ID: 1151612144

View in Genome Browser
Species Human (GRCh38)
Location 17:75183083-75183105
Sequence GTCCCACGCCACCGCGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151612132_1151612144 21 Left 1151612132 17:75183039-75183061 CCTCGCGGGAGCGCGCAACGCTT No data
Right 1151612144 17:75183083-75183105 GTCCCACGCCACCGCGTCCTGGG No data
1151612133_1151612144 -8 Left 1151612133 17:75183068-75183090 CCACCCCCACCCCCCGTCCCACG No data
Right 1151612144 17:75183083-75183105 GTCCCACGCCACCGCGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151612144 Original CRISPR GTCCCACGCCACCGCGTCCT GGG Intergenic
No off target data available for this crispr