ID: 1151607531

View in Genome Browser
Species Human (GRCh38)
Location 17:75148459-75148481
Sequence CAACAGCCACAGATGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151607531 Original CRISPR CAACAGCCACAGATGCAGCT TGG (reversed) Intronic
900833805 1:4984844-4984866 CAGAACTCACAGATGCAGCTTGG - Intergenic
901028311 1:6291010-6291032 CCACAGAGACAGAGGCAGCTTGG + Intronic
901492338 1:9602883-9602905 CAGCAGCCAGAGCTGCAGCTCGG - Intronic
901819092 1:11814709-11814731 GAAGAGGCACAGATTCAGCTTGG - Intronic
901827620 1:11872658-11872680 CTATAGCCCCAGAAGCAGCTCGG - Intergenic
902103570 1:14014192-14014214 CAACAGACACAGTTGCAACATGG - Intergenic
902193008 1:14776818-14776840 CCTCAGCCACTGAAGCAGCTAGG - Intronic
902337299 1:15760890-15760912 CCACTGCCACCGATTCAGCTGGG - Intronic
903378877 1:22883460-22883482 AAACAGCCACAGAGGCTGCAAGG + Intronic
904042702 1:27593554-27593576 CCACAGCCACGGCTCCAGCTGGG + Intronic
905090065 1:35423565-35423587 CATCAGCCTCTGAAGCAGCTGGG - Intergenic
910564789 1:88631290-88631312 CAACAGGAACAGATTCAGGTGGG + Intergenic
911512730 1:98827563-98827585 AAACGGCCCCAGATACAGCTTGG + Intergenic
912963985 1:114221162-114221184 TTACAGGCACAGATGCAGGTAGG - Intergenic
914926537 1:151893613-151893635 CATCAGGCACAGATGCAGGGGGG + Intronic
916146093 1:161740743-161740765 TAGCAGGCCCAGATGCAGCTTGG + Intergenic
918314754 1:183313912-183313934 CAAGGGCCTCAGCTGCAGCTGGG + Intronic
918633505 1:186747673-186747695 CAACAGCCTGAGATGTACCTTGG - Intergenic
918870098 1:189960677-189960699 CAAAAGCCATAGATGCAGGTAGG - Intergenic
919109716 1:193202652-193202674 CAACAGCCGCAGGAGCAGGTAGG - Intronic
920570912 1:207016600-207016622 CAGCACACACAGATGCAGATAGG + Intronic
920778000 1:208959124-208959146 CAACAGCCCAAGCTGCATCTGGG - Intergenic
922153354 1:223023045-223023067 CCAGAGCCACAGTGGCAGCTGGG + Intergenic
922235096 1:223716732-223716754 CAAAAGCCACAGAGGAAGTTGGG - Intronic
922536477 1:226384852-226384874 CAACAGCGAGGGAAGCAGCTTGG + Intronic
923034929 1:230279115-230279137 AACCAGCCACAGGTGCTGCTGGG - Intronic
1063705506 10:8426613-8426635 TAACAGCCACAGCAGCACCTGGG + Intergenic
1064103936 10:12485458-12485480 CAGCAGACACATTTGCAGCTGGG - Intronic
1064943422 10:20760395-20760417 GCACATCCACAGATTCAGCTGGG - Intergenic
1066135979 10:32446489-32446511 CAACCGCCACGGAGGCAGCCAGG - Exonic
1067879029 10:50027595-50027617 CAACGGCCCCAAAGGCAGCTGGG - Intergenic
1069670404 10:70197476-70197498 CAAGAGCTACAGAGGCAGGTAGG + Intergenic
1071983848 10:91031318-91031340 CAGAGGCCACAGAAGCAGCTGGG - Intergenic
1075201648 10:120409468-120409490 CTGCAGCCACAGGTCCAGCTGGG - Intergenic
1075456377 10:122587650-122587672 AAACACCCCCAGATGCAGCAGGG + Intronic
1076518683 10:131065380-131065402 CCTCAGCCACAGAAGTAGCTTGG - Intergenic
1076610305 10:131722231-131722253 CAGCGGCCACAGATGCAGAGAGG + Intergenic
