ID: 1151607097

View in Genome Browser
Species Human (GRCh38)
Location 17:75144720-75144742
Sequence CCTCAGATTCAGCAGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 302}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151607097_1151607107 15 Left 1151607097 17:75144720-75144742 CCCTCAACCTGCTGAATCTGAGG 0: 1
1: 0
2: 3
3: 30
4: 302
Right 1151607107 17:75144758-75144780 GGGTGTGGAAACTGGATTGGAGG 0: 1
1: 0
2: 0
3: 23
4: 309
1151607097_1151607105 7 Left 1151607097 17:75144720-75144742 CCCTCAACCTGCTGAATCTGAGG 0: 1
1: 0
2: 3
3: 30
4: 302
Right 1151607105 17:75144750-75144772 CAGGCAGAGGGTGTGGAAACTGG 0: 1
1: 0
2: 5
3: 40
4: 501
1151607097_1151607103 -5 Left 1151607097 17:75144720-75144742 CCCTCAACCTGCTGAATCTGAGG 0: 1
1: 0
2: 3
3: 30
4: 302
Right 1151607103 17:75144738-75144760 TGAGGTTATCTTCAGGCAGAGGG 0: 1
1: 0
2: 1
3: 31
4: 252
1151607097_1151607106 12 Left 1151607097 17:75144720-75144742 CCCTCAACCTGCTGAATCTGAGG 0: 1
1: 0
2: 3
3: 30
4: 302
Right 1151607106 17:75144755-75144777 AGAGGGTGTGGAAACTGGATTGG 0: 1
1: 0
2: 2
3: 29
4: 257
1151607097_1151607102 -6 Left 1151607097 17:75144720-75144742 CCCTCAACCTGCTGAATCTGAGG 0: 1
1: 0
2: 3
3: 30
4: 302
Right 1151607102 17:75144737-75144759 CTGAGGTTATCTTCAGGCAGAGG 0: 1
1: 0
2: 1
3: 26
4: 181
1151607097_1151607104 0 Left 1151607097 17:75144720-75144742 CCCTCAACCTGCTGAATCTGAGG 0: 1
1: 0
2: 3
3: 30
4: 302
Right 1151607104 17:75144743-75144765 TTATCTTCAGGCAGAGGGTGTGG 0: 1
1: 0
2: 4
3: 31
4: 262
1151607097_1151607108 27 Left 1151607097 17:75144720-75144742 CCCTCAACCTGCTGAATCTGAGG 0: 1
1: 0
2: 3
3: 30
4: 302
Right 1151607108 17:75144770-75144792 TGGATTGGAGGACTCCCAACTGG 0: 1
1: 0
2: 10
3: 93
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151607097 Original CRISPR CCTCAGATTCAGCAGGTTGA GGG (reversed) Intronic
904031295 1:27535015-27535037 CCCAGGATTCAGCAGGGTGAGGG + Intronic
904218268 1:28942269-28942291 CATCAGATCCCACAGGTTGAGGG + Intronic
904678389 1:32212420-32212442 CTTCACATTCAGCAGACTGAAGG - Intronic
904730625 1:32588280-32588302 CATCAGATCCCACAGGTTGAAGG - Intronic
906183744 1:43843868-43843890 CGTCAGATCCCACAGGTTGACGG + Intronic
906862554 1:49377337-49377359 TATCAGCTTCAGTAGGTTGATGG - Intronic
908293905 1:62694058-62694080 CGTCAGATCCCACAGGTTGAGGG + Intergenic
908611716 1:65868597-65868619 AGGCAGATTCAGCAGGTGGATGG + Intronic
908655741 1:66386166-66386188 CATCAGATCCAACAGTTTGAGGG - Intergenic
909676350 1:78242569-78242591 CGTCAGATCCTACAGGTTGAAGG - Intergenic
910715216 1:90223073-90223095 CTTCAGATCCCACAGGTTGAGGG + Intergenic
911352507 1:96772073-96772095 CATCAGATCCCACAGGTTGAGGG + Intronic
911432295 1:97806604-97806626 ACTCTGATTCAGAATGTTGATGG - Intronic
914934845 1:151969231-151969253 CATCAGATTCCACAAGTTGAGGG - Intergenic
915727320 1:158027035-158027057 CATCAGATCCCCCAGGTTGAGGG + Intronic
916531405 1:165660167-165660189 CATCAGATCCCACAGGTTGAGGG + Intronic
917130724 1:171739623-171739645 CATCAGATCCTGCAGGTTGAGGG - Intronic
917565784 1:176210262-176210284 CCTCAGATTCACCTGGGTGCTGG - Intergenic
917854973 1:179092407-179092429 CCTCAGGTCCAGCAGAATGAGGG - Intronic
