ID: 1151605294

View in Genome Browser
Species Human (GRCh38)
Location 17:75131650-75131672
Sequence CGGCGTCCTGGCCGACTTCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 37}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151605294_1151605301 22 Left 1151605294 17:75131650-75131672 CCTCGAAGTCGGCCAGGACGCCG 0: 1
1: 0
2: 1
3: 2
4: 37
Right 1151605301 17:75131695-75131717 CGCTCCGCGCCATCGCCGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 109
1151605294_1151605300 21 Left 1151605294 17:75131650-75131672 CCTCGAAGTCGGCCAGGACGCCG 0: 1
1: 0
2: 1
3: 2
4: 37
Right 1151605300 17:75131694-75131716 ACGCTCCGCGCCATCGCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1151605294_1151605303 26 Left 1151605294 17:75131650-75131672 CCTCGAAGTCGGCCAGGACGCCG 0: 1
1: 0
2: 1
3: 2
4: 37
Right 1151605303 17:75131699-75131721 CCGCGCCATCGCCGCCGGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151605294 Original CRISPR CGGCGTCCTGGCCGACTTCG AGG (reversed) Exonic
900109435 1:999337-999359 CCGCTTCCTGGCCGGCTGCGAGG - Exonic
902437900 1:16409837-16409859 CAGGGTCCTGGGCGACTTCTGGG + Exonic
920577218 1:207070375-207070397 CTGCCTCCTGGCCTACTTCTTGG + Exonic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
1083170562 11:60921931-60921953 CATCTTCCTGGCCGGCTTCGTGG + Exonic
1087046845 11:93850153-93850175 CGGCGCCCCGGCCCACTTCGGGG - Intronic
1089814736 11:121162291-121162313 CGGCTCCCTGGCCGCCTACGGGG + Exonic
1093077739 12:14774788-14774810 CGGCGTCCTGCCCAACATCCAGG + Exonic
1093461694 12:19412905-19412927 CGGCCTCATGGCCGGCTCCGAGG + Intronic
1096459429 12:51814209-51814231 CGGCCTCCTCACCGGCTTCGTGG - Intergenic
1096583132 12:52601227-52601249 CGGCCGCCTGGGCGGCTTCGTGG - Exonic
1104897089 12:132169640-132169662 AGACGTCCTGGCCGACATCCGGG - Intergenic
1118318856 14:64741847-64741869 TGGGCTCCCGGCCGACTTCGTGG + Exonic
1130307862 15:82726866-82726888 CCGGGACCTGGCCGACTACGTGG - Intergenic
1133188425 16:4116271-4116293 GGGCGTCCCGGCCGGCGTCGCGG - Intergenic
1134629630 16:15747643-15747665 TGGCGTCCTGGCCCACCTAGAGG - Exonic
1144682385 17:17204567-17204589 CAGCATCCTCGCTGACTTCGAGG - Intronic
1144695905 17:17303679-17303701 CGGCGTGCTGGCTGACTTCGAGG + Exonic
1145272641 17:21412956-21412978 CGGGGTCCTGGGCGCCTTGGGGG - Intronic
1145310850 17:21700419-21700441 CGGGGTCCTGGGCGCCTTGGGGG - Intronic
1151605294 17:75131650-75131672 CGGCGTCCTGGCCGACTTCGAGG - Exonic
1152567626 17:81107228-81107250 CGGCGTCCAGGCCCACCTCTAGG - Intronic
1160454801 18:78992831-78992853 CGCCGCCCCGGCCGCCTTCGAGG + Exonic
1160807856 19:1000518-1000540 CGGCGTCCTGGCGCGCCTCGGGG + Exonic
1161232075 19:3179431-3179453 CGGCGTCCTGGCCACCATCATGG + Exonic
1161514167 19:4687490-4687512 CAGGGTCCTGGCCAACTTCCAGG + Intronic
1165459599 19:35936677-35936699 CGGCGTCCCGGCTGGCTTCCTGG - Intronic
1175871019 20:62209534-62209556 GGCCGTCCTGGCCGCCTTCGAGG - Intergenic
1184161041 22:42697543-42697565 CGGGGTCCGGGCCCACTTGGAGG + Intronic
1185321338 22:50201462-50201484 CGGCGAACTGGCCGAATTGGTGG - Exonic
954678959 3:52331191-52331213 CGGCGTCCTGGACTACGACGAGG + Exonic
966974618 3:185073140-185073162 CGGAGTCCTGTCCGACTGCTTGG - Intergenic
992385504 5:76280647-76280669 CGGCCTCGTGGCCGGCTCCGAGG + Intronic
992769664 5:80035392-80035414 CGGCGTCCGGGCTGCCGTCGGGG - Exonic
1019500112 7:1360499-1360521 CTGGGTCCTGGATGACTTCGTGG - Intergenic
1026941405 7:74289803-74289825 CGGCGGCCTGGCCGAAAGCGGGG + Intronic
1029139683 7:98401036-98401058 CGCCGCCCTGGCCTTCTTCGAGG + Exonic
1038533774 8:28339320-28339342 CAACTTCCTGGCCGACTTCCGGG - Exonic
1040564908 8:48556410-48556432 CGGCGCCCGGGCCGCCTCCGCGG + Intergenic
1062582422 9:137234444-137234466 CGGCTACCTGGCCGTCCTCGCGG + Exonic
1200239987 X:154488376-154488398 CGCCGACCTGGCCCACTTCTCGG - Exonic