1077169654 11:1160533-1160555 CTGCGGCCACAGATGCAGCATGG - Intronic
1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG + Intronic
1078004546 11:7522767-7522789 CATCAGCCCCACATACAGCTAGG - Intronic
1078052908 11:7983263-7983285 CGACAGTCACAGAAGGAGCTGGG + Intronic
1081602756 11:44506622-44506644 TAAGAGCCAAAAATGCAGCTTGG - Intergenic
1083878410 11:65536764-65536786 TCTCAGCCACTGATGCAGCTAGG - Intronic
1083937750 11:65879235-65879257 CAATGGGCACAGGTGCAGCTGGG + Intergenic
1083955602 11:65981369-65981391 CAAGAGCCAGAGATGCAGAGAGG - Intergenic
1084564385 11:69920935-69920957 CAGCAGCCACAGGTGCAGGAGGG + Intergenic
1085196951 11:74678518-74678540 CAACAGCCTCACAGGCAGCCAGG + Intergenic
1085311510 11:75519719-75519741 CACCAGCCACAGATACTGATGGG + Intronic
1087050716 11:93883871-93883893 CAACAGCCACTGAGTGAGCTTGG - Intergenic
1087097013 11:94328813-94328835 GAACAGCCACTGCTGCACCTGGG + Intergenic
1087166479 11:95009533-95009555 CATGAGCCCCAGATGCAGCAAGG + Intergenic
1087480410 11:98693214-98693236 CAACAGCCTGAGCTGCATCTAGG - Intergenic
1089246296 11:117122750-117122772 CTACTGCCACAGAACCAGCTGGG - Intergenic
1090064923 11:123494545-123494567 TGACAGCCACAGAAGCAGCCAGG - Intergenic
1090417499 11:126550711-126550733 AAACAGCCACAAAAACAGCTGGG + Intronic
1091222514 11:133937594-133937616 CCACAGGGACAGATGCATCTGGG + Intronic
1091919440 12:4292733-4292755 AAACAGCCAGAGAGGCAGTTTGG + Intronic
1092960913 12:13596242-13596264 CAACAGACCCTGAGGCAGCTGGG - Intronic
1093075172 12:14750669-14750691 CCTCAGCCACCCATGCAGCTGGG - Intergenic
1093260302 12:16928141-16928163 CAACAAACACAGCTGCAGGTTGG - Intergenic
1094301927 12:28974171-28974193 CACCAGCCACAGAAGTATCTGGG + Intergenic
1094383529 12:29869090-29869112 CAACAGCCGCTGTTGCAGGTTGG - Intergenic
1095526490 12:43131853-43131875 CAACATCATCTGATGCAGCTTGG + Intergenic
1095676626 12:44926712-44926734 CAAGAGACACAGAGGCAGATAGG - Intergenic
1096121162 12:49090281-49090303 CCACAGCCACAAATGAAGCCCGG + Exonic
1097105826 12:56623708-56623730 CAGAAGCCAAAGATGCTGCTAGG + Intronic
1097832650 12:64241660-64241682 CCACAGCCACCGAAGTAGCTGGG + Intergenic
1098837704 12:75441901-75441923 CAACAGCCCCAGCTGTACCTTGG - Intergenic
1100518787 12:95353451-95353473 CAACTGCCCCCGATGCATCTGGG + Intergenic
1101917630 12:108908218-108908240 CAAGAGCCACAGATTCAGAGGGG + Intergenic
1102143497 12:110636692-110636714 CCACAACAACAGAGGCAGCTGGG - Intronic
1102452859 12:113054736-113054758 CAACAAACACAGAGGCAGCATGG + Intergenic
1103584119 12:121938300-121938322 CAACAACAACAGATGAGGCTGGG - Intronic
1103919325 12:124391201-124391223 CAACATCCCCAGATGCAGGTGGG - Intronic
1106144149 13:27036721-27036743 GCACAGCCCCAGATGCTGCTGGG - Intergenic
1106706014 13:32280173-32280195 TGACAGGCAGAGATGCAGCTTGG + Intronic
1108269140 13:48741320-48741342 CAGCAGCCCCAGATGCATCTTGG - Intergenic
