ID: 1151612088

View in Genome Browser
Species Human (GRCh38)
Location 17:75182798-75182820
Sequence GCCCAAGGTGAGCTCGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151612088_1151612092 3 Left 1151612088 17:75182798-75182820 CCGGCGGCGAGCTCACCTTGGGC 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1151612092 17:75182824-75182846 TCGTCGGCCATGGCGAGCGCCGG No data
1151612088_1151612091 -7 Left 1151612088 17:75182798-75182820 CCGGCGGCGAGCTCACCTTGGGC 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1151612091 17:75182814-75182836 CTTGGGCTTTTCGTCGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151612088 Original CRISPR GCCCAAGGTGAGCTCGCCGC CGG (reversed) Intergenic
901425834 1:9182160-9182182 GCCCAGGCAGAGCCCGCCGCCGG + Intergenic
902854483 1:19190935-19190957 GCCCTAGGTGATCTGGCCACTGG + Intronic
911574834 1:99563020-99563042 GGCCAAGGTGAGGTCACTGCTGG + Intergenic
912333963 1:108845488-108845510 GCCAAAGGGGAGCTCCCCACGGG + Intronic
915147408 1:153803211-153803233 GCCCAAGCTGAGCTCTGCCCAGG + Intergenic
1069698295 10:70404081-70404103 GCCGGAGGTGACGTCGCCGCGGG - Intergenic
1073124125 10:101139438-101139460 GCCCAACCTGAGCACTCCGCGGG - Intergenic
1073250982 10:102120203-102120225 GCCCCCGCTGCGCTCGCCGCCGG + Exonic
1076024702 10:127101692-127101714 GCCCAAGGGGAGCCAGCAGCAGG + Intronic
1076817512 10:132922088-132922110 GCCAAAGGTGAGCTCTGCACTGG - Exonic
1077055045 11:587458-587480 GTCCAAGGTGAGTTCACCTCTGG + Exonic
1077074884 11:695836-695858 GCCCGAGCTCACCTCGCCGCGGG - Exonic
1077247642 11:1547228-1547250 GCCCAACCTGCGCGCGCCGCGGG - Intergenic
1081574151 11:44309074-44309096 GCCGCAGGTGAGAGCGCCGCAGG - Intronic
1081602731 11:44506448-44506470 GCCCAAGGTGGGCTAGGAGCAGG + Intergenic
1083800027 11:65041297-65041319 GCCCACGGGCAGCTCGCAGCCGG - Exonic
1084366943 11:68707941-68707963 GACCAGAGTGAGCTCTCCGCAGG + Exonic
1084627443 11:70319275-70319297 GACCAGGGTGGGCTCACCGCAGG - Intronic
1084705992 11:70816288-70816310 GCCCAAGGTCAGCTGGCGGGTGG + Intronic
1085533015 11:77202834-77202856 GCCCGTGGTGTTCTCGCCGCTGG + Intronic
1089059311 11:115613285-115613307 GCCCTAGGTGAGCTGACCTCTGG + Intergenic
1091448197 12:556799-556821 GCCCAAGCTGTGCTGGCCTCAGG + Exonic
1093087680 12:14884797-14884819 GCCCAGGGTGAGCTGTCAGCTGG - Exonic
1100254056 12:92863484-92863506 GCCCCAGATGAGCTCCCAGCTGG + Intronic
1101998888 12:109544406-109544428 GCCAAAGGTGAGCAGGCCTCTGG + Intergenic
1103325238 12:120116268-120116290 GCCCAAGGTCAGCGCGAGGCAGG + Intronic
1106776584 13:33015996-33016018 GCCCTAGCGGAGCGCGCCGCTGG - Intergenic
1113544792 13:111139840-111139862 GCCCATGGGCAGCTGGCCGCAGG + Intronic
1113908268 13:113830363-113830385 CCCCCAGGTGACCTCGCCTCAGG + Intronic
1113908323 13:113830513-113830535 CCCCCAGGTGACCTCGCCTCAGG + Intronic
1113908351 13:113830588-113830610 CCCCCAGGTGACCTCGCCTCAGG + Intronic
1122402796 14:101477156-101477178 GCCCAAGGTGAGCTCTGCTGAGG - Intergenic
1125550150 15:40538947-40538969 GCCACAGGTGGGCTCACCGCAGG + Intronic
1127142726 15:55993745-55993767 GCCCCAGGAGCGCGCGCCGCCGG - Intronic
1132460800 16:53651-53673 GACCAATGTGAGCTCGAGGCGGG - Intronic
1132987726 16:2776822-2776844 GCGCGAGCTGCGCTCGCCGCGGG - Intronic
1135139228 16:19907566-19907588 GCCCGTGGTGAGCTTCCCGCAGG + Intergenic
1139938871 16:70590724-70590746 GCCCAAGGTTAGCCAGCAGCTGG + Intronic
1141644447 16:85359763-85359785 GCCGAGGGTGAGTTCGGCGCGGG - Intergenic
1143145663 17:4773529-4773551 GACCAAGGGGAGCTCTCCCCTGG - Intronic
1146399919 17:32494313-32494335 GCCCAAGGTGAGCCAGCCCTGGG - Exonic
1147561905 17:41514467-41514489 GCCCCAGGTGAGATTGCAGCTGG - Intronic
1147869630 17:43578309-43578331 CCCCAAGGTGGGCTGGCAGCCGG - Intronic
1148562562 17:48614265-48614287 CCGCAAGGTGAGCTCGCCTCGGG - Exonic
1151612088 17:75182798-75182820 GCCCAAGGTGAGCTCGCCGCCGG - Intergenic
