ID: 1151606067

View in Genome Browser
Species Human (GRCh38)
Location 17:75136869-75136891
Sequence CAGTGGGACCTCTGGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151606067 Original CRISPR CAGTGGGACCTCTGGGAATA GGG (reversed) Intronic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
901076104 1:6555593-6555615 TAGTGGGACCCCTGGCTATAGGG + Intronic
902607395 1:17576230-17576252 TAGTGGGGCCTCTGGGCAGATGG + Intronic
903979640 1:27176573-27176595 TAGTGAGACCCCTGGGAGTAGGG + Intergenic
904236411 1:29120449-29120471 GTGTGGGGCCTCTGGGAAGATGG - Exonic
906658825 1:47568108-47568130 CAGTGGGAACTCTTGTAATACGG - Intergenic
907730633 1:57062162-57062184 CGGTGGGACTCCTGGGAATCTGG - Intronic
908173556 1:61531351-61531373 CAGTGAGACCTCTGGGACAGTGG + Intergenic
912385817 1:109270715-109270737 CAGAGGGACACCTGTGAATAAGG - Intronic
912601618 1:110940451-110940473 CAGTGGGATTTCTGGATATATGG - Intergenic
913137878 1:115910385-115910407 CAGCAGGGCCTCTGGGAATATGG - Intergenic
915040610 1:152965381-152965403 CACTGGGAAATCTGGGAGTAGGG + Intergenic
917603540 1:176602223-176602245 CAGTGAAACCTCAGGGAATGAGG - Intronic
918027293 1:180763816-180763838 AAGTGGGTCCTCTAGGGATAAGG - Intronic
919361705 1:196604600-196604622 GAGTAGGACATATGGGAATAGGG - Intronic
921286932 1:213617271-213617293 CAGTGGGACCTGGCAGAATATGG - Intergenic
922149581 1:222986794-222986816 CAGTAGGGCCTCCGGGAAAAGGG + Intronic
923720149 1:236459931-236459953 AAGTGAGACCTCAGGGAATGAGG - Intronic
924291690 1:242543095-242543117 CAGAGGGGCCTCTGGGAACCAGG - Intergenic
1062854088 10:770587-770609 CAGAGGCACCTCTGGGAAGTGGG + Intergenic
1063835203 10:10004316-10004338 CAGCAGAACCTCTGGGAAGAGGG - Intergenic
1065582341 10:27184277-27184299 CAGGAGGACCTCTGTGAAGAGGG + Intronic
1068344396 10:55754705-55754727 CACTGGGGCCTCTGGGAAGCTGG + Intergenic
1068906172 10:62325525-62325547 CACTGGGGCCTATGGGAGTATGG + Intergenic
1069770271 10:70893998-70894020 CTGTGGGGCCACTGGGGATATGG + Intergenic
1070757466 10:79002349-79002371 CAGAGGGACCTGTGGGCACAGGG - Intergenic
1071201500 10:83223911-83223933 CAGTTGGACGTCAGGGAATATGG - Intergenic
1074661526 10:115663982-115664004 AAGTGGGAGCTGTGGGAAAATGG - Intronic
1078420147 11:11204784-11204806 AAGTGGGACATCTGTGAGTAGGG - Intergenic
1079118234 11:17654215-17654237 CAGTGGGACAACTGAGAAAAAGG - Intergenic
1079638069 11:22770132-22770154 CACTGGGGCCTGTGGGAGTAGGG + Intronic
1080609197 11:33889159-33889181 CAGTGGGACCTCAGAGGCTAGGG + Intronic
1080770950 11:35340875-35340897 CAGTGTGCCCCCTGGGATTATGG + Intronic
1083248510 11:61449290-61449312 CAGTGAACCCTCTGGGAATGAGG + Intronic
1084424151 11:69075432-69075454 CAGTGGGAGTTTGGGGAATAAGG + Intronic
1085969624 11:81571599-81571621 TTGTGGGAACTCTGGAAATACGG + Intergenic
1090638856 11:128713143-128713165 GAGTTGGACCTCTAGGAACATGG - Intronic
1092480372 12:8854076-8854098 CACTGGTACCTCTGGCAATAGGG + Intronic
1094488862 12:30946197-30946219 CAGGGGGATTTCTTGGAATATGG - Intronic
1097951169 12:65429614-65429636 CAGTGGGCCCAGTGGGAACATGG - Intronic
1101264814 12:103073161-103073183 CAGTGGGACCTATTGGAGGATGG + Intergenic
1101850741 12:108400021-108400043 CAGCGGGAATTCTGGGCATATGG + Intergenic