1108446376 13:50512761-50512783 CGCCAGCCTCAGAGGCAGCTGGG + Intronic
1108727582 13:53200039-53200061 CAGCAGCCACAGAATCAGCAAGG - Intergenic
1111050171 13:82872553-82872575 CCTCAGCCCCAGAAGCAGCTAGG + Intergenic
1111778627 13:92694028-92694050 CAACAGCCCCAGTTGCACCTGGG - Intronic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1117119641 14:52553338-52553360 CAGCCGCCACAGCTGCAGGTAGG - Exonic
1117536802 14:56710342-56710364 CAATAGCCAAGGATGCAGATAGG + Intronic
1117581177 14:57153267-57153289 CAAAAGCCAGAGATGTAGATGGG + Intergenic
1119261544 14:73240859-73240881 TAGAAGCCACAGAGGCAGCTGGG + Intronic
1119561335 14:75592277-75592299 CAATAGCCCCAGGTACAGCTTGG - Intronic
1120264920 14:82236647-82236669 GAACAGCCACAGACACAGTTGGG + Intergenic
1121672554 14:95723992-95724014 AAACAGCCCCAGGTACAGCTTGG + Intergenic
1122564425 14:102642149-102642171 CAATGGACACAGACGCAGCTGGG - Intronic
1122618857 14:103041676-103041698 CACCGGCCGCAGCTGCAGCTTGG + Intronic
1202940706 14_KI270725v1_random:143208-143230 CTACAGCTACAGCTGCAGTTTGG - Intergenic
1123908469 15:24943413-24943435 CATGAGCCATAGGTGCAGCTGGG + Intronic
1125329311 15:38566276-38566298 TCACAGCCACAGATGCAGAAGGG + Intergenic
1126292758 15:47100039-47100061 CTACAGCTACAGCTGCAGTTTGG + Intergenic
1126497109 15:49303781-49303803 CTAGAGCCAAAGAAGCAGCTGGG - Intronic
1130083902 15:80761407-80761429 CCCCAGCCTCACATGCAGCTGGG + Intergenic
1132793977 16:1709431-1709453 CAACAGCCAGTGATGGTGCTTGG - Intronic
1133264757 16:4576303-4576325 CAACAGACACGGCTGCAGCTGGG + Exonic
1133714312 16:8432280-8432302 CACCAGCCACAACTACAGCTTGG - Intergenic
1134271231 16:12735026-12735048 CAACAGGCAGAGAAGCAGCCGGG + Intronic
1135051032 16:19193161-19193183 CACCGGCCACTGAAGCAGCTGGG - Intronic
1135160209 16:20087665-20087687 CAACAGACAAAAATGCAGCTAGG - Intergenic
1138098238 16:54230643-54230665 CAAAAGCCACAGAGCCAGCTGGG + Intergenic
1141280017 16:82622940-82622962 CAAAGGGCACAGATGCAGGTTGG + Intergenic
1142799976 17:2338537-2338559 CAACAGCCACAGAGGCAGGCAGG - Intronic
1143021158 17:3917843-3917865 CAATGGCCACAGGGGCAGCTGGG - Intergenic
1143358191 17:6346677-6346699 CAACAGGCACTGCGGCAGCTTGG - Intergenic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1143510437 17:7392810-7392832 CCACAGCCACAGGTCCAGCAGGG + Exonic
1143740829 17:8952886-8952908 TAACGGCCACAGTTGCAACTTGG - Intronic
1143970246 17:10790104-10790126 CAACACACACAGACTCAGCTTGG - Intergenic
1146059278 17:29596055-29596077 CAGCCGCCACAGAAACAGCTCGG + Intronic
1146309722 17:31758157-31758179 CAATAGCTACAAATGCAGGTAGG + Intergenic
1151517131 17:74603880-74603902 CAACAGACGCAGCTGCACCTGGG + Intergenic
1151607531 17:75148459-75148481 CAACAGCCACAGATGCAGCTTGG - Intronic
1151870787 17:76835139-76835161 CAAGAGCCGCGGAGGCAGCTTGG - Intergenic
1151891653 17:76954491-76954513 AATCTGCCAAAGATGCAGCTTGG + Intergenic