918075495 1:181168085-181168107 CATCAGATCCCACAGGTTGAGGG - Intergenic
918547345 1:185700139-185700161 ATTCTGATTCAGGAGGTTGATGG + Intergenic
918990882 1:191695837-191695859 CATCAGATCCCACAGGTTGAGGG - Intergenic
920055988 1:203192190-203192212 CATCAGATCCCACAGGTTGAGGG + Intergenic
920074031 1:203324060-203324082 TCTGAGATTCAGGAGGTTGCGGG + Intergenic
920076937 1:203344097-203344119 CCTCTGAGTGAGCAGGTTGGGGG + Intronic
920793047 1:209110885-209110907 TGTCAGATTCCACAGGTTGAAGG - Intergenic
922333421 1:224597900-224597922 CATCAGATCCCACAGGTTGAGGG - Intronic
922506478 1:226128940-226128962 AATCTGATTCAGCAGGTTGGAGG + Intergenic
923228378 1:231960772-231960794 CATCAGATGCCACAGGTTGAGGG + Intronic
923329528 1:232909670-232909692 CATCAGATCCCTCAGGTTGAGGG - Intergenic
923682014 1:236126075-236126097 CCGCATATTCAGCAAGTTTAGGG - Intergenic
924143999 1:241055229-241055251 CCTCAGATCCCACAGGTTAACGG + Intronic
924154695 1:241163921-241163943 CGTCAGATCCCACAGGTTGAGGG + Intronic
924469690 1:244331000-244331022 CATCAGATCCCACAGGTTGAGGG - Intergenic
1063835143 10:10003907-10003929 CGTCAGATCCCACAGGTTGAGGG + Intergenic
1067514662 10:46927919-46927941 CCTGAGGTTCAGGAGGTTGGAGG + Intronic
1067647597 10:48123894-48123916 CCTGAGGTTCAGGAGGTTGGAGG - Intergenic
1067708510 10:48628860-48628882 GCTCAGACTCCCCAGGTTGATGG - Intronic
1071308086 10:84316666-84316688 CATCAGATCCCACAGGTTGAGGG - Intergenic
1071496399 10:86170260-86170282 CCTCAGAGCCAGCAGGCGGATGG + Intronic
1071587795 10:86842156-86842178 CATCAGATCCCACAGGTTGAGGG - Intronic
1071758463 10:88572917-88572939 CCTGAGATTCTGCAGCTTCAAGG - Exonic
1071859598 10:89658707-89658729 CATCAGATCCAACAGGTTAAGGG + Intergenic
1072940908 10:99762687-99762709 CATCAGATCCCACAGGTTGAGGG - Intergenic
1074153565 10:110779635-110779657 CGTCAGATCCCACAGGTTGATGG - Intronic
1074251034 10:111747492-111747514 CCTCTGATTCTGCACATTGAGGG + Intergenic
1075558692 10:123451932-123451954 CGTCAGATTCTGAAAGTTGATGG + Intergenic
1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG + Intergenic
1077086241 11:752910-752932 CCTCAGATCCCACAGGTTGAAGG - Intronic
1080723579 11:34872745-34872767 CATCAGATTCCACAGGTTGAAGG - Intronic
1081467206 11:43332317-43332339 CATCAGATTCCACATGTTGAGGG + Intronic
1081469627 11:43358099-43358121 AGTCTGATTCAGCAGGTTGCGGG + Intergenic
1083940812 11:65894481-65894503 CCACAGATCCAGAAGGATGAGGG - Intronic
1085061869 11:73454685-73454707 CTCCAGATTCAGCTGGTAGACGG + Intronic
1085487578 11:76880466-76880488 CATCAGATCCCACAGGTTGAGGG + Intronic
1085488617 11:76891663-76891685 CCTCAGAAACCACAGGTTGAGGG - Intronic
1086470335 11:87102142-87102164 CATCAGATTCCACTGGTTGAGGG + Intronic
1087929975 11:103965946-103965968 GCCCAGATTCAGCAAGTTGACGG + Intronic
1089142691 11:116300049-116300071 CATCAGATCCCACAGGTTGAGGG + Intergenic
1090125348 11:124078258-124078280 CATCAGATCCCACAGGTTGAGGG + Intergenic
1091758048 12:3068261-3068283 CATCAGATTTAGTAAGTTGAAGG - Intergenic
1091977549 12:4837493-4837515 CATCAGATCCCACAGGTTGAGGG - Intronic
1093466810 12:19457812-19457834 ATTCTGATTCAGCAGGTTTAGGG - Intronic
1095259859 12:40085427-40085449 CGTCTGATTCCACAGGTTGAGGG - Intronic