1102077263 12:110069527-110069549 CAGTGGACCCACTGGGAAGAAGG - Intronic
1103970617 12:124668690-124668712 GAATGTGACCTCTGGAAATAGGG + Intergenic
1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG + Intergenic
1108730254 13:53227906-53227928 CAGGAAGACCTCAGGGAATAGGG - Intergenic
1111108211 13:83673602-83673624 CAGTAGGACTTATGGCAATAGGG - Intergenic
1112057178 13:95700469-95700491 CTGTTGGACCTCTTGGTATAAGG - Intronic
1113005589 13:105698446-105698468 CAGTGTGCTCTGTGGGAATATGG - Intergenic
1113420175 13:110164982-110165004 CCGGGAGACCTGTGGGAATAGGG + Exonic
1114526968 14:23372475-23372497 CAGAGGGACACCTGGGAAGAGGG + Intergenic
1116360642 14:43992168-43992190 CACTGGGACCTATGGGAAGGTGG + Intergenic
1120781560 14:88490408-88490430 CAGTGGGACCTCTGGGTATGGGG - Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1129831434 15:78673638-78673660 CGGTGTGACTTCTGGGAAGAAGG - Intronic
1130241639 15:82198767-82198789 CAGTGGGACCTCTGGCAAGTTGG - Intronic
1130458799 15:84142388-84142410 CAGTGGGAGCTCTGGCAAGTTGG + Intergenic
1130520938 15:84660148-84660170 CAGTGGGACTTCTGGGAAAGTGG - Intergenic
1131137433 15:89948930-89948952 AAGTGGGTCCTCTGGGGATAAGG + Intergenic
1132905293 16:2279301-2279323 CAGTGGAAGCTCTTGGAACAGGG + Intronic
1133388043 16:5386606-5386628 CAGTGGGACCTCCAGGACAAGGG - Intergenic
1133667163 16:7979752-7979774 CAGTGGCAGCCCTGGGAATCCGG + Intergenic
1134636887 16:15799422-15799444 CAGTGGGAACACTAGGAATCAGG - Intronic
1144147927 17:12416151-12416173 CAGTGGGTCATCTGTGAACAAGG - Intergenic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1149526374 17:57359150-57359172 CAGTGGGACCTAGGGGATTTGGG - Intronic
1150899785 17:69259547-69259569 GACTGGGAGCTATGGGAATAGGG + Intronic
1151254902 17:72869098-72869120 CAGAGGTTCTTCTGGGAATAAGG + Intronic
1151606067 17:75136869-75136891 CAGTGGGACCTCTGGGAATAGGG - Intronic
1152096371 17:78274245-78274267 CAGTGGGATGTCAGGGGATATGG - Intergenic
1155409050 18:25522019-25522041 CAAGGAGACCTCTGAGAATAAGG - Intergenic
1155465392 18:26129130-26129152 AAGTGGGTCCTCTAGGAATAAGG - Intergenic
1156016090 18:32548799-32548821 CCAGGGGACCTCTGGGAACAGGG + Intergenic
1156391275 18:36652708-36652730 CAGTGGGTCCTCTGGGTCTGAGG + Exonic
1158898008 18:61933714-61933736 CAATGGGAGCACAGGGAATAGGG + Intergenic
1162446400 19:10725536-10725558 CAGAGGGATCTGTGGGAATATGG + Intronic
1163765774 19:19162573-19162595 CAGAGGGACCTATGGAAAAAAGG - Intronic
1163879072 19:19901741-19901763 CGGTGGGACCTCAGCCAATATGG + Intronic
1164717575 19:30404799-30404821 CTGTGGGATCTCTGGGTAGATGG - Intronic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1166333468 19:42091677-42091699 CAGTGGGACCGATGGGGAGATGG - Intronic
1166813486 19:45527913-45527935 CAGGGGGACCTCTGGGCTGAGGG + Exonic
1167951572 19:53031864-53031886 TAGTGGGGCCTCTGGGATTTTGG + Intergenic
1168708192 19:58481493-58481515 AAGGGGGACCTCTGAGAAGAGGG + Intronic
925983860 2:9199118-9199140 CAGTGGGAGCTCTGGGAGCAAGG - Intergenic
929444791 2:41993145-41993167 CAGTGGGCCCTCTAGGAGCATGG + Intergenic
929618064 2:43327893-43327915 CAGTGGGATCTCTGGGAGAAGGG - Intronic
932715962 2:74100938-74100960 CAGTTGGAGCTCTGGGCAAAGGG - Exonic
940890919 2:159034472-159034494 AAACGGGATCTCTGGGAATAGGG - Intronic
