ID: 1151617974

View in Genome Browser
Species Human (GRCh38)
Location 17:75226813-75226835
Sequence TCCATTAGGTGCCAAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 4, 3: 5, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151617974_1151617978 -8 Left 1151617974 17:75226813-75226835 CCTGTTTCTTGGCACCTAATGGA 0: 1
1: 0
2: 4
3: 5
4: 129
Right 1151617978 17:75226828-75226850 CTAATGGACACCTTATGGGATGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151617974 Original CRISPR TCCATTAGGTGCCAAGAAAC AGG (reversed) Intronic
904083118 1:27884572-27884594 TCCACTGGGAGCCAAGACACGGG - Intronic
909964508 1:81890949-81890971 ACCCTGAGGTACCAAGAAACGGG - Intronic
916762810 1:167832601-167832623 TCCATTAGGTGCTAAGACACTGG - Intronic
916930854 1:169576692-169576714 TCCATCAGGAGCCAAGACAGAGG - Intronic
920323842 1:205145834-205145856 TCCATTAGATTCCGAAAAACAGG - Exonic
920668738 1:207986539-207986561 TCCTTTAGGTGCACAGAAATGGG + Intergenic
921301120 1:213752548-213752570 TCCATAAGATGCCAAGAACTAGG + Intergenic
921699063 1:218246569-218246591 TGCATTAGGTACCAAGAAGGTGG - Intergenic
923412232 1:233721963-233721985 TCCCTTATCTGCCCAGAAACCGG - Intergenic
923866525 1:237945609-237945631 CCCATGAGGTGGCAAGAAATGGG - Intergenic
923937040 1:238773822-238773844 TCCATTATTTACCTAGAAACAGG + Intergenic
924250178 1:242124979-242125001 TCAATCAGGTGGCAAGAAAAAGG + Intronic
1067760670 10:49043503-49043525 TCCACTAGGTGCAGAGAAATAGG - Intronic
1068303370 10:55175052-55175074 TCCATATAGTGCCAAGAAAGGGG + Intronic
1071979271 10:90987237-90987259 TCCATCAGGTGACAAGATGCTGG - Intergenic
1075117017 10:119635478-119635500 TCCAAAAGGTGTCAAAAAACTGG - Intergenic
1075859214 10:125660454-125660476 TACATTAAGTACAAAGAAACAGG - Intronic
1075881548 10:125856480-125856502 TCAATTAAGTGCCAAGACACAGG + Intronic
1078083181 11:8218407-8218429 TCCTTAAAATGCCAAGAAACTGG - Intergenic
1078342571 11:10509497-10509519 CCCATGAGGTGGCAAGAAATGGG - Intergenic
1081730216 11:45366629-45366651 TCCATGTGGTGCCAGGAAAGAGG - Intergenic
1086828689 11:91533055-91533077 TCCCTTAATTACCAAGAAACTGG - Intergenic
1089504312 11:118953485-118953507 ACCATTAGTTGCTAAGCAACTGG - Intronic
1091195318 11:133725942-133725964 TCCATCAGCTGTCAAGGAACAGG - Intergenic
1091682553 12:2537539-2537561 GCCATTAGGTGTCATGGAACCGG + Intronic
1104643595 12:130482322-130482344 CCTACTAGGTGCCAAGAAGCTGG + Intronic
1113644866 13:111987357-111987379 TGCATTAGGTGCCAAGCAGAGGG + Intergenic
1113684325 13:112271578-112271600 TCCATTTGGTGCCTGGAAAAAGG + Intergenic
1114707992 14:24746842-24746864 TCACCTAGGTTCCAAGAAACTGG - Intergenic
1114752773 14:25224271-25224293 TACATTAGGGGCCCAGAAACAGG + Intergenic
1114802369 14:25792052-25792074 TCAATTAGCTGCCAAGATGCAGG + Intergenic
1117622906 14:57606258-57606280 TCTTTTAGGTGGCAAGATACTGG + Intronic
1202828476 14_GL000009v2_random:2209-2231 CCCATGAGGTGGCAAGAAATAGG + Intergenic
1124951474 15:34325782-34325804 CCCACTAAGTGCCAAGAAATAGG + Intronic
1130059412 15:80558932-80558954 TCCATTCTGTGCCCAGTAACTGG + Intronic
1130267829 15:82424450-82424472 ACCAGTAGGTGCAAAGACACAGG + Intergenic
1130504196 15:84522384-84522406 ACCAGTAGGTGCAAAGACACAGG - Intergenic
1133505967 16:6412708-6412730 TCCATTAGCAGCCACAAAACTGG - Intronic
1135038938 16:19102715-19102737 GCAATTTGGTGCCAATAAACTGG - Intergenic
1136625724 16:31461116-31461138 TCCATTGTGTGCCCAGAGACTGG + Intronic
1141131376 16:81439549-81439571 TCAATTCGGTGCTAATAAACAGG + Intergenic