1095749349 12:45694280-45694302 CCTCAGATTCCACAGGTTATGGG + Intergenic
1096854770 12:54472967-54472989 CACCAGATTCAGCAGCTTGTAGG + Intronic
1097374031 12:58819146-58819168 CCCCAGACTCAGCTGGTAGAAGG + Intergenic
1097698348 12:62796308-62796330 CATCAGATTTCACAGGTTGAGGG + Intronic
1097725154 12:63066885-63066907 CCACTGATTCAGCAAGTTGCAGG + Intergenic
1098168965 12:67727065-67727087 CATCAGATACCACAGGTTGATGG + Intergenic
1100174050 12:92009185-92009207 CCTCAAATTAAGCAGGTTGTGGG - Intronic
1100413477 12:94346642-94346664 CATCAGATCCTGCGGGTTGAAGG - Intronic
1101462682 12:104912796-104912818 CATCAGATCCCACAGGTTGAGGG - Intronic
1101772801 12:107767170-107767192 CGTCAGATCCCACAGGTTGAGGG + Intergenic
1102833164 12:116026537-116026559 GCTCTGATTCAGGAGGTTTAGGG + Intronic
1104427444 12:128689842-128689864 TCTCAGATTCAGCAGGTCTGGGG - Intronic
1104484922 12:129143091-129143113 CATCAGATCCCACAGGTTGAGGG + Intronic
1105940839 13:25146492-25146514 CCTCAGATGCCACAGGTTAAAGG - Intergenic
1106613900 13:31309413-31309435 CCTTAGATCCCACAGGTTGACGG + Intronic
1109331890 13:60941067-60941089 CATCAGATACCGCAGGTTGGGGG + Intergenic
1109470941 13:62802563-62802585 CATCAAATTCTACAGGTTGAGGG - Intergenic
1109748485 13:66657900-66657922 CCTCAGATTCAACAGACTGCAGG + Intronic
1109933115 13:69243521-69243543 CCTCTGAGTCAGCAGGATAAGGG - Intergenic
1112285765 13:98103167-98103189 CATCAGATCCCACAGGTTGAGGG + Intergenic
1112491418 13:99867846-99867868 ACTCAGATTCTGCTGGGTGATGG - Intronic
1113253212 13:108477109-108477131 CATCAGATTCAGCTGGCTGAAGG + Intergenic
1115826954 14:37289350-37289372 CCTCAGATCCCATAGGTTGAGGG + Intronic
1115919800 14:38359985-38360007 CATCAGATCCCACAGGTTGAAGG + Intergenic
1119392129 14:74298025-74298047 GCTCACATACAGCAGGTTGCAGG + Exonic
1120560898 14:85990853-85990875 CGTCAGATCCCACAGGTTGAGGG - Intergenic
1121351909 14:93180366-93180388 CTTCACATTGAGCAGGCTGAGGG - Intergenic
1121594272 14:95147701-95147723 CATCAGATCCCACAGGTTGAGGG + Intronic
1122018527 14:98817513-98817535 GCTCAGATTCAGCAGTGGGACGG - Intergenic
1124192624 15:27593798-27593820 CATCAGATCCTGCAGGTTAAGGG + Intergenic
1124412213 15:29445849-29445871 CATCAGATCCCACAGGTTGAGGG - Intronic
1127890401 15:63245613-63245635 CATCAGATCCCACAGGTTGAGGG + Intronic
1131734738 15:95320112-95320134 CCTCATATCCCACAGGTTGAGGG + Intergenic
1131881512 15:96867562-96867584 CCCCAGATTCAACTGGTAGAGGG + Intergenic
1133456483 16:5946749-5946771 AATCAGATTCCACAGGTTGAGGG - Intergenic
1135018924 16:18947385-18947407 CCTCAGATTCAGCAGCTCTGGGG + Intergenic
1136076056 16:27818017-27818039 CCTCTGATTCAGCAGGTCTAAGG + Intronic
1137247425 16:46717173-46717195 CGTCAGATCCCACAGGTTGAGGG - Intronic
1137281320 16:46979121-46979143 CATCAGATCCCACAGGTTGAGGG - Intergenic
1137319564 16:47366955-47366977 CCTCTAATTCCACAGGTTGAGGG + Intronic
1139273082 16:65701443-65701465 CATCACATTCCACAGGTTGAGGG - Intergenic
1139818141 16:69693945-69693967 CCTCAGATTCAGTTGGTACAAGG + Exonic
1141005670 16:80349454-80349476 CTTAAGAATCAGCAGATTGATGG + Intergenic
1141879738 16:86849932-86849954 TCTCTGATTCAGCAGGTCTAGGG - Intergenic
1141963461 16:87425056-87425078 CCTCAGTTTCAGCAGGCAGGAGG - Intronic