941974837 2:171392084-171392106 CAGTGGCCCCTCTGGGATCAAGG - Exonic
942226786 2:173823529-173823551 GAGTGTGACCTCTGTAAATAGGG - Intergenic
943799170 2:192036244-192036266 CATTGGTACTTCTGGAAATATGG - Intronic
945677581 2:212874419-212874441 AAGTGGGTCCTCTGGGGATAAGG - Intergenic
947730986 2:232431552-232431574 CACTGGGACACCTGGGAACAGGG + Intergenic
948805106 2:240450578-240450600 CAGCTAGACCTCTGGGAACAAGG + Intronic
1168809901 20:698366-698388 GAGTTGCACCTCTGGGACTAGGG + Intergenic
1169049377 20:2563037-2563059 CAGAGGGACCTTGGGGAAAACGG - Intronic
1170520569 20:17180401-17180423 AAGTGGGACCCCTGGGCTTAAGG - Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1172530251 20:35626187-35626209 CAGAGGGACCTCTGGGACACAGG + Exonic
1172950952 20:38723344-38723366 CAGTGTGGCCTCTGAGAATGAGG - Intergenic
1174403349 20:50288225-50288247 TAGTGAGACCACTGGGAAAAGGG + Intergenic
1174867674 20:54152720-54152742 CAGTGGGACCTCAGTTGATAGGG + Intergenic
1175377625 20:58540162-58540184 GAGTGGGATCACTGGGAATTGGG - Intergenic
1178670940 21:34591276-34591298 CAGTGTGCCCTCTGGACATAAGG + Intronic
1179885807 21:44313833-44313855 GAGTCGGACCTCTGGGTACAGGG + Intronic
1181379258 22:22486957-22486979 CAGAGGCACTTCTGGGAATTCGG + Exonic
1182060546 22:27394078-27394100 CATTGTGACCTCAGGCAATATGG - Intergenic
1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG + Intergenic
1183364868 22:37401564-37401586 CAGTGGGCCCTCAGGAAACACGG + Intronic
951745676 3:25974656-25974678 CAGTGGGACAACTGGGAAGGGGG + Intergenic
954139841 3:48599184-48599206 CAATGGGGCCTGTGGGGATAGGG + Exonic
954688653 3:52384261-52384283 CATGGGGCCCTCAGGGAATAAGG - Intronic
954744458 3:52779218-52779240 CAGTGGCATATCTGGGAAAAGGG - Intronic
958636869 3:96755907-96755929 CAGTGGCTCTGCTGGGAATATGG + Intergenic
961371401 3:126434040-126434062 CAGTGGGAGCTCTGAGAACATGG - Intronic
961666986 3:128498720-128498742 CAGTCGCAACTCTGGGAATGAGG + Intergenic
961732173 3:128973737-128973759 CAGTGGGACCCCTGGGACACAGG - Intronic
961806098 3:129490431-129490453 CAGAGGGAAGCCTGGGAATAGGG - Intronic
963141221 3:141947746-141947768 CAGTGGGGCCTCTGGAACTTAGG + Intergenic
964333893 3:155634426-155634448 CAGTGAGGCCTCTGGGAAAATGG - Intronic
965550722 3:169962413-169962435 CAGTGGGACATCTTGGATTCTGG - Intergenic
967023126 3:185540198-185540220 ATGTGGGACCTCTGAGAAGATGG - Intronic
967687718 3:192437140-192437162 CAGGGAGAACTCTGGGAAAATGG + Intronic
970256885 4:14177465-14177487 CAGGCTGACCTCTGGGAGTAAGG + Intergenic
972043118 4:34629142-34629164 CAATGTCACCTGTGGGAATATGG - Intergenic
975497965 4:75055280-75055302 CAGAGAGACATCTGGAAATAAGG - Intergenic
975733224 4:77357551-77357573 CTGTGAGACCTCAGAGAATAGGG - Intronic
976135252 4:81929135-81929157 AAGTGGGATATCTGGGAAAAGGG - Intronic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
976637677 4:87303418-87303440 CAGTGTGACCTCTGGGAAATGGG + Intergenic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
979787913 4:124739842-124739864 CGGTGGGATCTGTGGGAAAATGG + Intergenic
981195904 4:141920110-141920132 CAGTGGGACCACAGGGAGTGGGG - Intergenic
985680469 5:1253298-1253320 CCCTGGGAGCTCTGGGAATTTGG - Exonic
988830219 5:34979726-34979748 CAGTGGGACTGCTGGATATATGG - Intergenic
