ID: 1151620755

View in Genome Browser
Species Human (GRCh38)
Location 17:75243409-75243431
Sequence GAGGGCTGCCTGGAGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 810
Summary {0: 1, 1: 0, 2: 12, 3: 105, 4: 692}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151620749_1151620755 -8 Left 1151620749 17:75243394-75243416 CCTGGGCCAGCCTTCGAGGGCTG 0: 1
1: 0
2: 1
3: 25
4: 223
Right 1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG 0: 1
1: 0
2: 12
3: 105
4: 692
1151620746_1151620755 -3 Left 1151620746 17:75243389-75243411 CCTTGCCTGGGCCAGCCTTCGAG 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG 0: 1
1: 0
2: 12
3: 105
4: 692
1151620745_1151620755 5 Left 1151620745 17:75243381-75243403 CCTTCTCTCCTTGCCTGGGCCAG 0: 1
1: 0
2: 5
3: 90
4: 470
Right 1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG 0: 1
1: 0
2: 12
3: 105
4: 692
1151620741_1151620755 10 Left 1151620741 17:75243376-75243398 CCTTCCCTTCTCTCCTTGCCTGG 0: 1
1: 0
2: 5
3: 119
4: 1197
Right 1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG 0: 1
1: 0
2: 12
3: 105
4: 692
1151620744_1151620755 6 Left 1151620744 17:75243380-75243402 CCCTTCTCTCCTTGCCTGGGCCA 0: 1
1: 0
2: 1
3: 81
4: 489
Right 1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG 0: 1
1: 0
2: 12
3: 105
4: 692
1151620740_1151620755 15 Left 1151620740 17:75243371-75243393 CCAAACCTTCCCTTCTCTCCTTG 0: 1
1: 0
2: 6
3: 84
4: 833
Right 1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG 0: 1
1: 0
2: 12
3: 105
4: 692
1151620739_1151620755 16 Left 1151620739 17:75243370-75243392 CCCAAACCTTCCCTTCTCTCCTT 0: 1
1: 0
2: 9
3: 92
4: 882
Right 1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG 0: 1
1: 0
2: 12
3: 105
4: 692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151620755 Original CRISPR GAGGGCTGCCTGGAGGCTGC GGG Intronic
900096140 1:940893-940915 GCCGGGTGCCTGGAGGCTTCCGG - Intronic
900145717 1:1157981-1158003 GCGGGATGGCTGGAGGCTGGGGG - Intergenic
900152221 1:1183669-1183691 GAGGGCTGCCTGGAGGAGGAGGG - Intronic
900418059 1:2544044-2544066 GGGGACAGCCAGGAGGCTGCGGG - Intergenic
900432216 1:2607745-2607767 GTGGGCTGAGTGGGGGCTGCTGG + Intronic
900509959 1:3054104-3054126 TGAGGCTGCCTGGAGGCTGAGGG + Intergenic
900514933 1:3077189-3077211 ACGGGCCTCCTGGAGGCTGCTGG + Intronic
900526508 1:3131813-3131835 GAGAGCTGCCTGGAGACCCCAGG - Intronic
900555558 1:3278640-3278662 GAGGGCGGCCTTGTGGCTGCCGG - Intronic
900596476 1:3482363-3482385 GAGAACCGCCCGGAGGCTGCAGG - Intergenic
900600701 1:3501593-3501615 GAGGGCAGCCTGGAAGCCCCAGG + Intronic
900612358 1:3549501-3549523 GGGGGCTGCCTGGGGGCTTCTGG + Intronic
900622914 1:3595627-3595649 GGGGGCAGCATGGAGGCAGCAGG + Intronic
900793335 1:4693365-4693387 GAGGGCTTCCTGGAGGCAGGGGG + Intronic
900955219 1:5882630-5882652 GAGGACTGAGTGGACGCTGCAGG - Intronic
901602060 1:10430324-10430346 GGGGGCTGGCTGGAGGCCGACGG + Exonic
901914337 1:12486567-12486589 GAGAGCTGCCTGGTGGCCTCCGG - Intronic
901941171 1:12663070-12663092 AAGGGCTTCCAGGAGGCTGCAGG + Intronic
902501108 1:16912462-16912484 GCAGGCTGCCTGCAGGGTGCAGG + Intronic
903070136 1:20722980-20723002 GCAGGCTGCCTCGATGCTGCTGG - Intronic
903225145 1:21890398-21890420 AGGGGCTCCCTGGGGGCTGCTGG - Intronic
903293102 1:22326986-22327008 GAAGGCTTCCTGGAGGAGGCAGG - Intergenic
903332321 1:22602447-22602469 GAGAGCCGGGTGGAGGCTGCAGG - Exonic
903778199 1:25806450-25806472 AAGGGCAGCCTGGAGGATGCTGG + Intronic
904251029 1:29224395-29224417 CATTGCTCCCTGGAGGCTGCTGG + Intronic
904260844 1:29286838-29286860 GAGGGGTTCCTGGAGGCATCTGG - Intronic
904263622 1:29305268-29305290 GAGGGATTCCTGGAGGCTAGGGG - Intronic
904830532 1:33303703-33303725 GAGGGGTTCCAGGAAGCTGCAGG - Intergenic
905179141 1:36155987-36156009 GAGAGGCGCCGGGAGGCTGCGGG + Intronic
905239080 1:36570943-36570965 GACTGTGGCCTGGAGGCTGCAGG + Intergenic
905626293 1:39492181-39492203 GCGGGCAGCCGGGAGGCGGCGGG - Exonic
905670604 1:39788274-39788296 GCGGGCAGCCGGGAGGCGGCGGG + Exonic
906111302 1:43323827-43323849 GAAGGCTGCCTGGAGGCATAAGG - Intergenic
906149385 1:43578653-43578675 GAGAGCTTCCTGGAAGCAGCAGG + Intronic
906200069 1:43954277-43954299 GGGTGCTGCCTGGAGACAGCCGG - Intronic
906678695 1:47710575-47710597 GAGCGAAGCCTGGAAGCTGCGGG + Intergenic
906704652 1:47886202-47886224 GAGGGCTCCCTGGAGGAGGTGGG - Intronic
907403352 1:54239135-54239157 CAGTGCCGCCTGGAGGCAGCCGG - Exonic
907476542 1:54709747-54709769 GAAGGCTTCCTGGAGGAGGCAGG + Intronic
907526878 1:55058864-55058886 AAGGGTTTCCTAGAGGCTGCAGG + Intronic
911048417 1:93648811-93648833 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
911530218 1:99035555-99035577 GATGGTTGCCAGGAGGCTGGGGG + Intergenic
911647054 1:100348746-100348768 TAATTCTGCCTGGAGGCTGCAGG - Intergenic
912504213 1:110144597-110144619 GAGGCTTGGCTGGAGGCTGGAGG + Intergenic
914916468 1:151822303-151822325 GAGGGCTGGGTGGGGGCTGGGGG + Intronic
915633995 1:157173822-157173844 GTGGGCAGACTGGAGGCTGACGG + Intergenic
915670565 1:157485704-157485726 GTGGGCAGACTGGAGGCTGATGG - Intergenic