1144024655 17:11267338-11267360 CTTCAGATTCAGTAGGTTTGAGG - Intronic
1144936972 17:18907532-18907554 AGTCAGATCCAGCAGGCTGAAGG - Intronic
1147197583 17:38777919-38777941 CTGCTGATTTAGCAGGTTGAGGG - Intronic
1147219976 17:38922821-38922843 CCTCAGGTCCAGCTGCTTGAGGG + Intergenic
1151570272 17:74922417-74922439 CCCCAAAATGAGCAGGTTGAGGG + Intronic
1151607097 17:75144720-75144742 CCTCAGATTCAGCAGGTTGAGGG - Intronic
1153703194 18:7717272-7717294 CCCCAGACTCAGCTGGTAGATGG + Intronic
1153889018 18:9495243-9495265 CATCAGATTCCACAGGTTGACGG - Intronic
1155641844 18:28026923-28026945 CAACAGAATCAGCAGGTAGAAGG + Intronic
1156120243 18:33834293-33834315 CCTGAGATCCAGGAGGTTGGAGG - Intergenic
1156369586 18:36460886-36460908 CCTCACTTTCAGCAGGTGAAGGG - Intronic
1158896470 18:61918710-61918732 CATCAGACTCCGCAGGTTTAAGG + Intergenic
1160568407 18:79800530-79800552 GCTCTGATTCAGCCGGTTTAGGG - Intergenic
1161990994 19:7684158-7684180 CCTCAGATTCAGCAGCTCTGGGG - Exonic
1163541109 19:17911150-17911172 CATCAGATCCCGCAGGTTAAGGG + Intergenic
1164010165 19:21195120-21195142 CCTGTGATTCAGCAGGTTTATGG + Exonic
1164538159 19:29102082-29102104 CATCAGATCCCACAGGTTGAGGG - Intergenic
1165401274 19:35602076-35602098 CATCAGATCCCACAGGTTGAAGG + Intergenic
1165551384 19:36589309-36589331 CATCAGATCCCTCAGGTTGAGGG - Intronic
1165891720 19:39116584-39116606 CCTCAGATCCCACAGGTTGAGGG + Intergenic
1166052225 19:40267136-40267158 CCCCACATTCAGCAGCTAGAGGG + Intronic
1166700304 19:44878322-44878344 CCTCACCCTCAGCAGGATGAAGG - Intronic
1167132128 19:47593818-47593840 CATCAGATCCCACAGGTTGAAGG - Intergenic
1167966330 19:53150169-53150191 CATCAGATCCCACAGGTTGAGGG - Intronic
924999908 2:396578-396600 CCTTAGCTTCCGCAGGTAGAGGG - Intergenic
925983921 2:9199814-9199836 GCTCTGATTCAGCAGGTCCAAGG + Intergenic
926762396 2:16290509-16290531 CATCAGATCCCACAGGTTGAGGG + Intergenic
926968479 2:18442118-18442140 CCTCAGATTCAGGAGGCTGAAGG + Intergenic
927765486 2:25803479-25803501 TGTCAGATTCCACAGGTTGAGGG - Intronic
928276194 2:29902371-29902393 ATGCAGATTCAGCAGGATGATGG - Intronic
928330773 2:30356364-30356386 CGTCAGATTCCACAGGTTGAAGG + Intergenic
928819321 2:35342087-35342109 CCTGTCATTCAGCTGGTTGAAGG - Intergenic
930009205 2:46922845-46922867 CCTCAGAAACCGCAGGTTGAGGG + Intronic
930745975 2:54884104-54884126 CCTCAGATGCCACAGGTTGAGGG + Intronic
932623019 2:73277228-73277250 CCTCAGCTCCAGCAGATGGAGGG - Intronic
932986383 2:76730798-76730820 TTTCTGATTCAGCAGGTTCAGGG + Intergenic
933606790 2:84391749-84391771 CATCAGATCCCACAGGTTGAGGG + Intergenic
934912461 2:98272118-98272140 CATCAGATCCCACAGGTTGAGGG + Intronic
935184327 2:100717984-100718006 CATCAGATCCCCCAGGTTGAGGG + Intergenic
935378272 2:102422451-102422473 TCTCAGTTTCAGCAGCTGGAGGG - Intronic
936602381 2:113910567-113910589 CATCAGAATCCACAGGTTGAAGG - Intronic
937294698 2:120802917-120802939 ACTCAGATTCAGTAGGTCTAAGG - Intronic
938417136 2:131113001-131113023 CATCAGATCCCACAGGTTGAGGG - Intronic
939806470 2:146780127-146780149 CCTCAGAGTCAACAGGCTAAGGG + Intergenic
941026537 2:160462152-160462174 CATCAGATTCACCAGGGCGAGGG + Intronic