1152143073 17:78549938-78549960 GAACAGCCACAGAGGAGGCTGGG + Intronic
1152254065 17:79227276-79227298 GAACATCCACAGAGGCAGGTTGG + Intronic
1153472982 18:5467910-5467932 CCAAATCCACAGCTGCAGCTGGG - Intronic
1153923142 18:9808845-9808867 CAACAAGCACAGCTCCAGCTGGG - Intronic
1155158952 18:23180373-23180395 CAACAGCTTAAGATGCTGCTAGG + Intronic
1155423012 18:25675964-25675986 CAACAACAACAGATTCAACTAGG + Intergenic
1155816882 18:30323362-30323384 AAGTAGCTACAGATGCAGCTAGG - Intergenic
1158433637 18:57416696-57416718 CCACAGCCAGAGAACCAGCTGGG + Intergenic
1158772747 18:60541057-60541079 CCACAGCCACCCTTGCAGCTTGG - Intergenic
1158833257 18:61303379-61303401 CCACAGCCCCAGATGCACGTTGG - Intergenic
1159640627 18:70859444-70859466 CAACAGCCTGAGCTGCAACTTGG - Intergenic
1160053649 18:75459637-75459659 CATCAGCTTCAGATGGAGCTGGG + Intergenic
1160225283 18:77007078-77007100 CAACGGAGACAGAAGCAGCTGGG - Intronic
1160680437 19:409513-409535 CAACAGTAATAAATGCAGCTGGG + Intergenic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1161419221 19:4166877-4166899 CAACAACCACAAAATCAGCTGGG - Intronic
1161662524 19:5555731-5555753 CAAAAGCCACAGAAGCTGCAGGG - Intergenic
1163764813 19:19157550-19157572 CAAAACTCACTGATGCAGCTGGG + Intronic
1165844928 19:38812281-38812303 CAATAGCCAGAGATGAATCTGGG - Intronic
1165903943 19:39181987-39182009 CACCAGCATCTGATGCAGCTGGG - Intronic
1167292010 19:48629699-48629721 CTACAGGCACAGATGCACCCTGG + Exonic
1167383873 19:49153034-49153056 CCACACCCCAAGATGCAGCTTGG + Intronic
925452351 2:3980398-3980420 AAACAGCCATAGCTGCTGCTGGG + Intergenic
928410131 2:31048306-31048328 CAAAAGCCACAGAGCCAGCAGGG - Intronic
929452503 2:42047216-42047238 CTAAAGCCCCAAATGCAGCTGGG - Intergenic
930769791 2:55119920-55119942 CACCAGCCTCAGATGCAGGAGGG + Intergenic
934161378 2:89252833-89252855 TAACAGCCACAGATGGCGCTGGG + Intergenic
934205902 2:89929582-89929604 TAACAGCCACAGATGGCGCTGGG - Intergenic
935329974 2:101969730-101969752 CAAAGGCCACAGGTACAGCTTGG - Intergenic
935562953 2:104577444-104577466 CAACCTCCCCAGATGTAGCTAGG + Intergenic
937540323 2:122942782-122942804 CAACAACCACAGAGGCAGGGAGG + Intergenic
938842275 2:135174847-135174869 CCACAGCCACAGAGGAGGCTGGG - Intronic
939275860 2:139994892-139994914 CAACAGGCAGAGATGAAGGTCGG - Intergenic
941638273 2:167960078-167960100 CAACAGCAGCAGATGCAGGAAGG + Intronic
941664047 2:168226122-168226144 AAACAGCCAGAGAAGCAGGTGGG + Intronic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
944399554 2:199309545-199309567 CAACAGCCACACCTGCAGGAAGG + Intronic
945181078 2:207091841-207091863 CAACAGCCACAGCTTGATCTTGG + Intronic
948467778 2:238160358-238160380 CACAGGCCACAGGTGCAGCTGGG + Intronic
1168994901 20:2125801-2125823 CAGGAGCCACATATGCAGCCAGG + Intronic
1169548900 20:6681008-6681030 CAAAAGCCTCAGCTGCAGCCTGG - Intergenic