915731217 1:158055864-158055886 CAGGCCTTCCTGGAGGGTGCTGG - Intronic
915916689 1:159944861-159944883 GAGAGCTGCCTGGAGGCAGTGGG - Intronic
918085189 1:181239047-181239069 GTGGGCTGCCTGCAGGCAGGGGG + Intergenic
920137432 1:203781369-203781391 CTGGGCTGCATGGAGCCTGCAGG + Intergenic
920184424 1:204151534-204151556 CAGGGCTGCCAGGGGGATGCGGG - Intronic
920455380 1:206097235-206097257 GAGGGCTGCAGGGAGGCAGGAGG - Intronic
920547002 1:206826569-206826591 GAGGGTGGACTGGAGGCTGCTGG - Intronic
920554898 1:206897566-206897588 GCTGGCTGCCTGGAGGCAGCTGG - Exonic
921692167 1:218164613-218164635 GAGGGCGGACTGGAAGCAGCGGG - Intergenic
922528609 1:226325739-226325761 TAGAGCTGCCTGGAGCCTGATGG + Intergenic
922775978 1:228214356-228214378 CAGTGCTGCCTGGAGGATGTGGG + Exonic
923108083 1:230869125-230869147 CAGGGCAGCCCGGAGGCTGGAGG + Intronic
923523211 1:234752264-234752286 GAGGGCTGTCTGGAGGGAGCAGG + Intergenic
924224664 1:241911215-241911237 CAGATCTGCCTGGAGGCAGCTGG - Intergenic
924434925 1:244030806-244030828 TAGGGCTCCCTGTGGGCTGCAGG + Intergenic
924648382 1:245901612-245901634 GATGGCTGACTAGAGGCAGCTGG + Intronic
1062768204 10:81049-81071 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1062860302 10:805189-805211 GTGGGGGGCCTGGAGGGTGCAGG + Intergenic
1062897543 10:1115878-1115900 GAGGACGGCCTGCAGGCTGTGGG + Intronic
1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG + Intronic
1063151373 10:3339646-3339668 TCGGGATGCCTGGAGGCGGCTGG - Intergenic
1064430106 10:15263222-15263244 GAGGGCCTCCTAGAGGCTCCGGG + Intronic
1064605723 10:17036593-17036615 CAGGGCTGCCAGGGGGCTGAAGG + Intronic
1065319502 10:24495967-24495989 GAGGCCTGGCTTGAGACTGCTGG - Intronic
1065487209 10:26247114-26247136 CAGAGCAGCCTGGAGGCTGCTGG + Intronic
1065506855 10:26438228-26438250 GAGGGCGGGCTGCAGGCGGCCGG + Exonic
1065789208 10:29244255-29244277 TGGGGCTGCCTGGAGGCTGGAGG + Intergenic
1066466328 10:35653573-35653595 GAAAGCTGCCAGGAGACTGCTGG - Intergenic
1067343739 10:45423453-45423475 CAGGGCTTCCTGGAGGAGGCAGG - Intronic
1067343804 10:45423925-45423947 CAGAGCTGCCTGGAGGGGGCGGG + Intronic
1069552867 10:69376652-69376674 GAAGGCTGCCTGAAGGCAGGGGG - Intronic
1069580293 10:69561242-69561264 GAGGGCTCTCTGCAGGCTGAAGG - Intergenic
1069660696 10:70121498-70121520 GAGGGGTGCCTGGAAGCAGGAGG + Intronic
1069749542 10:70736492-70736514 GAGGGGTCCCTGGAGGCTGCCGG + Intronic
1069904275 10:71723334-71723356 GAGTGCAGCCTCGAGGCTACTGG - Intronic
1070413957 10:76171640-76171662 CAGGGATTCCTGGAGGCTGTGGG + Intronic
1070730823 10:78827063-78827085 GTGTGCTGCCTGGTGGCTCCTGG - Intergenic
1070733978 10:78851165-78851187 CAGGGCTGGCTGGGGGCCGCAGG - Intergenic
1070806128 10:79271802-79271824 GAGGTGGGCCTGGAGCCTGCTGG + Intronic
1071129051 10:82370366-82370388 GAGGGATGTCTGGATGCTGAGGG - Intronic
1071279510 10:84087283-84087305 CAGAGCAGCCTGGGGGCTGCTGG + Intergenic
1071328256 10:84537561-84537583 GAGGGCCGGCGGGAGGCTGAAGG + Intergenic
1071515038 10:86291557-86291579 GAGGGCTTCCTGGAGGTGGATGG - Intronic
1072032651 10:91536423-91536445 GAGGCTTGGCTGGAGGCTTCAGG - Intergenic
1072188840 10:93064722-93064744 CAAGGCTGGCTGGAGGCTGAAGG - Intronic
1072193722 10:93097091-93097113 CAGGGGCGCCTGGAAGCTGCAGG + Intergenic
1073432114 10:103493749-103493771 GAGGGAATCCTGGAGACTGCCGG + Intergenic
1073559332 10:104483380-104483402 GAGTGCTGCTTGGAGGGTCCAGG + Intergenic
1074162497 10:110845994-110846016 AAGGGCTGCAGGGAGGCTCCTGG + Intergenic
1074327591 10:112467542-112467564 CTGGGCTGCCTGCAGCCTGCTGG + Intronic
1074687902 10:115976702-115976724 CAGAGCTGCTGGGAGGCTGCTGG - Intergenic
1075293664 10:121253301-121253323 GAGGGCTTCCTGGGGGAAGCAGG - Intergenic
1075445431 10:122509671-122509693 GATGGCTGCGGGGAGTCTGCTGG + Intronic
1075486855 10:122829520-122829542 GAGGGCTGCCTGAGGACTGAGGG - Intergenic
1075531887 10:123236696-123236718 GAGGGCAGCATGGAGGCACCTGG - Intergenic
1075776596 10:124993113-124993135 GAGAGCTGCCTGTAGCCAGCAGG + Intronic
1075965712 10:126609980-126610002 GTGTTCTGCCTGGAGGCTCCTGG - Intronic
1076103021 10:127797798-127797820 GAGGGATGAGGGGAGGCTGCGGG - Intergenic
1076222545 10:128746065-128746087 GGGGGATGCCTGGAGGCAACTGG + Intergenic
1076547835 10:131257657-131257679 GGGGGCTGCCTGGGGGTTGTAGG + Intronic
1076647572 10:131963805-131963827 GGGGGCTGGGTGAAGGCTGCAGG - Intergenic
1076800122 10:132817881-132817903 GCGCTCTGCCTGGAGGCTCCCGG + Intronic
1076889605 10:133277150-133277172 GAGGGCCGCCTGGCGGTTTCAGG + Intergenic
1077049265 11:559439-559461 GGGGTCTCCCTGGAGGCTCCTGG - Intronic
1077141554 11:1027035-1027057 GGGGCCTGGCAGGAGGCTGCAGG + Exonic
1077186572 11:1238137-1238159 GTGGGCTGCCTGGAGGAAGCAGG + Intronic
1077225354 11:1437024-1437046 GAGGGCTGCCTGGATGGGGCTGG + Intronic
1077244949 11:1532229-1532251 GAGGGCTGGCCGCAGGCTGTGGG + Intergenic
1077504449 11:2923643-2923665 GAGGGCTTCCTGGAGGAGGTTGG + Intronic
1077889120 11:6405928-6405950 GAGGGCTGGCTGGACACTTCTGG + Intronic
1078060835 11:8041880-8041902 GGGGGCTCGCTGGAGGCTGCGGG - Intronic
1078669013 11:13348504-13348526 GAGGGCTGTGTGGGGGCTGTGGG + Intronic