942745299 2:179225081-179225103 CATCAGATCCCTCAGGTTGAGGG - Intronic
943464207 2:188208535-188208557 CCTAAGTTACAGCAGATTGAAGG - Intergenic
943843488 2:192609759-192609781 CTTCAGAGTCAGCATATTGAAGG + Intergenic
944295966 2:198062766-198062788 CATCTGATTCAGTAGGTTAAAGG - Intronic
945185562 2:207136136-207136158 ACTCAGATTCAGTAGTTTGCTGG - Intronic
945430137 2:209754456-209754478 CATCAGATCCCACAGGTTGAAGG - Intergenic
947180331 2:227405638-227405660 CTTCAGATTCAGGAGTTTGGTGG + Intergenic
947767818 2:232648708-232648730 GCTCTGATTCAGCAGGTCTAGGG + Intronic
1169469849 20:5874736-5874758 CATCAGATCCCGCAGGTTAAGGG - Intergenic
1169542798 20:6618897-6618919 CGTCAGAATCCACAGGTTGAGGG + Intergenic
1170125285 20:12956464-12956486 CCTCAGAAACCACAGGTTGAGGG + Intergenic
1170588470 20:17753279-17753301 CCCCAGATTCTTGAGGTTGAGGG - Intergenic
1173152364 20:40578473-40578495 CCTGAGATCCAGCAGGTTCAAGG - Intergenic
1174884012 20:54311816-54311838 CCTCACATTCAGGAGGCAGAAGG + Intergenic
1177579820 21:23007061-23007083 GCACAGATTTAGCAGGTTTATGG + Intergenic
1178237255 21:30857396-30857418 CATCAGATCCTGCAGGTTAAGGG + Intergenic
1178857955 21:36265974-36265996 CTTGAGATCCTGCAGGTTGAGGG + Intronic
1179168155 21:38951552-38951574 ACTCTGATTCAGCAGGCTGAGGG + Intergenic
1179500788 21:41807404-41807426 CCACAGATTCAGGAGGAAGAAGG - Intronic
1181696906 22:24597878-24597900 CCTCAGAAACCACAGGTTGAGGG + Intronic
1181734142 22:24868655-24868677 CCTCAGACTAAGCAAGTTGTGGG + Intronic
1182825779 22:33263371-33263393 ACTCAGGTTGAGCAGGATGAAGG + Intronic
1183565477 22:38611245-38611267 GCTCAGATTCAGCACGCTGAGGG + Intronic
1184068529 22:42134299-42134321 CCTCAGATGCAGCATGTTTTAGG + Intergenic
1185263529 22:49884944-49884966 CCTGAGAAGCAGCAGGCTGATGG + Exonic
1185414367 22:50701684-50701706 CCTTAGGTTCAGCGGGATGAGGG + Intergenic
949950310 3:9223779-9223801 CTTCAGAATCAGCAGGTTCTTGG - Intronic
952423744 3:33153771-33153793 CCGCAGATTCACCAGGATCACGG - Exonic
952983449 3:38756863-38756885 CCTCAGGGTCTGCAGGTTCAAGG + Exonic
953664036 3:44913104-44913126 ATTCTGATTCAGCAGGTTTAGGG + Intronic
954345140 3:49990941-49990963 CTTCAGACTCCGCAGGTTGAAGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955320179 3:57968701-57968723 CATCAGATTCCAAAGGTTGAGGG - Intergenic
955591474 3:60540463-60540485 CCTCAGATTCCACAGGTTGAGGG - Intronic
956272514 3:67462825-67462847 TCTCAGATCCCACAGGTTGAGGG - Intronic
956437799 3:69251267-69251289 GCTCAGATTCAAGAGGTGGAAGG - Intronic
956979520 3:74619338-74619360 ATTCAGATTCAGCAGGTCTAGGG + Intergenic
957737464 3:84221335-84221357 CATCAGATTCCACAGGTTAATGG + Intergenic
959342226 3:105146059-105146081 CGTCAGATTCCACAGGTTGAGGG - Intergenic
960240190 3:115331621-115331643 TCTCAGATCCCACAGGTTGAGGG - Intergenic
962033056 3:131621598-131621620 CCTCAGATACTGCAGGTTTTAGG + Intronic
962100699 3:132339421-132339443 CATCAGATCCTACAGGTTGAGGG + Intronic
962679601 3:137784619-137784641 CTTCTGATTCAGTAGGTCGAAGG + Intergenic
963952398 3:151217364-151217386 TCTCAGATTCCTCAGGTTGCTGG + Intronic
964257772 3:154796857-154796879 CATCAGATCCCACAGGTTGAAGG + Intergenic
965846603 3:172969473-172969495 CATCAGAATCACCTGGTTGAAGG + Intronic