1170304950 20:14928196-14928218 CATCAGCTCCAGAGGCAGCTTGG + Intronic
1171839558 20:30193820-30193842 CTACAGCTACAGCTGCAGTTTGG - Intergenic
1172655092 20:36532003-36532025 GATCAGCCACAGATTCAGATGGG - Intergenic
1172847810 20:37940306-37940328 CCACAGCCAGAGGGGCAGCTGGG + Intronic
1173541337 20:43854034-43854056 CAGCAGCCGCAGATGCAGGACGG - Intergenic
1176582448 21:8543734-8543756 CTACAGCTACAGCTGCAGTTTGG + Intergenic
1178871356 21:36379518-36379540 CAACAGACAAATATGCAGATAGG - Intronic
1179119174 21:38527291-38527313 CAGCAGCCTCAGCTGCAGCTGGG + Intronic
1180220328 21:46354552-46354574 CCACAGCCACACATACTGCTGGG - Intronic
1180265280 22:10520782-10520804 CTACAGCTACAGCTGCAGTTTGG + Intergenic
1181568034 22:23751453-23751475 CAGAAGCCACTGAGGCAGCTGGG + Intergenic
1182711782 22:32327796-32327818 CCACGGACACAGATGCAGCAAGG + Intergenic
1182797785 22:33003962-33003984 CAACAGCCTCAGCTGTACCTTGG - Intronic
1183243483 22:36675581-36675603 CAACAGCCACAGAGCCTGCTGGG + Intronic
1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG + Intronic
1185216285 22:49601725-49601747 CAACATCCACAGTGGCCGCTGGG + Intronic
953439777 3:42907380-42907402 CACCAGCCACAGAGGCAGCTAGG - Intronic
953460002 3:43074366-43074388 CAAGAACCACAAATGGAGCTGGG - Intergenic
957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG + Intergenic
957609471 3:82448944-82448966 CAACAGCCAGAGCTGTACCTTGG - Intergenic
958042588 3:88244657-88244679 CAACAGCCCAAGCTGCACCTTGG - Intergenic
958467202 3:94472757-94472779 CAACAGCCACAGGTGCACACAGG - Intergenic
959156189 3:102668663-102668685 TAACAGCCAACAATGCAGCTGGG - Intergenic
959202949 3:103271654-103271676 CAACAGCCTGAGTTGCACCTTGG + Intergenic
960244064 3:115380333-115380355 CAAGGGCCACAGATATAGCTTGG - Intergenic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
962675074 3:137750211-137750233 CAACAGCCACAGGAGTGGCTTGG + Intergenic
964341991 3:155717596-155717618 AAAGAGCCTCAGATACAGCTTGG - Intronic
964638694 3:158885611-158885633 CAAGGGCCACAGGTACAGCTTGG + Intergenic
966268559 3:178076909-178076931 CAACAGCAACAGTTGTAGTTTGG - Intergenic
967126734 3:186430734-186430756 CAGCAGCAACTGAAGCAGCTGGG - Intergenic
967658937 3:192081693-192081715 CAACAGGTAGGGATGCAGCTAGG + Intergenic
970600340 4:17636905-17636927 CAAGAGCCAGGGATGCTGCTGGG + Intronic
972678348 4:41281916-41281938 CCACAGCCACACAAGTAGCTGGG + Intergenic
974140180 4:57876417-57876439 GAACAGCCTCAGATACAGATTGG + Intergenic
974573694 4:63689027-63689049 CAACAGCCCCAGCTGTACCTTGG - Intergenic
974742264 4:66021946-66021968 CAACAGCCAGAGATGTACATTGG + Intergenic
974811938 4:66956595-66956617 CACCAGCCCCAAAAGCAGCTGGG - Intergenic
976331377 4:83834713-83834735 CTTTAGCCACAGATGCATCTTGG + Intergenic
980383533 4:132058219-132058241 CAACAGCCCCAGCTGCACCTTGG - Intergenic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