991123560 5:63044289-63044311 CATTAGGAACTCTGGTAATAGGG + Intergenic
991694462 5:69257196-69257218 CAGAGGGGCCTCAGGGAATTTGG + Intronic
992940006 5:81751716-81751738 CAGCCGGCCCTCTGGGAACAGGG - Intronic
993835879 5:92819426-92819448 CTGTGGAACCTCTGGGATTAGGG - Intergenic
994931356 5:106189822-106189844 CACTGAGAGCTCTAGGAATATGG + Intergenic
995436074 5:112137030-112137052 AAGTGGGTCCTCTGGGGAGAAGG + Intergenic
1002321595 5:178379432-178379454 TAGTGGGACCTCTGGGCAGAGGG + Intronic
1004447880 6:15717506-15717528 CATTGGATCCTCTGGTAATAAGG - Intergenic
1006922608 6:37636570-37636592 CAGTGGGACTCCTGAGAACACGG - Exonic
1007431635 6:41780294-41780316 CAGGGGGACCACTGGGGACAAGG + Intronic
1008372226 6:50745686-50745708 CAGGGAGACCTCTGGGACCAAGG + Intronic
1015143659 6:129961873-129961895 AAGTGGGTCCTCTGTGGATAAGG - Intergenic
1015218769 6:130780624-130780646 CAGTGTGACCTATAGGAAGATGG + Intergenic
1015223321 6:130829255-130829277 CAGTGGGACATCTGGTATTTGGG + Intronic
1015997174 6:139007064-139007086 CAGAGGAACCTTTGGGAATCAGG + Intergenic
1016282792 6:142437799-142437821 TAGTGGAACCTCTGGGTATACGG - Intronic
1017701965 6:157083157-157083179 AACTGGGACTTCTGAGAATAGGG - Intronic
1018236836 6:161734756-161734778 GAGTGGGACCTGAGTGAATAAGG + Intronic
1025940994 7:66076096-66076118 GAGTGGGACCTCGGGGACTCCGG + Intronic
1028213695 7:88106262-88106284 CAGTGGCTCCCCTGGGAATTTGG + Intronic
1028935705 7:96461873-96461895 CAGTGGGATTTCTGGCCATATGG + Intergenic
1032710214 7:134454624-134454646 CACGGGGATCTCTGGGAACAGGG + Intronic
1033972549 7:147060151-147060173 CTTTGGGACCTTTGAGAATATGG - Intronic
1035522208 8:284114-284136 CACTGGGAACTCTGGGATTAGGG - Intergenic
1038692270 8:29774186-29774208 GAGTGGGACCTGTGGGCATTGGG - Intergenic
1049410919 8:142473681-142473703 CTCTGGGACCTGTGGGAGTATGG + Intronic
1049702804 8:144022770-144022792 AAGTGGGTCCTCAGGGAAGAGGG - Intronic
1049763593 8:144342507-144342529 CAGTTGGACCTCTTGGAAGGGGG - Intergenic
1049838203 8:144753981-144754003 CAGTGGGGCCACTGGCAACAGGG + Intronic
1050412220 9:5378297-5378319 CAGAGATACATCTGGGAATAGGG - Intronic
1052916463 9:33927322-33927344 CAGTGGGACCTTAGGGACTGGGG - Intronic
1052917307 9:33933249-33933271 CACTGGGTCCCCTGGGAGTAGGG - Intronic
1055955150 9:81766293-81766315 CAGTGGGAGATCTGGGGATGGGG + Intergenic
1061192423 9:129089486-129089508 CAGTCTGCCCTCTGGGCATAGGG - Exonic
1188171003 X:26926434-26926456 CATTGGTAGCTCTGTGAATATGG - Intergenic
1189136382 X:38555026-38555048 CAGTGGTGCCTCTGGGAAGGAGG - Intronic
1189301901 X:39958284-39958306 CAGTTGGGCCTCTGGGACAATGG - Intergenic
1192807261 X:74521853-74521875 CAGTGGAACCAGTGGGACTAGGG - Intronic
1193520607 X:82524505-82524527 CAGTGGGAGCTCTTGAAATGTGG + Intergenic
1195468748 X:105210365-105210387 CAGTGGGACATTAGGGTATAGGG - Intronic
1196018815 X:110967541-110967563 CAGTGGGAAGCCTGGGAATTTGG + Intronic
1196591969 X:117496046-117496068 CACTGGGACCTATTGGAAGATGG + Intergenic
1199451190 X:147980909-147980931 CAGTGTGCACTCTGGGAATGAGG + Intergenic
1200036629 X:153335190-153335212 GGGTGGGACCTCTGGGAAGTGGG - Intronic
1201639142 Y:16160174-16160196 CAGCAGGACCTCAGGGACTACGG + Intergenic
1201663671 Y:16425153-16425175 CAGCAGGACCTCAGGGACTACGG - Intergenic