965981115 3:174692132-174692154 CCTCTGATTGAGCTGGGTGAGGG - Intronic
966694826 3:182778855-182778877 CATCAGATCCCTCAGGTTGAGGG + Intergenic
967163470 3:186759703-186759725 CCTCAGAAACCACAGGTTGAGGG + Intergenic
967661267 3:192113156-192113178 AGTCAGATTCCACAGGTTGAGGG - Intergenic
969304872 4:6319869-6319891 CTTCAGGTTCAGCAGGAGGAAGG - Intergenic
969945871 4:10782639-10782661 ACTCATCTTCATCAGGTTGATGG - Intergenic
971873337 4:32273047-32273069 CCTCACACTCAGCTAGTTGATGG - Intergenic
973670439 4:53211585-53211607 CATCAGATCCCACAGGTTGAGGG - Intronic
977401767 4:96541532-96541554 CATCAGATCCTGCAGGTTCAGGG - Intergenic
977718404 4:100209726-100209748 CATCAGATGCCACAGGTTGAGGG - Intergenic
979958198 4:126981724-126981746 CATCAGATTCCACAGGTTAAGGG + Intergenic
981505212 4:145492250-145492272 CCTCAGATCCCACAGATTGAAGG + Intronic
981623817 4:146734585-146734607 CATCAAATTCCCCAGGTTGAGGG - Intronic
982092124 4:151889339-151889361 ACTCAGATTCTGCAGGTAGTCGG - Intergenic
984118768 4:175715528-175715550 GCTCAGATTCAGCTGGGAGAGGG + Intronic
985043675 4:185917717-185917739 TGTCAGATCCCGCAGGTTGAAGG - Intronic
985122949 4:186661906-186661928 CCTCAGATTCTGCAGGTTAAGGG - Intronic
985245284 4:187974396-187974418 ATTCTGATTCAGCAGGTCGAGGG + Intergenic
985319087 4:188688824-188688846 CCTCAGATCCCACAGGTGGAGGG - Intergenic
985803837 5:2024184-2024206 GATCAAATTCAGCAGCTTGAAGG - Intergenic
986332984 5:6731511-6731533 CCTCATATTCAGTGGGTTTAAGG + Intronic
986707139 5:10461605-10461627 CCTGAGATCCCACAGGTTGAGGG + Intronic
986830007 5:11566250-11566272 CCTCAGTTTCAGCACCTTAAAGG - Intronic
986935277 5:12876760-12876782 CCCCAGATTCAGCCAGTAGATGG + Intergenic
986984143 5:13480999-13481021 ACTCAGATTCAACAGGATGACGG + Intergenic
987252043 5:16109764-16109786 CATCAGATTCTACAGGTTGATGG - Intronic
988781692 5:34528358-34528380 CCTCATATTCTGCTGGTGGATGG - Intergenic
988943630 5:36171683-36171705 GCTAAGATTCAGCTGGGTGATGG - Exonic
988996483 5:36719895-36719917 ATTCAGATGCAGCTGGTTGAAGG - Intergenic
989169125 5:38457906-38457928 CCACAGAGTCAGAAGGTAGAAGG + Intronic
989186646 5:38632464-38632486 TGTCAGATTCCACAGGTTGAGGG - Intergenic
989959903 5:50400359-50400381 CCTCAGATTCTAAAGATTGACGG + Intronic
990334639 5:54760329-54760351 CATCAGTTTCACCAGGTAGATGG - Intergenic
990604510 5:57395413-57395435 CATCAGATCCCACAGGTTGAGGG + Intergenic
991483729 5:67112409-67112431 CATTAGATTCCACAGGTTGAGGG + Intronic
992272151 5:75076202-75076224 CCTCAGATTCCACAGGTTTAAGG + Intronic
994552508 5:101255537-101255559 CATCAGATCCTACAGGTTGAGGG - Intergenic
995493972 5:112722514-112722536 CATCAGATCCCACAGGTTGAGGG + Intronic
1001072819 5:168601479-168601501 CCTCAGTTTCTGGAGGTTGGAGG + Intergenic
1001945017 5:175771626-175771648 TGTCAGATTCTGCAGGATGAGGG + Intergenic
1002124241 5:177029913-177029935 CTTCAGATCCTACAGGTTGAGGG - Intronic
1002998620 6:2310358-2310380 CATCAGATCCCACAGGTTGAGGG + Intergenic
1003462869 6:6348288-6348310 CCTCAGAAACAACAGGGTGATGG - Intergenic
1003706911 6:8542834-8542856 TATCAGATTCCACAGGTTGAGGG + Intergenic
1004278196 6:14256669-14256691 TGTCAGATTCCACAGGTTGAGGG + Intergenic
1004394409 6:15235534-15235556 CCTCAGATCCCACAGGTTGAAGG + Intergenic