1079096323 11:17512764-17512786 GAGGGCTAGCTGGAAACTGCAGG + Intronic
1079135444 11:17773889-17773911 CAGGTCTGGCAGGAGGCTGCTGG + Intronic
1079356428 11:19733785-19733807 GAGGCCTACCTGGAGACTGTTGG + Intronic
1081059990 11:38462197-38462219 GAGGGATGTCTGGAGGCTAAGGG - Intergenic
1081621996 11:44624196-44624218 GTGGGCTTCCTGCAGGATGCTGG + Intergenic
1081867319 11:46366918-46366940 TAGGGCTACCTGGCGCCTGCGGG - Exonic
1083171441 11:60925791-60925813 GAGTGCTGTCTGGAGGGAGCAGG - Intronic
1083190511 11:61048617-61048639 GAAGGCTTCCTGGAGGAGGCAGG - Intergenic
1083554378 11:63614227-63614249 GCGGGCGCCCAGGAGGCTGCAGG + Exonic
1083619125 11:64040374-64040396 GAGGGCTGCATGGAGACCCCCGG + Intronic
1083639252 11:64136520-64136542 GGGGCCTGCCTGGAGGCTGGGGG + Intronic
1083683440 11:64361765-64361787 GAGGGCGGCCAGAGGGCTGCAGG + Intronic
1083707433 11:64526017-64526039 GAGAGCTGCCAAGAGGCTGCTGG - Intergenic
1083941636 11:65899490-65899512 GGGGGCACCCGGGAGGCTGCAGG - Intronic
1084004271 11:66314963-66314985 GAGGGATGACCGGTGGCTGCTGG - Exonic
1084190693 11:67497421-67497443 GGGGGCTGCCTGAAGGCTGTGGG + Exonic
1084332920 11:68440175-68440197 GACGGCCGCCTGGATGCTGACGG - Intronic
1084368313 11:68718164-68718186 GTGGGCTGACTGGGGGCTGCAGG - Intronic
1084421579 11:69063177-69063199 GAAGGCTGCTGGGAGGCTTCTGG - Intronic
1085390818 11:76181303-76181325 GGAGGCTGCCTGAGGGCTGCAGG - Intergenic
1085476037 11:76789453-76789475 GAGACCTGCCTGGAGCCTGTTGG + Intronic
1085522315 11:77145948-77145970 GATGGCTGGCTGGTGACTGCGGG - Intronic
1085784327 11:79437804-79437826 GAGGGCGCCCCGGAGGCGGCTGG - Intronic
1090825297 11:130380885-130380907 GTGGGGTGCCTGGGGGCTCCTGG + Intergenic
1090911242 11:131121495-131121517 GGGGGCTGCCTGATGGCTGCAGG + Intergenic
1091023888 11:132124920-132124942 GGAGGCTGGTTGGAGGCTGCAGG + Intronic
1091423909 12:369258-369280 GAGGGCTGTCTGGAAGCAACTGG + Intronic
1092077188 12:5683805-5683827 GAGGGCTTCCTGGAGGAGGCAGG + Intronic
1092963817 12:13622378-13622400 GAGGCCTGCCCCGGGGCTGCAGG - Intronic
1093683516 12:22030399-22030421 GAGGGATGTCTGGATGCTGAGGG + Intergenic
1093971036 12:25376248-25376270 TATGGCTGCCTGGAGGCAGCTGG - Intergenic
1094025916 12:25959211-25959233 GAGGGCAGCTCCGAGGCTGCAGG - Intronic
1094221696 12:28000936-28000958 CAGGGCAGCCTGAGGGCTGCTGG + Intergenic
1095983476 12:47985496-47985518 GAGGGCTGCTAGGAGGGTGGGGG - Intronic
1096181976 12:49556075-49556097 GAAGGCTTCCTGGAGGAGGCAGG - Intronic
1096527189 12:52217409-52217431 GAGGGCTGGATGCTGGCTGCAGG - Intergenic
1096656944 12:53097880-53097902 GAGGGCTGCGCGGAAGCTGAGGG + Exonic
1097024231 12:56042325-56042347 GGCGCCTTCCTGGAGGCTGCCGG + Intronic
1097043430 12:56170116-56170138 GAGGGATTTCTGGAAGCTGCAGG - Intronic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1101036927 12:100716165-100716187 GAGGGCAGCCAGGCGGCGGCGGG - Intergenic
1101479700 12:105084739-105084761 GTGGGCTTCCTGGAGCCTGTGGG + Intergenic
1101919051 12:108918016-108918038 GAGGGGTGTCTGGGAGCTGCTGG - Intronic
1102262630 12:111453747-111453769 GAGGGCGGCCTGGGGACCGCCGG + Exonic
1102466497 12:113133685-113133707 GGGCTCTTCCTGGAGGCTGCTGG - Intronic
1102492172 12:113296031-113296053 GGCGGCTGCCTGGGGGCTGCTGG - Exonic
1102738371 12:115183276-115183298 TAGGGCAGGCTGGAGGTTGCTGG + Intergenic
1103555935 12:121766475-121766497 GAGGCCTGCCTGGGGGCCGCTGG - Intronic
1103907814 12:124336253-124336275 GCCGGCTGCCTGGATGCTGTCGG - Intronic
1103934980 12:124470878-124470900 GAGGGCTGCCTTGAGCCACCTGG + Intronic
1103977989 12:124716162-124716184 GAGGGGTGGCTGGAGGCTTCGGG + Intergenic
1104031342 12:125067297-125067319 TAGGGCAGCCTGGAGACTCCTGG + Intronic
1104443406 12:128813720-128813742 TAGAAATGCCTGGAGGCTGCTGG - Intronic
1104657999 12:130588166-130588188 AAGGGCTTCCTGGAGGAGGCAGG - Intronic
1105069677 12:133226975-133226997 GGGGGTTGCCTGAGGGCTGCAGG + Exonic
1105575786 13:21650453-21650475 TAGGGCAGGCTGCAGGCTGCAGG - Intergenic
1105830505 13:24160213-24160235 GGGGGCTGGCTGGTGGCTGAGGG + Intronic
1105840343 13:24248644-24248666 GACTGCTGCCTGGAGGCTGTTGG + Intronic
1106036945 13:26051840-26051862 GAGAGCCGGCCGGAGGCTGCCGG - Intergenic
1107084067 13:36406629-36406651 TAGGGTTTCCTGGATGCTGCAGG + Intergenic
1108494444 13:51010064-51010086 GAAGGCTACCTGTAGGCTGTGGG + Intergenic
1108718000 13:53100828-53100850 CAGGCCTTCCTGGAAGCTGCTGG - Intergenic
1112146930 13:96710334-96710356 GAGCTCTGCCTGCAGGCAGCTGG + Intronic
1113420213 13:110165266-110165288 GAGGGCTGGCATGAGGCTGCAGG - Intronic
1113537206 13:111077120-111077142 GATGGCTGACTGGAGGCACCCGG - Intergenic
1113577681 13:111405541-111405563 GAAGCCTCCCTGGAGGCAGCAGG + Intergenic
1113796991 13:113064184-113064206 CACGTCTGCCTGGATGCTGCGGG - Intronic
1113836704 13:113332792-113332814 GACGGCTTCCTCGAGTCTGCAGG - Intronic
1113863713 13:113507934-113507956 GATGGCTGCCTGTGGGCTGAAGG - Intronic
1114270831 14:21098761-21098783 CAGTGCTGCTTGGAGGCTGGGGG - Intronic
1115429573 14:33300829-33300851 GAGGGGTGTTTGGAGGCTCCTGG - Intronic
1115649187 14:35390846-35390868 GGGAGCTGCCTTGAGGCTGGGGG - Intergenic