1141131517 16:81440881-81440903 TCAAATAGGTGCTAATAAACAGG - Intergenic
1141283852 16:82653251-82653273 TCCATGAGTTGCCACGTAACTGG - Intronic
1141379964 16:83567303-83567325 CCCACTATGTGCCAAGAACCAGG - Intronic
1144307490 17:13982536-13982558 TCCATTAGGTGACTAGAAACAGG - Intergenic
1144459826 17:15449378-15449400 ACAATTAGGTGACAAAAAACAGG + Intronic
1146569678 17:33941607-33941629 TCCACTGGGGGCAAAGAAACTGG + Intronic
1148256027 17:46133030-46133052 TCCATTATATGCCAAGTACCAGG + Intronic
1148535395 17:48434262-48434284 TCCTGTCGGTGCCAAGAACCAGG + Intergenic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1150183728 17:63157127-63157149 TCCCTTATCTGCCTAGAAACTGG - Intronic
1151617974 17:75226813-75226835 TCCATTAGGTGCCAAGAAACAGG - Intronic
1155016579 18:21846999-21847021 ACCATTGGCTGCCAAGAAACAGG - Exonic
1155078868 18:22387911-22387933 CCCATTATGTGCCAAGGAAGGGG - Intergenic
1157208230 18:45718773-45718795 TCCATTAGTTGACATGAAACTGG - Intergenic
1157932871 18:51842411-51842433 TCTTTTAAATGCCAAGAAACAGG + Intergenic
1158388503 18:57022159-57022181 TCCATTAGGTGTCCAGAAACTGG + Intronic
1158666211 18:59434946-59434968 ACCATTAGGTGCCATGATCCAGG - Exonic
1159967166 18:74606357-74606379 TCCATTATGTCATAAGAAACTGG - Intronic
1163289536 19:16370389-16370411 TCCCTCAGGTGCCAAGCAAGGGG + Intronic
1163361860 19:16851775-16851797 TGCCCTAGGTCCCAAGAAACAGG + Intronic
1166854183 19:45774869-45774891 TCCATTGGCTGCCAAGGAGCAGG + Intronic
1202644220 1_KI270706v1_random:125611-125633 CCCATAAGGTGGCAAGAAATGGG - Intergenic
928920645 2:36523270-36523292 TCCATTAAGTGCCAGAAGACAGG - Intronic
931089541 2:58870730-58870752 TCCATCAGATGCAAAGAACCTGG - Intergenic
933258938 2:80110256-80110278 TCTATTAGGTTTCCAGAAACTGG + Intronic
934506592 2:94899157-94899179 CCCATGAGGTGGCAAGAAATGGG - Intergenic
936861140 2:117021947-117021969 CCCATAAGGTGGCAAGAAATGGG + Intergenic
939283344 2:140094412-140094434 TCAATTAGGATCCAAGAAAATGG + Intergenic
942686147 2:178534184-178534206 TGCATTATCTGCCCAGAAACTGG + Exonic
943236204 2:185323420-185323442 TCCATTATATGCCAACAAATTGG + Intergenic
946784537 2:223228595-223228617 TCCCTTAGGTGACAAGAGAAAGG + Intergenic
1169489332 20:6057788-6057810 TCCATTAAGTGGCAAGGAAGAGG + Intergenic
1169891991 20:10463351-10463373 TCTATTATCTGCCCAGAAACTGG - Intronic
1170465246 20:16616997-16617019 TCCATGAGGGTCCAAGAACCAGG - Intergenic
1175020139 20:55837459-55837481 ACCATTATGTGCCAACAAATTGG - Intergenic
1175211507 20:57360303-57360325 CCCATGAGGTGGCAAGAAATGGG - Intronic
1176607658 21:8847037-8847059 CCCATGAGGTGGCAAGAAATAGG + Intergenic
1178440517 21:32594429-32594451 GACACTTGGTGCCAAGAAACAGG - Intronic
1180357742 22:11856828-11856850 CCCATGAGGTGGCAAGAAATGGG + Intergenic
1180380523 22:12135505-12135527 CCCATGAGGTGGCAAGAAATGGG - Intergenic
1182649716 22:31841390-31841412 TCTTTGAGGTGCCAAGAACCTGG - Intronic
1183972226 22:41486224-41486246 TCTATTATGTGCCAAGCAATAGG - Intronic
953203276 3:40797248-40797270 TCCATTATGTGCCCTGTAACTGG - Intergenic
953794431 3:45973505-45973527 TCAATTATTTGCCAAGAAAGGGG + Intronic
955607473 3:60721151-60721173 TCCATCAGGCACCAAGAAATAGG + Intronic
961317724 3:126051967-126051989 TCCATAAGCTGCCCAGCAACAGG + Intronic
962039615 3:131692353-131692375 TCTATTATGTGCCAAGTATCAGG - Intronic
963750753 3:149177128-149177150 TCAGTTAGGTGACAAGCAACTGG - Intronic
968424545 4:513597-513619 TCCACTAGGTGCCAGGTACCAGG - Intronic