1004496177 6:16165529-16165551 CATCAGATCCCACAGGTTGAGGG + Intergenic
1004931066 6:20463802-20463824 CGTCAGATCCCACAGGTTGAAGG + Intronic
1005692937 6:28324419-28324441 CCTCAGATGCTGCTGGTTCATGG - Intergenic
1005976582 6:30804798-30804820 CATCAGATCCCACAGGTTGAGGG + Intergenic
1006041892 6:31263032-31263054 CCTCAGACTCCACAGGTTTAAGG - Intergenic
1006155510 6:32011011-32011033 CCTCAGAGTGTGCAGGTGGACGG - Intergenic
1006161843 6:32043865-32043887 CCTCAGAGTGTGCAGGTGGATGG - Exonic
1007674800 6:43584641-43584663 CATCAGATTCCACATGTTGAGGG + Intronic
1007937992 6:45750831-45750853 CATCAGATCCCGCAAGTTGAGGG - Intergenic
1008617876 6:53243636-53243658 TCTCAGGTTCAGCAGGTCTAGGG + Intergenic
1008634105 6:53392406-53392428 CATCAGATCCTGCAGGTGGATGG + Intergenic
1010238091 6:73591694-73591716 CATCCGATTCCACAGGTTGAAGG + Intergenic
1010382320 6:75239249-75239271 CATCAGATTCCACAGGTTGATGG - Intronic
1011624832 6:89274215-89274237 CCTCAGATGCCCCAGGTTGTTGG + Intronic
1011667107 6:89644944-89644966 TTTCAGATTGAACAGGTTGAAGG + Intronic
1014023629 6:116618810-116618832 CATCAGATCCCACAGGTTGAGGG + Intronic
1014242106 6:119028839-119028861 CATCAGATTCCACAGGTTAAAGG - Intronic
1014892311 6:126857624-126857646 GCTTAGATTCAACTGGTTGATGG - Intergenic
1015334330 6:132020181-132020203 CCTCAGACACAGAAGGCTGAGGG + Intergenic
1016499857 6:144707708-144707730 CTTCTGATTCAGCAGGTTTTGGG + Intronic
1018743333 6:166746574-166746596 CCTCAGATTCCACAAGTTGAGGG + Intronic
1019790100 7:3006378-3006400 CATCAGCTTCTCCAGGTTGATGG - Intronic
1021977128 7:26021495-26021517 CATCAGACTCCACAGGTTGAAGG - Intergenic
1022008437 7:26288596-26288618 TGTCAGATCCAACAGGTTGAGGG + Intergenic
1023708951 7:42971362-42971384 CATCAGATGCCACAGGTTGAGGG + Intergenic
1024340181 7:48249922-48249944 CATCAGATCCTGCAGGTTAAGGG + Intronic
1028345765 7:89780004-89780026 CCCCAGACTCAGCTGGTAGACGG + Intergenic
1030634704 7:111935744-111935766 AGTCAGTTGCAGCAGGTTGATGG - Intronic
1032522091 7:132553204-132553226 CCTCAGGGTGAGCAGGTTGCAGG - Intronic
1033026033 7:137773450-137773472 CCTCAGAGTCACCAGGTTTCAGG - Intronic
1033147799 7:138885918-138885940 CCTCAGATCCTACAGGTGGAGGG - Intronic
1033780794 7:144666860-144666882 CCTCACATTGAGTAGGTTGTTGG - Intronic
1033966057 7:146976337-146976359 CCTCAGATCCCACAGGGTGAGGG + Intronic
1034938269 7:155213659-155213681 CCCCAGTTGCAGCAGGTTGGGGG + Intergenic
1037110503 8:15159494-15159516 CTTCAGATGCCACAGGTTGAGGG - Intronic
1037442035 8:18926827-18926849 CATCAGATCCTACAGGTTGAGGG + Intronic
1038268298 8:26052894-26052916 TCAAAGATTCAGAAGGTTGAGGG - Intergenic
1038298834 8:26323410-26323432 CATCATATTCCCCAGGTTGAGGG + Intronic
1039311719 8:36323480-36323502 GCTCAGTGTCAGCAAGTTGAGGG - Intergenic
1039433968 8:37547054-37547076 CCTCGGCTGCTGCAGGTTGATGG - Intergenic
1040010152 8:42654834-42654856 TTTCTGATTCAGCAGGTTCAGGG + Intergenic
1040297501 8:46165267-46165289 CCTTTGATTTAGCAGGTTGGAGG - Intergenic
1040347272 8:46517404-46517426 CTTTACATTCAGCAGGTTGTAGG + Intergenic
1040859934 8:51988671-51988693 CTACGGATTCAGCATGTTGAGGG - Intergenic
1040946216 8:52887106-52887128 CATCAGATCCCACAGGTTGAAGG - Intergenic