1116786706 14:49296127-49296149 GCAGGCTGCCCGCAGGCTGCAGG + Intergenic
1117009310 14:51454066-51454088 GAGGCCTCCCTGCTGGCTGCTGG - Intergenic
1117063933 14:51989810-51989832 GAGAGGGGCCCGGAGGCTGCCGG - Intronic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1118885062 14:69859463-69859485 GAGGGGAGCCTGGGGACTGCGGG - Intronic
1119644960 14:76341415-76341437 GAGGGCTTCCAGGAGGCCACAGG - Intronic
1121335868 14:93077144-93077166 GAGTGCAGCTTGGAGGCTGTTGG - Intronic
1121440701 14:93947313-93947335 GAGAGCTGCCTGGGTGCTGGCGG + Intronic
1121546752 14:94768825-94768847 GATGGCGGCCCGCAGGCTGCTGG - Intronic
1121750336 14:96349077-96349099 GTGGGCTGCCTTGAATCTGCAGG - Intronic
1121814755 14:96920683-96920705 GAGGGTGGCCTGGGAGCTGCTGG - Intronic
1121826731 14:97016349-97016371 GAGGGCTGCCTGAAGCTGGCAGG + Intergenic
1122811524 14:104291736-104291758 GAGCGAGGCCTGGAGGGTGCTGG - Intergenic
1122917701 14:104866343-104866365 GAGGGCTGGCTGGGGGCCGGAGG + Intronic
1122931020 14:104933153-104933175 GAGGGCTCCCTGGAGGAGGTGGG - Exonic
1123124585 14:105937416-105937438 GAGGGCAGCATGGAGGCACCTGG + Intergenic
1123133676 14:106008140-106008162 GGGGCATGTCTGGAGGCTGCAGG + Intergenic
1202902249 14_GL000194v1_random:50617-50639 GAGGGGTTGCTGGGGGCTGCTGG - Intergenic
1124028107 15:25985646-25985668 CAGGTCTTCCTGGTGGCTGCAGG + Intergenic
1124931754 15:34126757-34126779 GAGGGCTGCCTGACTGCAGCAGG + Intergenic
1125540084 15:40465166-40465188 GAGGAATGCCTGGAGGCAGTAGG + Intronic
1125596854 15:40893038-40893060 GAAGGCTGCATTGAGGCTGCAGG + Intergenic
1125677845 15:41512048-41512070 GAGGGCTGCCTGGGGGCCGGGGG - Intronic
1125919963 15:43519503-43519525 GTGGGCTGTCTGGAGGATACTGG - Intronic
1127658263 15:61075913-61075935 TAGGGCTGCCTGGCAGCTCCAGG - Intronic
1128313377 15:66645372-66645394 GAAGGCTGCCTGGAGGAGGTGGG - Intronic
1128816793 15:70615887-70615909 GGGTGCTACCTGGATGCTGCTGG + Intergenic
1129068998 15:72935739-72935761 CAGGGCAGCCTGGAAGATGCAGG - Intergenic
1129162836 15:73756465-73756487 GAAGGCTGCCTAGAGGGTGGAGG - Intergenic
1129168829 15:73795643-73795665 GAGGGCTTCCTGGAGGAGGAAGG + Intergenic
1129270547 15:74417230-74417252 GAGGGCTCCCTGAGGGCCGCTGG - Intronic
1129315725 15:74742547-74742569 GAGGGCAGTATGGAGGCTGTGGG + Intergenic
1129465236 15:75721147-75721169 GAGGGCGTCCTGGAGCCAGCAGG + Intergenic
1129520247 15:76181371-76181393 GAGGGGTGCCTAGAGGATCCCGG + Intronic
1129672258 15:77613884-77613906 GAGGGCTGGCGGGGGGCAGCAGG + Exonic
1129704324 15:77785766-77785788 GAGGGCTTCCTGGAGGTGTCTGG - Intronic
1129833256 15:78684215-78684237 GTGAGCTGTCTGAAGGCTGCTGG - Intronic
1129871327 15:78943838-78943860 GAGGGCTGCCTGGAGAAGGCTGG - Intronic
1130321606 15:82847073-82847095 TTGTGCTGCCTGGAAGCTGCAGG - Intronic
1130693921 15:86111090-86111112 GAGAATTGCCTGGAGGCAGCTGG + Intergenic
1130908755 15:88256992-88257014 GCGGGCTGCCGCGAGGCTGCGGG - Intergenic
1131111552 15:89767783-89767805 GTGGGCAGCCAGGTGGCTGCAGG + Intronic
1131511100 15:93049968-93049990 GAGAGCAGCCTGGTGTCTGCAGG - Intronic
1131694101 15:94856507-94856529 GAAGGCTGCGCGCAGGCTGCGGG + Intergenic
1132032709 15:98451513-98451535 GAGAGCTGCCGCCAGGCTGCGGG - Intronic
1132092996 15:98960783-98960805 GAGGGCAGCCTGGAGGGGGAGGG - Exonic
1132147231 15:99436234-99436256 GAGGGCAGCATTGGGGCTGCTGG - Intergenic
1132220960 15:100105171-100105193 GTGGTCTGCCTGGAGGCAGCGGG + Intronic
1132457104 16:30025-30047 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1132513038 16:353368-353390 GAGGGCAGTCAGGGGGCTGCAGG + Intergenic
1132513249 16:354114-354136 GGGGGCTGCCTGGAGCATCCCGG - Intergenic
1132513325 16:354416-354438 GAGAGGTGCCTGGAGGGAGCTGG - Intergenic
1132720427 16:1312977-1312999 GAGGGTGGCATTGAGGCTGCTGG + Intronic
1132834752 16:1947141-1947163 GCAGGCTGCCTGGAGGCAGTGGG - Intronic
1132878010 16:2148826-2148848 GTGGGCAGCGTGGAGGCAGCGGG - Exonic
1133008255 16:2896537-2896559 CTGGGCTTCCTGGGGGCTGCCGG - Exonic
1133013819 16:2929773-2929795 CTGGGCTTCCTGGGGGCTGCCGG - Exonic
1133317311 16:4892729-4892751 GAGGGCTGCCTTGAGGATGTGGG + Intronic
1134182768 16:12061121-12061143 GAAGGCTGCCTGGAAGAAGCAGG - Intronic
1134259197 16:12637266-12637288 GTGGGCTGCCTGGAAGCTGGAGG - Intergenic
1134313655 16:13098635-13098657 GAGTGGTTTCTGGAGGCTGCAGG + Intronic
1135517778 16:23149566-23149588 ACGCGATGCCTGGAGGCTGCGGG + Intergenic
1135964940 16:27027990-27028012 GGGGCCTGCCTTCAGGCTGCTGG + Intergenic
1136085484 16:27881926-27881948 GAGGCCAACCAGGAGGCTGCAGG - Intronic
1136615050 16:31393452-31393474 GAGGGCAGGCTGGGGGCTGGTGG + Intronic
1136996825 16:35196274-35196296 CATGTCTGCCTGGATGCTGCAGG - Intergenic
1137588933 16:49681702-49681724 CATGGGTTCCTGGAGGCTGCAGG + Intronic
1137709601 16:50557037-50557059 GAGGGCCTACTGGAGGGTGCAGG - Intronic
1138029787 16:53551046-53551068 GAGGGCTGCTTGAAGGAGGCAGG - Intergenic
1138191507 16:55017500-55017522 GAGGGCAGCATGGAAGCTCCTGG + Intergenic
1138417385 16:56879262-56879284 GGGGGCTGGGTGGAGGCTGCAGG + Intronic
1138428347 16:56951370-56951392 GAGGGCAGGGTGGAGGATGCGGG + Intergenic