1156451598 18:37269536-37269558 GCCCAAGGTGAATTGGCAGCAGG - Intronic
1157553087 18:48594730-48594752 GCCCAATCTGAGCTCCCCACAGG + Intronic
1160861236 19:1237979-1238001 GCCCCCGCTGCGCTCGCCGCTGG + Exonic
1160894334 19:1395640-1395662 GCCCAAGGGCGGCACGCCGCAGG - Intergenic
1161857252 19:6773005-6773027 GTCCCAGGTGAGCCCTCCGCGGG + Exonic
1161944881 19:7429258-7429280 GCCCAGGCTGAGATCGCCGTGGG - Intronic
1163463778 19:17454903-17454925 GCCCCAGGTGGGCAGGCCGCGGG - Intronic
1163648264 19:18502446-18502468 GACTAAGGTGAGCTCACTGCTGG - Intronic
1163714433 19:18865772-18865794 GTCCCAGGTGAGCCCGCCCCTGG + Exonic
1165307223 19:35010189-35010211 GACCACGGTGAGCCCGCAGCGGG + Exonic
926594884 2:14779416-14779438 GCCCAAGGTCAGCAGGCCCCAGG + Intergenic
931861797 2:66362499-66362521 CCCCAAGGTGAGCTTGCCCAGGG - Intergenic
936616768 2:114056019-114056041 GCCTAAGGTCAGCTTGCAGCTGG - Intergenic
937087225 2:119179428-119179450 TCCCAGGGTGAGCTTGCCACAGG + Intergenic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
947875500 2:233464898-233464920 GCCCAAGATGAGCTTTCCTCAGG - Intronic
948577991 2:238966389-238966411 GACCCAGGTGAGTTCGTCGCAGG + Intergenic
1173659747 20:44724986-44725008 GCCCAAGGTGAGCGCAGCGGTGG + Exonic
1178660358 21:34502573-34502595 GCCCAAGGTGAGCTCCATCCAGG - Intergenic
1179560723 21:42214526-42214548 GCCCAAGGCAAGCTCGCCACAGG + Intronic
1183991152 22:41597794-41597816 GCCCAAGGTCACCTTGCAGCTGG - Intergenic
1184131510 22:42519493-42519515 GACCAAGTTGGGCTCGCCCCGGG + Intronic
1184141733 22:42581709-42581731 GACCAAGTTGGGCTCGCCCCGGG + Intergenic
950184234 3:10935193-10935215 GCCCGAGGTGAGACCGCCCCAGG + Exonic
953970591 3:47344041-47344063 GCGAAACGTGAGCTCGCCGGAGG + Exonic
956742092 3:72283123-72283145 GCCCCAGCTGAGCTCACAGCTGG + Intergenic
956867577 3:73384724-73384746 GCCCAAGGTGTCCTGGCTGCAGG + Exonic
959410035 3:106009602-106009624 GCCCAAGTTCAGCTCCCAGCAGG + Intergenic
969640764 4:8397152-8397174 GCCCAAGGTGGCCGCGCAGCCGG - Intronic
973218871 4:47703155-47703177 GCCCTAGGTCAGCACTCCGCTGG + Intronic
978636051 4:110808705-110808727 GCCCAAGGTGAGCCAGTCACTGG - Intergenic
984650033 4:182261353-182261375 GCCCAAGGTGAACTCTCTGAAGG - Intronic
1003604018 6:7542795-7542817 GCCCCAGGTGCGCTCGCCCGCGG - Intronic
1015024821 6:128520258-128520280 GCCCAAGGCCAGTTCTCCGCAGG - Exonic
1017146589 6:151240607-151240629 GCCCGAGGGGAGCTCCACGCCGG + Exonic
1018793704 6:167170100-167170122 GCCCCAGGTGTGCTCTCCACAGG + Intronic
1018822629 6:167384981-167385003 GCCCCAGGTGTGCTCTCCACAGG - Intergenic
1019523602 7:1471117-1471139 GCCCCAGGTGAGGCCACCGCCGG - Exonic
1023602514 7:41893693-41893715 GTCCAAGGTCAGCTTGCCGGCGG - Intergenic
1029976416 7:104839066-104839088 TCCCAAGGGGAGCTCCCTGCAGG + Intronic
1032784380 7:135188779-135188801 TCCCCAGGTGAGCTCCCCCCAGG - Intronic
1035966618 8:4199082-4199104 GCTCAGGGTGAGCTGGGCGCTGG - Intronic
1036774313 8:11599639-11599661 GCGCCAGGTAAGCTCGCAGCAGG - Intergenic
1039515939 8:38133672-38133694 GCAGAGGGTGAGCTTGCCGCTGG - Intronic
1049471580 8:142777280-142777302 GCCCAGCGCGAGCTCACCGCAGG + Intronic
1049831729 8:144705183-144705205 GCCCCAGGTGAGCTGGCCTTTGG + Intergenic
1055404620 9:75961951-75961973 GCCCATGGTGAGCACAGCGCCGG - Intronic
1059251847 9:112892782-112892804 GCCCCAGGTGAGCTAGCACCTGG + Intergenic
1060218782 9:121753712-121753734 GCACAAGGTGAGCGCCCAGCTGG - Intronic
1060660527 9:125402592-125402614 GCCCAAGGTGAGGGCTCAGCAGG - Intergenic
1061596182 9:131630730-131630752 TCCCAAGGCGAGCTGGCCACAGG + Intronic
1189944945 X:46168506-46168528 GCCATAGCTGAGCTCCCCGCTGG - Intergenic
1200217584 X:154374823-154374845 CCCCGAGATGAGCTCACCGCCGG + Intergenic
1200253726 X:154568192-154568214 GCCCTAGGTGAGCGCTCTGCTGG + Intergenic
1200264043 X:154636216-154636238 GCCCTAGGTGAGCGCTCTGCTGG - Intergenic