1041950523 8:63495747-63495769 CTTCAGATCCCACAGGTTGAGGG - Intergenic
1042369780 8:67978111-67978133 CGTCAGATTCCACAGGTTGAGGG - Intronic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1045615244 8:103901283-103901305 CCTCAGATTCAGAGGGTTCAGGG + Intronic
1046438705 8:114230510-114230532 CCCCAGACTCAGCTGGTAGATGG + Intergenic
1049468029 8:142762110-142762132 CGTCAGATCCCGCAGGTGGAGGG - Intergenic
1049872780 8:144994012-144994034 CCTCAGATCCCACAGGCTGAGGG - Intergenic
1050460672 9:5874904-5874926 CATCAGATCCCACAGGTTGAGGG - Intergenic
1051484489 9:17593321-17593343 CGTCAGATCCCACAGGTTGAGGG - Intronic
1051753467 9:20369043-20369065 TTACAGATTCAGTAGGTTGAGGG + Intronic
1055305759 9:74927633-74927655 CGTCAGATCCCACAGGTTGAGGG + Intergenic
1056605649 9:88082650-88082672 CATCAGATCCCACAGGTTGAGGG - Intergenic
1057161196 9:92889490-92889512 CCTGAGATTCAGAAGGGTCAAGG - Intergenic
1057199231 9:93131527-93131549 CCTCACAGCCCGCAGGTTGAAGG - Intronic
1057284669 9:93742381-93742403 CATCAGATCCCACAGGTTGAGGG + Intergenic
1057311344 9:93945138-93945160 CCTCAGAGTCAGGAGGATGCTGG - Intergenic
1057327323 9:94077344-94077366 TGTCAGATCCAACAGGTTGAGGG + Intronic
1057526801 9:95810327-95810349 CCTCAGATCCCACAGGTTAAGGG + Intergenic
1057666641 9:97051023-97051045 CATCAGATCCCACAGGTTGAGGG - Intergenic
1057711753 9:97451766-97451788 CATCAGATCCCACAGGTTGAGGG - Intronic
1057816718 9:98301262-98301284 CTTCAGATCCCACAGGTTGAGGG - Intronic
1058726838 9:107812684-107812706 CGTCAGATGCCACAGGTTGAGGG + Intergenic
1058909145 9:109505218-109505240 CCAGAGATTCAGAAGGTTCATGG - Intergenic
1059892512 9:118818564-118818586 CATCAGATCCCGCAGGTTGAAGG + Intergenic
1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG + Intronic
1061512470 9:131069495-131069517 ATTCTGATTCAGAAGGTTGAAGG - Intronic
1061741417 9:132708942-132708964 CCTCAAAATCTGCAGGCTGAAGG + Intergenic
1185727963 X:2437950-2437972 CCTCAGATGAAGCACCTTGAAGG + Intronic
1186837194 X:13449916-13449938 CGTCAGATCCCACAGGTTGAGGG + Intergenic
1187288090 X:17925521-17925543 CCTCAGATTCTGCAGGTTCTTGG + Intergenic
1187502408 X:19850860-19850882 CCTCAGATTCAGTAGGTCTCGGG - Intronic
1187682878 X:21785659-21785681 CATCAGATCCCACAGGTTGAGGG - Intergenic
1187862004 X:23691847-23691869 CATCAGATACCACAGGTTGAGGG + Intergenic
1188433555 X:30134833-30134855 CATCAGATTCCACAGGTTAAGGG + Intergenic
1189147241 X:38667668-38667690 CCACTGATTCTTCAGGTTGATGG + Intronic
1189182164 X:39014905-39014927 CCTCAGATCCAGCATGCTGCTGG - Intergenic
1189464115 X:41265079-41265101 CTTCAGATCCCACAGGTTGATGG - Intergenic
1189515624 X:41711178-41711200 CATCAGATTCCACAGGTTGAGGG - Intronic
1189516562 X:41718456-41718478 CGTCAGATCCCACAGGTTGAAGG - Intronic
1191011113 X:55760372-55760394 TGTCAGATTCAGCAGGTTTGGGG + Intergenic
1195325602 X:103755858-103755880 CGTCAGATCCTGCAGGTTGAGGG + Intergenic
1195406986 X:104525267-104525289 CATCAGATTTAGAAGGTAGAAGG - Intergenic
1196801938 X:119551819-119551841 CGTCAGATACCACAGGTTGACGG + Intronic
1197557832 X:127978055-127978077 CATCAGATTCCACGGGTTGAGGG + Intergenic
1200924539 Y:8642567-8642589 CCTCTGCTTCAGCAGAATGATGG + Intergenic