1138591401 16:58001249-58001271 GCGGGGTGCCGGGAGGCTGCAGG + Intronic
1138999363 16:62490472-62490494 GAGAGCCCCCAGGAGGCTGCTGG - Intergenic
1139361084 16:66400694-66400716 GAGGGCTTCCTGGAGGAGCCAGG + Intronic
1139478639 16:67216015-67216037 GGGCCCTGCCTGGAGGCAGCTGG - Intronic
1139587998 16:67916668-67916690 GAAGGCTAGCTGGAGGCTACTGG + Intronic
1139954281 16:70685899-70685921 GAGCGCAGCCTGGAGGCGGGAGG - Exonic
1140145860 16:72307920-72307942 GATGGCTTCTTGGAAGCTGCTGG + Intergenic
1140295116 16:73702297-73702319 AGGGGCTGCCTGGGGGCTGCAGG + Intergenic
1141072884 16:80974053-80974075 GAGGGCTTCCGGGTTGCTGCTGG - Exonic
1141148229 16:81546953-81546975 GAGAGCTCCCTGGATGGTGCTGG + Intronic
1141440281 16:84025630-84025652 GAGGGAGGCCTGGTGGCTGCTGG - Intronic
1141520673 16:84576812-84576834 GAAGGCTGCCTGCTGGCTTCAGG + Intronic
1141656305 16:85418481-85418503 GAGGGCTTCCTGGAGGAGGCGGG - Intergenic
1141762686 16:86039017-86039039 GAAGGAGGCCTGGAGGATGCTGG + Intergenic
1141922172 16:87143635-87143657 GAGGGCGGCCTGCAGGCTCTGGG - Intronic
1141945333 16:87305499-87305521 CAGGGCAGCCTGGGGGCGGCGGG - Intronic
1142004917 16:87685123-87685145 GAGCCCAGCCTGGGGGCTGCGGG + Intronic
1142030269 16:87835088-87835110 CAGGGCTGCAAGGAGCCTGCAGG + Intronic
1142106460 16:88306228-88306250 AAGAGGTGCCTGGAGGGTGCTGG - Intergenic
1142194179 16:88732000-88732022 CAGCCCTGCCTGGAGGCTGCGGG + Intronic
1142202893 16:88769632-88769654 GCGTGCTGACTGGAGGCTGCAGG - Intronic
1142212233 16:88813622-88813644 GAGGCCGGCCGGGAGGCAGCGGG + Intergenic
1142278201 16:89133900-89133922 GGGGGCTGCCAGCAGGCTCCAGG - Intronic
1142310648 16:89310901-89310923 TCGTGCTGCCTGGAGTCTGCAGG + Intronic
1142614726 17:1127606-1127628 CAGGGCAGCCTGGAGCCTCCTGG - Intronic
1142687048 17:1583366-1583388 GAGGGCTCCCCGGAGGAAGCCGG + Intronic
1142848836 17:2694682-2694704 GAGGGCAGCCGGGAGGCTCCCGG - Intronic
1142955842 17:3521211-3521233 GAAGGCTTCCTGGAGGAGGCAGG - Intronic
1143014840 17:3886213-3886235 GAGGGCTCCCTGGAGGAGGCGGG - Intronic
1143335092 17:6166085-6166107 GAGGGCTGTCCTCAGGCTGCTGG + Intergenic
1143524200 17:7462900-7462922 GTGGGCTGCCCCGAGGCCGCCGG - Exonic
1143628896 17:8126004-8126026 GAGGGGGGTGTGGAGGCTGCAGG - Intergenic
1143723076 17:8827269-8827291 TCCGGCTGCCTGGATGCTGCAGG + Exonic
1144451477 17:15383455-15383477 GAGAGCTGCGGGCAGGCTGCTGG - Intergenic
1144698467 17:17321579-17321601 GAGAGCTGCCAGGCAGCTGCAGG + Intronic
1144739389 17:17572855-17572877 GAGGGCTGGCTGGTGGTGGCGGG - Intronic
1144837499 17:18164380-18164402 GAGAGCTGGCTGGGGGTTGCTGG - Intronic
1144848229 17:18231052-18231074 GAGGGACACCTGAAGGCTGCAGG - Intronic
1144950099 17:18989348-18989370 GGAGGCGGCCTGGAGCCTGCTGG + Intronic
1144953134 17:19004588-19004610 GAGGCCTGCCCGGAGGAGGCTGG + Intronic
1145251767 17:21300684-21300706 GAGGGCTCCCTGGAGGAGGCGGG + Intronic
1145967232 17:28928262-28928284 GAGGGTTGCCTGGGCTCTGCTGG - Intronic
1146185195 17:30720071-30720093 GAGGGCTTCCTGGAGGAGGTGGG + Intergenic
1146496868 17:33330359-33330381 CAGGACTGCAGGGAGGCTGCTGG + Intronic
1147159746 17:38563058-38563080 GAGGCCGGGGTGGAGGCTGCTGG - Intronic
1147163305 17:38579978-38580000 GAGGGCTGCTTTGGGGCTGGTGG - Intronic
1147247640 17:39132680-39132702 GAGGGCTGAATGGAGGCAGCTGG + Intronic
1147649107 17:42051814-42051836 CAGTGCTGCATGGAGGATGCTGG - Intronic
1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG + Intronic
1147971156 17:44219687-44219709 GCGGGCTGCCTGCAGGCGGAGGG - Intronic
1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG + Exonic
1148071845 17:44913225-44913247 AAGGGCTGCCTGGAGGAGGCAGG + Intronic
1148084846 17:44987875-44987897 GCTGGCTGCCTGGATGCTGGGGG + Intergenic
1148150676 17:45395080-45395102 GAGGGCTTCCTGGCTGCTTCTGG - Exonic
1148763907 17:50026503-50026525 GGGGACTGCCTGGAGCCAGCAGG + Intergenic
1149468517 17:56898036-56898058 GAGGGCTGGCTGCACACTGCTGG - Intronic
1149894043 17:60415207-60415229 GAGGGCTGGATGTAGGCTGCTGG + Intronic
1150130108 17:62664583-62664605 CAGGGCTGCCTGGAGGCCCAGGG + Exonic
1150295800 17:64006727-64006749 AAGGGCTGCCTGGAGGGAGATGG + Exonic
1150425604 17:65074748-65074770 GGGGGCTGCCTGCACACTGCTGG - Intergenic
1150644001 17:66966721-66966743 CAGGGCTGAGTGGAGTCTGCAGG + Intronic
1150856345 17:68756747-68756769 GAGGGCTTCCTTGAGGAAGCAGG + Intergenic
1151271013 17:72996051-72996073 GAGGGCAGTGTGGAGGGTGCTGG - Intronic
1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG + Intronic
1151727412 17:75892931-75892953 AGGGGCTGCCTGGTGTCTGCAGG - Intronic
1151834294 17:76573138-76573160 GAGAGTTGCCTGGAGGGTGGGGG - Intronic
1152040828 17:77901638-77901660 GCGGGCTGGCTGGCAGCTGCTGG - Intergenic
1152057278 17:78039843-78039865 TGGGGCTGCCTGGGGGCAGCGGG - Intronic
1152103295 17:78315094-78315116 GAGGTGGGCCTGGGGGCTGCAGG + Intergenic
1152408822 17:80111922-80111944 GAGGGCACCTTGGAGCCTGCCGG + Intergenic
1152438187 17:80288772-80288794 GAGGGCCTCCTGGAGCCGGCAGG - Intronic
1152522164 17:80862906-80862928 GAGGGCCGGCTGGCGGCAGCAGG - Intronic
1152545024 17:80996027-80996049 GAAGGCTTCCTGGAGGTGGCGGG + Intronic