981126956 4:141118261-141118283 CAGCAGCCTCAAATGCAGGTGGG - Intronic
981748944 4:148075082-148075104 TAGCAGCCACACATGCAGTTGGG + Intergenic
983379097 4:166968514-166968536 CAACAGCCTGAGCTGCACCTTGG - Intronic
983540801 4:168907549-168907571 CATCAGCCACACATGAAGCTGGG + Intronic
987115717 5:14725180-14725202 CAACAGACAGAGACACAGCTGGG - Intronic
990342661 5:54839055-54839077 CAACAGCCTCATCTGCAGCTGGG + Intergenic
991688273 5:69201741-69201763 CCTCAGCCTCAGAAGCAGCTGGG - Intronic
992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG + Intronic
994150327 5:96440384-96440406 AAACAGCTACAGCTGCAGCGTGG - Intergenic
997249130 5:132375397-132375419 CAACAGTCAGACATGCTGCTAGG - Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999132968 5:149298801-149298823 CACCAGCATCAGCTGCAGCTTGG + Intronic
999348388 5:150844483-150844505 TAGCAGCCACAGATGAAGCCTGG + Intergenic
1000965053 5:167646611-167646633 CAAGAGACACAAATTCAGCTAGG + Intronic
1002900697 6:1407528-1407550 CAACAGTGACAGAGGCAGCTTGG - Intergenic
1002951549 6:1817692-1817714 CAATAGCTCCAGATGAAGCTGGG + Intronic
1003001867 6:2343278-2343300 CATCAGCCACGTAAGCAGCTAGG - Intergenic
1003035475 6:2637433-2637455 CCACAGCCTCAGGGGCAGCTTGG + Intergenic
1004859112 6:19782935-19782957 CATGTGCCACAGATGCAGCCGGG - Intergenic
1005633919 6:27735216-27735238 CATGAGCCACAGAGCCAGCTGGG + Intergenic
1006009770 6:31032527-31032549 CAGCAGCCACAACTGCAGCCAGG - Exonic
1006353880 6:33542066-33542088 CATCAGCCTCAGAGGTAGCTAGG - Intergenic
1007415915 6:41691077-41691099 CAGCAGCAACAGCAGCAGCTCGG - Exonic
1007984855 6:46197487-46197509 CAACAGCCTCAGTTGTACCTTGG + Intergenic
1012263556 6:97114469-97114491 CATCAGCCACATATCCAGCATGG - Exonic
1015092873 6:129379755-129379777 CAAGAGCTACAGTTGAAGCTTGG - Intronic
1016126298 6:140408364-140408386 CAACAGCCTGAGCTGTAGCTTGG - Intergenic
1019267665 7:127458-127480 CAACATCCACAGATTCAGCAGGG - Intergenic
1019417674 7:934788-934810 CACCAGCCACAGATGCTTCGTGG - Intronic
1019747936 7:2710928-2710950 TAACAGGCACAGGGGCAGCTTGG + Intronic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1023822930 7:43990132-43990154 CAACAGCAACACTAGCAGCTGGG + Intergenic
1024145544 7:46513003-46513025 CAGCAGCAGCAGATGCAACTGGG + Intergenic
1024415979 7:49107714-49107736 CAACAGCCTGAGCTGCACCTTGG - Intergenic
1025288091 7:57685263-57685285 CTACAGCTACAGCTGCAGTTAGG - Intergenic
1029513492 7:101011367-101011389 CAATAGCCAATGATGCAGCTGGG - Intronic
1029751194 7:102543562-102543584 CAACAGCGACACTAGCAGCTGGG + Intronic
1029769146 7:102642667-102642689 CAACAGCGACACTAGCAGCTGGG + Exonic
1030193945 7:106835031-106835053 CAAGAGCCTGAGAAGCAGCTTGG - Intergenic
1032274191 7:130440410-130440432 AAACTGCCACAAATGCAGCAGGG + Intronic
1033539897 7:142346910-142346932 CATCAGACACACATGCAGCTGGG + Intergenic