969964208 4:10977442-10977464 GCAATTTGGTGCCAAGAAAATGG - Intergenic
970359620 4:15295811-15295833 TCTATTATGTGCCAGGCAACTGG - Intergenic
971860208 4:32091957-32091979 TTCATTAGGTGCCAAAAATTGGG - Intergenic
988350516 5:30100059-30100081 TCGATTAGCTGCTAAGAAAGTGG + Intergenic
990840231 5:60070952-60070974 ACAATTATGTGCCAACAAACTGG - Intronic
991020880 5:61978745-61978767 TCCCTTTGGTGCCAACTAACTGG - Intergenic
997623147 5:135313630-135313652 TGTTTTAGGGGCCAAGAAACAGG - Intronic
1000045347 5:157517708-157517730 TCTATTATGTGCCAAGCACCTGG - Intronic
1000258943 5:159567588-159567610 TCCCTGAGGGACCAAGAAACTGG + Intergenic
1001037669 5:168309265-168309287 TCCAGTAGGTACCCAGAAATGGG - Intronic
1001378740 5:171287923-171287945 TCCATAAAGTTCTAAGAAACAGG - Intronic
1001905101 5:175465380-175465402 TCCAGTGGCTGCCAAGAAGCTGG + Intergenic
1004290376 6:14361608-14361630 TCCAATAGGTCCCAAGAAACAGG - Intergenic
1009276416 6:61687187-61687209 TGCATTATGTTCCAAGAAAAAGG + Intronic
1010961346 6:82149221-82149243 ACAATTAGATGCCAATAAACTGG + Intergenic
1012099706 6:95017037-95017059 TCCATTAGCTGTCAAGAGAAAGG + Intergenic
1012230074 6:96750778-96750800 TCCATTTGGTCCCTAGAATCTGG + Intergenic
1014443068 6:121495866-121495888 TCTTTTATGTGCCTAGAAACAGG + Intergenic
1015740510 6:136448824-136448846 TCTATCAGTTGCCAAGAAAGGGG + Intronic
1028692698 7:93671687-93671709 AACATCAGGTGCCAAGATACAGG - Intronic
1030884828 7:114923353-114923375 TCCTTTGGTTGCGAAGAAACAGG + Intronic
1032414526 7:131726039-131726061 TCCTTTAGGGGCCATTAAACAGG + Intergenic
1040590486 8:48788163-48788185 TCCCTGAGGTGCCCAGAAGCTGG - Intergenic
1041456735 8:58068504-58068526 TTAATTAGTAGCCAAGAAACAGG - Intronic
1047571872 8:126107941-126107963 ACGTTTATGTGCCAAGAAACAGG + Intergenic
1049676044 8:143889689-143889711 TCCCTTACCTGCCAAGAAAGAGG - Intergenic
1052218573 9:25995079-25995101 AACATTTGGTGCCAAGAACCCGG + Intergenic
1054354461 9:64048223-64048245 CCCATGAGGTGGCAAGAAATAGG + Intergenic
1056594641 9:87996829-87996851 TCCATTAGCTGCCAAGCTGCTGG + Intergenic
1058447402 9:105066131-105066153 TCCTTTAGGAGCCAGGAACCAGG + Intergenic
1202629043 M:1340-1362 CCCATGAGGTGGCAAGAAATGGG + Intergenic
1203742795 Un_GL000218v1:17350-17372 CCCATGAGGTGGCAAGAAATAGG + Intergenic
1203703001 Un_KI270742v1:11925-11947 CCCATGAGGTGGCAAGAAATGGG + Intergenic
1203567300 Un_KI270744v1:102082-102104 CCCATGAGGTGGCAAGAAATGGG - Intergenic
1188288094 X:28354213-28354235 TCCATTAACTTCCAAGAATCAGG - Intergenic
1189485719 X:41430143-41430165 CCCATCAGGTGCCAGGAGACAGG - Intergenic
1190954891 X:55183244-55183266 CCCATGAGGTGGCAAGAAATGGG - Intronic
1194987636 X:100507954-100507976 TTCATAAGGTGCCAGGAAATAGG - Intergenic
1195718977 X:107847697-107847719 TCTATTAGGTGGCAAGCACCCGG + Intronic
1197657585 X:129133819-129133841 TCCATTAAGTGCCAAGAGATAGG - Intergenic
1198389636 X:136161234-136161256 GCCAATAGGTGGCAAGAAGCAGG - Intronic
1199531557 X:148853643-148853665 TCAACTAGGAGTCAAGAAACAGG - Intronic
1200184002 X:154169970-154169992 TCCACTTGGTGACAAGGAACCGG - Intergenic
1200189656 X:154207098-154207120 TCCACTTGGTGACAAGGAACCGG - Intergenic
1200195409 X:154244907-154244929 TCCACTTGGTGACAAGGAACCGG - Intergenic
1200201061 X:154282028-154282050 TCCACTTGGTGACAAGGAACCGG - Intronic
1200373331 X:155751310-155751332 ACAATTAGATGCCAAGAAATTGG + Intergenic
1202324130 Y:23673245-23673267 TACTTTAGGTTCAAAGAAACAGG + Intergenic
1202546641 Y:25996809-25996831 TACTTTAGGTTCAAAGAAACAGG - Intergenic