1152676522 17:81644286-81644308 GAAGACCGCCTGGAGGCTGCAGG - Intronic
1152961093 18:80546-80568 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1153226119 18:2901311-2901333 CAGGGCTTCCTGGAGACAGCAGG + Intronic
1153349225 18:4059919-4059941 GAGGGCATCCTGGAGGGGGCCGG - Intronic
1153414532 18:4832114-4832136 TAGGGCTGCCTGGTGGGAGCTGG - Intergenic
1153785124 18:8527925-8527947 GATGGCTGACTGGAAGCAGCTGG + Intergenic
1154070669 18:11149171-11149193 GCGGGCCGCCTGGGGGCTGGAGG - Intergenic
1155032740 18:21998437-21998459 GACAGCTCCCTGGATGCTGCTGG - Intergenic
1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG + Intergenic
1156478807 18:37423410-37423432 GAAGACTGCCTGGAGGAGGCGGG + Intronic
1157047703 18:44122738-44122760 AAGGGATGCCTGAAGGCTCCTGG + Intergenic
1157226156 18:45866546-45866568 GAGGGCTGCCAGCAAGCTGCTGG - Intronic
1157482663 18:48065587-48065609 GAGGGCTCTCAGGAGGTTGCTGG + Intronic
1157573965 18:48731375-48731397 GAGAGATGCCTGGAAGCTTCTGG + Intronic
1157794194 18:50559895-50559917 CTGAGCGGCCTGGAGGCTGCGGG + Intergenic
1157845493 18:51000282-51000304 GAGAGCCTCCAGGAGGCTGCCGG - Intronic
1158277086 18:55780370-55780392 GCGGGCTGCGCGGAGGCTGCGGG - Intergenic
1158505695 18:58044476-58044498 GAGCGCGCCCTGGACGCTGCCGG - Exonic
1159214071 18:65366881-65366903 GATGGCTGCCTAGAGGCACCTGG + Intergenic
1160225676 18:77009098-77009120 GAGGGGGGCCTGGTGGATGCAGG + Intronic
1160456512 18:79006060-79006082 GAGGGCTGCACGTGGGCTGCAGG - Intergenic
1160710299 19:548359-548381 GAGGGCTTCCTGGAGGAGGTGGG + Intronic
1160753656 19:747145-747167 CTGGGCCGCGTGGAGGCTGCGGG - Exonic
1161028837 19:2048758-2048780 GATAGCTACCAGGAGGCTGCTGG + Intronic
1161348299 19:3778651-3778673 GAGGGCTTCCTGGAGGAAGCAGG - Intronic
1161378400 19:3951535-3951557 GAGCGCTGCCTGGCGCCTCCAGG - Intergenic
1161448273 19:4329827-4329849 GAGGACTGCCTTGGGGCTGGGGG - Intronic
1161521006 19:4723539-4723561 GACGGGTGCATGGAGGCTCCGGG + Intronic
1161570912 19:5030500-5030522 GAGGGCTTCCTGGGAGCTGATGG + Intronic
1161585479 19:5103159-5103181 CAGGGCTGCCCGGTGCCTGCAGG - Intronic
1161586065 19:5106546-5106568 GGTGGCTGCCGGGTGGCTGCTGG - Intronic
1161630401 19:5352098-5352120 GAGGGCTTCCTGGAGGTGGCAGG - Intergenic
1161682436 19:5686957-5686979 GCGAGTTGCCTGGGGGCTGCGGG - Exonic
1161718649 19:5891632-5891654 GAGAGGTGCCTGGGGGCTGCAGG - Exonic
1161811502 19:6473896-6473918 GAGGGCTGCTTGCAGGAGGCCGG + Intronic
1162022251 19:7873284-7873306 GCTGGGGGCCTGGAGGCTGCGGG + Exonic
1162099073 19:8328832-8328854 GAGAGCAGCCAGGAGGTTGCAGG + Intronic
1162378441 19:10318250-10318272 GAGGCCAGCCTGCAGGCCGCTGG + Exonic
1162906227 19:13825716-13825738 GAGGGCTGCCAGGTGGATGCGGG + Intronic
1162973585 19:14195618-14195640 GAGGGCTTCCTGAAGGAGGCGGG - Intronic
1163148576 19:15398478-15398500 GAGGGCAGCCTGGAGTCACCTGG + Intronic
1163650536 19:18515333-18515355 GTGGGCTGCCAGGAGGCATCAGG - Intronic
1163683276 19:18696011-18696033 GAGGGGTGGGTGGAGGCTACTGG + Intronic
1164399801 19:27894747-27894769 GAGAGCTGCTTGGAGGATGCAGG - Intergenic
1164669249 19:30063465-30063487 GAAGGCTGCCTGGAGGAGGGTGG - Intergenic
1164748723 19:30635552-30635574 AAGGGCTGCCTGCAAGGTGCAGG + Intronic
1164866987 19:31612653-31612675 GAGAGCATCCTGGGGGCTGCTGG + Intergenic
1164875877 19:31688014-31688036 GAGGGCAGCCTGGCCGGTGCAGG - Intergenic
1165097552 19:33417855-33417877 CTTGGCTGCCTGGAGGGTGCGGG - Intronic
1165115234 19:33524446-33524468 GCTGGCTGCCTGGAGACGGCAGG + Intergenic
1165213835 19:34255016-34255038 GAGGGCGGCCTGCTGGCGGCAGG + Intronic
1165247309 19:34505005-34505027 CTGGGCTGGGTGGAGGCTGCAGG - Exonic
1165255460 19:34575241-34575263 AAGGCCTGCCTGGAGACTACAGG - Intergenic
1165315011 19:35049429-35049451 GCAGGCAGGCTGGAGGCTGCAGG - Intronic
1165565149 19:36719674-36719696 GAGGGCTGTCTTGAGGCGGAAGG - Exonic
1165786223 19:38463531-38463553 AGGGGCTGCCTGCAGCCTGCGGG + Intronic
1165891302 19:39113820-39113842 GAAGGGTGCTGGGAGGCTGCAGG + Intergenic
1165947014 19:39449616-39449638 GATGGCTGCCTGGAGGAGGAAGG + Intronic
1166091572 19:40512779-40512801 GAGCGTCTCCTGGAGGCTGCGGG + Exonic
1166339771 19:42130771-42130793 GAGGGCTTCCTGGAGGAAGGGGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166698862 19:44870302-44870324 GAGGGCGGCCAGGAGGATGTGGG + Intronic
1166717034 19:44975153-44975175 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
1166774265 19:45302923-45302945 CAGGACTGGCTGGAGGCTCCAGG - Exonic
1166837773 19:45677791-45677813 GAGGGCGGCCTGGTGGAGGCGGG - Intronic
1166859069 19:45799273-45799295 GAGGGCTGCCAGGTGCCTGCGGG + Intronic
1167002917 19:46756438-46756460 GTGGGCGTGCTGGAGGCTGCGGG + Exonic
1167006992 19:46782636-46782658 GAGGGCTGCCTTGTCTCTGCTGG - Intronic
1167439334 19:49499448-49499470 GAGGGCCTCCTGGGGTCTGCTGG + Intronic
1167631231 19:50627375-50627397 GAGGGCTGCCTGGGGTCCCCAGG + Intronic
1167728246 19:51233832-51233854 GAGGGCAGCATGGAGGCACCCGG - Intronic
1168598350 19:57696900-57696922 GGGAGCTGCCTTGGGGCTGCTGG - Intronic
925033050 2:666272-666294 CTTGGCTGCCTGAAGGCTGCAGG + Intergenic
