCACTGGGGAGGGGG - Intronic
1192197430 X:69037969-69037991 GTCCCCTGCCACTGCTGGGTGGG - Intergenic
1195577652 X:106468617-106468639 GATCACTGCCGCTGAGGAGAGGG + Intergenic
1197480432 X:126977864-126977886 GTTCCTTGCCATTGCTGAAAGGG + Intergenic
1198306974 X:135393186-135393208 CTTCCCTGCCACTCAGGAAAGGG + Intergenic