1035053767 7:156020022-156020044 TAACAGGCACAGAGGCAGGTAGG + Intergenic
1035451345 7:158979129-158979151 CTACAGCTGCAGATGGAGCTGGG + Intergenic
1035929740 8:3766935-3766957 CGACGGCAACAGATGCAGCACGG + Intronic
1038906208 8:31906199-31906221 CAACAGCCACACAGTGAGCTTGG - Intronic
1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG + Intergenic
1041719087 8:60960273-60960295 TACCAGCAACAGAGGCAGCTGGG - Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044040121 8:87356980-87357002 AAACAGCCCCAGATACAGCATGG + Intronic
1044051804 8:87515120-87515142 CAACAGCCAGAGCTGTACCTTGG - Intronic
1045527185 8:102951025-102951047 AAACAGCCACAGTGGGAGCTGGG + Intronic
1046601734 8:116325052-116325074 CCACAGCCACAGATTCTGCCTGG + Intergenic
1049251246 8:141590328-141590350 CAACCTCAACAGATGCATCTGGG + Intergenic
1050917997 9:11161908-11161930 AAACAGCCCCAGATGTGGCTTGG + Intergenic
1051525465 9:18038266-18038288 CAACAGCCAAAAATGCCACTTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057383546 9:94589229-94589251 CAACAGCCGCAGATGTCCCTGGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059334725 9:113561827-113561849 CAACAGCCTGGGATGCAGCCAGG - Intronic
1060195384 9:121620260-121620282 AAACAGCCACACCTCCAGCTGGG - Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1061446067 9:130638838-130638860 CCACAGCCACAGGTGAGGCTGGG - Intergenic
1203612463 Un_KI270749v1:21748-21770 CTACAGCTACAGCTGCAGTTTGG + Intergenic
1185636391 X:1555019-1555041 CAACAGCCAGAGAGACAACTGGG - Intergenic
1188844846 X:35059891-35059913 CCCAAGCCACAGCTGCAGCTAGG + Intergenic
1189468806 X:41298418-41298440 CAACAGCCACTGGAGCAGTTAGG - Intergenic
1190928403 X:54928665-54928687 CCACAGCCACAGCTGCAGCTTGG - Exonic
1190950599 X:55139612-55139634 CAACAGCCTGAGATGTACCTTGG - Intronic
1191225742 X:58040913-58040935 CAACAGCAACAGTAGCAGCATGG - Intergenic
1192539894 X:71958893-71958915 CAACTGCCAAGGATGCAGATAGG + Intergenic
1193407264 X:81117368-81117390 CAACAGCCTCCCAAGCAGCTGGG + Intronic
1193543042 X:82794840-82794862 CAACAGCCTGAGATGTACCTTGG - Intergenic
1193547506 X:82847782-82847804 CAACAGCCTCACAAGTAGCTGGG - Intergenic
1194323465 X:92480932-92480954 CAGCAGCGACAGAGGCAGCATGG + Intronic
1196193255 X:112815539-112815561 CAGCAGCCACAGCAGCAGCCAGG - Exonic
1199083699 X:143605866-143605888 CAACAGCCCAAGCTGCAACTTGG - Intergenic
1199557066 X:149120995-149121017 CAAAAGCTACGGATGAAGCTGGG - Intergenic
1199689860 X:150300890-150300912 CAACAGCCACACTAGAAGCTAGG - Intergenic
1199814376 X:151384937-151384959 CAGCTGGCACAGAGGCAGCTAGG - Intergenic
1200235422 X:154465716-154465738 CACCAGCCACAGTTGAAGCGGGG - Exonic
1200631566 Y:5594098-5594120 CAGCAGCGACAGAGGCAGCATGG + Intronic
1201070618 Y:10144586-10144608 GCACAGCCAGAGATGGAGCTTGG - Intergenic
1201313212 Y:12616389-12616411 GAACAGCCAAGGATGCTGCTGGG - Intergenic