925332437 2:3069154-3069176 GGGGGTTGCCAGGAGGCTGGGGG + Intergenic
925333239 2:3074882-3074904 GAGGGACACCTGGAGGCTGAGGG - Intergenic
925609352 2:5691437-5691459 GCGGGCTTGCTGGAGCCTGCGGG + Intergenic
925610363 2:5696724-5696746 GAGGGAAGCCTCGGGGCTGCGGG + Exonic
925992963 2:9268811-9268833 TAGGGCTGCCTGAGTGCTGCAGG + Intronic
926012080 2:9416483-9416505 AAAGGCAGCCTGGAGGCAGCTGG - Intronic
926053195 2:9757660-9757682 CAGGGCTGGCTGGAGGGGGCTGG + Intergenic
926396973 2:12453481-12453503 TAGGGCTGTCTGGGGGCAGCTGG + Intergenic
926948485 2:18215582-18215604 GGCAGCTGCCTGGAGGCTGGAGG + Intronic
927138805 2:20115839-20115861 GAGGGCAGCCTGGAGGCCAGAGG - Intergenic
927203996 2:20595494-20595516 GAGGGCTTCCTGGAGGAGGGAGG + Intronic
927210967 2:20638751-20638773 GAGGGCTTCCTGCAGCCTCCTGG + Intronic
928120574 2:28581001-28581023 GAGGGGAGCCTTGGGGCTGCTGG + Intronic
928181607 2:29072252-29072274 GAGGGATGCCTTGAGCCTGCTGG + Exonic
928434849 2:31248348-31248370 GATGGCTTCCTGGAGGCAGAGGG - Intronic
929511253 2:42568086-42568108 GGGGCCGGCCTGGAGCCTGCAGG - Intronic
929789339 2:45012045-45012067 TAGTGTTGCCTGGAGGCTCCTGG - Intergenic
929900103 2:45993267-45993289 GATGGGCTCCTGGAGGCTGCAGG - Intronic
931643282 2:64399919-64399941 GATGCATGCCTGGAGGCTGTGGG - Intergenic
931665869 2:64609299-64609321 GAGGGCGCCTCGGAGGCTGCCGG - Intergenic
931670298 2:64641372-64641394 GGGGGCGGCCGGGAGACTGCTGG + Intronic
932673461 2:73757786-73757808 CACGGGTGCCTGGAGGCTACAGG + Intergenic
932702085 2:73999045-73999067 GAAGGCTTCCTGGAGGAAGCAGG + Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
933950716 2:87326890-87326912 GAGGACTGGCTGGAGGCAGCAGG + Intergenic
933969893 2:87461873-87461895 TATGGCTTCATGGAGGCTGCTGG - Intergenic
934504436 2:94879814-94879836 GAGGGGTTGCTGGGGGCTGCTGG + Intergenic
934713411 2:96529782-96529804 GAGGGCTGCGTGGAGGCTGAAGG - Intergenic
934784786 2:96997241-96997263 GAGGTGTGCCCGGAGGCTGCAGG + Intronic
934919671 2:98332633-98332655 AAGAGCGGCCTGGAGGCAGCAGG + Intronic
935591844 2:104852333-104852355 GGGGGCTGCCTGGCTGCGGCTGG + Intergenic
936032257 2:109081757-109081779 AAGGGCTCCCTGGCGGCGGCAGG - Intergenic
936228558 2:110679932-110679954 GAGGGCTCCATGGAGGCTGGGGG + Intergenic
936329063 2:111531688-111531710 GAGGACTGCCTGGAGGCAGCAGG - Intergenic
936501795 2:113072531-113072553 CAGAGCTGCCTGGAGCCTGCTGG + Exonic
937121878 2:119446208-119446230 GTGGGGTGTCAGGAGGCTGCTGG - Intronic
937825691 2:126366461-126366483 CAGAGCTTTCTGGAGGCTGCAGG + Intergenic
937910296 2:127072332-127072354 GAAGACTGCCTGGAAGGTGCTGG - Intronic
937910770 2:127074466-127074488 GCGGGCTGCCAGGTGGCTGCTGG - Intronic
938366196 2:130736564-130736586 GAGGGCTGGGGGGAGGCTGTAGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
940983000 2:160024063-160024085 GGGAGCTGCCTGGAGTCTACAGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941857017 2:170241665-170241687 GTGGACTGCCTGGATGCTGTGGG + Intronic
942482906 2:176407884-176407906 GAGGGCTGCATGTGGACTGCAGG + Intergenic
944414277 2:199467575-199467597 GAGGGCTCCCTGTAGTCGGCAGG + Intronic
945314902 2:208360656-208360678 GAAGGCAGCCTGGTGGCAGCAGG - Intronic
946131456 2:217610074-217610096 GAGGGCAGACTGTGGGCTGCAGG + Intronic
946692648 2:222320387-222320409 GAGGGCGGCCTGGAGGCGCTCGG + Intergenic
947096233 2:226570294-226570316 GGGGCCTGCCTGGACGCTGGTGG + Intergenic
947522959 2:230862548-230862570 AAGGGGAGCCAGGAGGCTGCGGG - Intergenic
948263402 2:236620924-236620946 GGGGGCTTCCTGGAGGCTATAGG + Intergenic
948353368 2:237358922-237358944 GAAGGCTGCCTGGAGGAAGCGGG + Intronic
948499181 2:238379159-238379181 CAAGGTTACCTGGAGGCTGCTGG + Intronic
948585534 2:239016563-239016585 GGGGCCTGCCTGGAGGGTGGCGG - Intergenic
948695103 2:239729364-239729386 GAGGGTCCCCTGGGGGCTGCGGG + Intergenic
948798875 2:240421124-240421146 GAGTGCTGCCTGAGGGCTGGGGG - Intergenic
948860285 2:240749621-240749643 CTTGGCTGCCTGGAAGCTGCAGG - Intronic
1168956593 20:1838626-1838648 GCTGGCTGCCTGGGAGCTGCTGG - Intergenic
1168970119 20:1925205-1925227 GAAGTCTGCCGGGAGGCTCCTGG - Intronic
1169128284 20:3146993-3147015 GGGGTCTGCATGCAGGCTGCGGG + Exonic
1169327439 20:4686926-4686948 GAGGGGCGCCTGGGGGCCGCGGG + Intronic
1169427892 20:5510528-5510550 GAGGCCTGCCTAGCAGCTGCAGG + Intergenic
1170000515 20:11608785-11608807 GAGGGCTTCCTGGAGCCTGAAGG - Intergenic
1170803736 20:19611904-19611926 ACGGGGAGCCTGGAGGCTGCGGG - Intronic
1171154417 20:22859202-22859224 TGGGGCTCCCTGGGGGCTGCTGG + Intergenic
1171194704 20:23187782-23187804 CAGGGCAGCCTGGTGGCAGCTGG - Intergenic
1171294875 20:24008654-24008676 CAAGCCTGCCTGGAGGCAGCAGG - Intergenic
1171401323 20:24874523-24874545 GGGGGCTTCCAGGAGGCTGACGG - Intergenic
1171424831 20:25042860-25042882 GAGGGGTGTCTGGAGGATGAGGG - Intronic
1172039044 20:32031042-32031064 GAGGGCTTCCTGGAGGGCGTGGG + Exonic
1172127877 20:32636032-32636054 GAGGGGGGCCTGGGGGCTGGGGG - Intergenic
1172618361 20:36305066-36305088 GAGGGCTTCCTGGAAGAGGCAGG - Intergenic
1173418596 20:42880542-42880564 GAGGGCATCCTGGGGGCTGAAGG - Intronic
1173795746 20:45858037-45858059 GAGGGCTGCCTGGAGGAGGAGGG + Intronic
1173857466 20:46259650-46259672 GAGGGCTGCCTGGAGGAGGGGGG + Intronic
1174050560 20:47764577-47764599 GAGGGAGTCCTGGAGGCTGGAGG + Intronic
1174078887 20:47957168-47957190 CAGGGGCACCTGGAGGCTGCTGG - Intergenic
1174180075 20:48669036-48669058 GAGGGCTGCAGGGAGGTGGCAGG - Intronic
1174353413 20:49983432-49983454 GAGGGCCCTCTGGACGCTGCTGG + Intronic
1174551548 20:51366137-51366159 GAGGGGTGGCAGGAGGCTGAAGG - Intergenic
1175165958 20:57045045-57045067 GGAGGCTGGGTGGAGGCTGCAGG - Intergenic
1175207825 20:57325469-57325491 GAGGGCGATCTGAAGGCTGCAGG + Intergenic
1175242727 20:57561661-57561683 GAGCCCTGCCTGCAGGGTGCTGG - Intronic
1175310873 20:58010929-58010951 GAGGGACGGCTGAAGGCTGCAGG - Intergenic
1175423887 20:58852501-58852523 CGGGGCTGCCTGGAGGCTGGGGG + Intronic
1175636858 20:60591662-60591684 GAGAGCAGGCTGGGGGCTGCAGG + Intergenic
1175820483 20:61906496-61906518 GAGGGCTGCCAAGTGGCTCCCGG + Intronic
1175944371 20:62551786-62551808 GGGGTCTGCTTGGAGGCGGCTGG + Intronic
1176084365 20:63289367-63289389 GAGGGCTGCTTGGACCCTGGTGG + Intronic
1176103722 20:63376019-63376041 CAGGGCTGACTGGAGGATACAGG - Intronic
1176163101 20:63658547-63658569 GAGGGCGGCTTGGGGCCTGCCGG - Intronic
1176265872 20:64209078-64209100 GAGGGCTGCTTGGAGGGGCCTGG + Intronic
1176621617 21:9065384-9065406 GAGGGGTTGCTGGGGGCTGCTGG - Intergenic
1178454244 21:32732554-32732576 GAGGGGAGCCTGGAGGAGGCTGG - Intergenic
1179480342 21:41672995-41673017 GTGGGGTGCCTGCAGGCCGCTGG - Intergenic
1179597391 21:42452075-42452097 GAGGGCTTCCTGGAGGGGGTGGG - Intergenic
1179620748 21:42614096-42614118 GGGGGCTGCCCTGAGGCTCCTGG + Intergenic
1179787990 21:43740616-43740638 AAGGGCTCCCAGGAGGCTGGTGG + Intronic
1179902388 21:44400914-44400936 GAGGGCTGGATGGAGGCTCAGGG + Intronic
1180001204 21:44996295-44996317 GTGGGCAGGCTGGCGGCTGCTGG + Intergenic
1180042865 21:45288727-45288749 GGGAGCTGCCTGGAGGCTGCGGG - Intergenic
1180061455 21:45387241-45387263 GAGAGCTGCATGGAAGCTCCTGG - Intergenic
1180142645 21:45901466-45901488 CAGAGCTGGCTGGAGGCTGGAGG - Intronic
1180176500 21:46093032-46093054 CAGGGCAGCCTGCAGCCTGCTGG + Intergenic
1180602666 22:17032739-17032761 GATGGGTCCCTGGAGGCTGGAGG + Intergenic
1180675075 22:17581222-17581244 GCGCGCTGCCTGGAGACTGGAGG - Intronic
1180781596 22:18523209-18523231 CAGGGCTGGCTGGGGGCTGGGGG + Intergenic
1180881065 22:19203833-19203855 GAGGACTGCCTGGGGGCATCAGG - Intronic
1180983203 22:19889075-19889097 TAGGGGTCCCTGGTGGCTGCTGG - Intronic
1181029413 22:20142689-20142711 GGGTGCTGACTGGCGGCTGCAGG + Intronic
1181082299 22:20423683-20423705 GAGTGCTGTGTGGCGGCTGCAGG + Intergenic
1181238480 22:21462552-21462574 CAGGGCTGGCTGGGGGCTGGGGG + Intergenic
1181293806 22:21818929-21818951 GAGGGGAGGCTGAAGGCTGCAGG + Intronic
1181345818 22:22219934-22219956 GAGGGCTCCCTGGATTCTGTAGG - Intergenic
1181372253 22:22427837-22427859 GAGGGCTCCCTGGCTTCTGCTGG - Intergenic
1181487688 22:23241829-23241851 GAGGGGAGCCTAGAGGCTGCAGG - Intronic
1181731416 22:24849686-24849708 GAGGGCTTCCTGTAGGCAGGAGG + Intronic
1181737293 22:24892087-24892109 GAGACCTGGATGGAGGCTGCTGG + Intronic
1182015886 22:27039344-27039366 GAGGGCATGGTGGAGGCTGCAGG + Intergenic
1182026664 22:27124499-27124521 GAGGGCTCCCAGAAGGCGGCAGG + Intergenic
1182045385 22:27270228-27270250 CATGGCTGCCTGGAGGCCCCAGG + Intergenic
1183094031 22:35541443-35541465 GAGAGCTGCCTGGAAGCGCCGGG - Exonic
1183390933 22:37545540-37545562 GAGGGCTTCCTGGAGGAAGGAGG - Intergenic
1183512831 22:38245890-38245912 GAGGGCTGGCGGGGGGCTGGGGG - Intronic
1183536104 22:38402314-38402336 GAAGGCTGCCTGGAGGAGGCAGG + Intergenic
1183686434 22:39363701-39363723 GGGGACTGCCTGGAGGAGGCTGG + Intronic
1183733621 22:39631542-39631564 GAGGACTGCCTGGAGGAGGAGGG + Intronic
1183857331 22:40644024-40644046 GAGGGCTTCCTGGAGGAAGTGGG - Intergenic
1184684800 22:46091415-46091437 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684836 22:46091559-46091581 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684845 22:46091595-46091617 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184750837 22:46485645-46485667 GAGAGGTGCATGGAGCCTGCTGG - Intronic
1184981204 22:48097097-48097119 AGGGGCTGCCAGGTGGCTGCAGG - Intergenic
1185077737 22:48692190-48692212 GAGAGCTGCCTCCAGCCTGCAGG + Intronic
1185180917 22:49362635-49362657 CAGGGCCTCCTGGAGGCTCCGGG + Intergenic
1185316698 22:50182418-50182440 GCGGGATGCCGGGTGGCTGCTGG - Intergenic
1185418716 22:50723304-50723326 GTGGGCTGCATGGATGCTGGCGG + Intergenic
949495713 3:4629806-4629828 GAGGGCTTCCTGGAGGAAGAAGG + Intronic
950146598 3:10654512-10654534 AGAGGCTGCCTGGAGGGTGCAGG + Intronic
950479106 3:13233778-13233800 GAGGGCTCCCGGCAGGCTCCTGG + Intergenic
950633120 3:14297491-14297513 GAGGGATACCTGGGGACTGCCGG + Intergenic
950683755 3:14602511-14602533 GCGGGCTGGCTGGAGGGAGCAGG + Intergenic
950805795 3:15601982-15602004 GAGGGCTGCGCAAAGGCTGCCGG + Intronic
951967835 3:28407214-28407236 GAGGGCTCCATGAAGGATGCAGG - Intronic
953469928 3:43157982-43158004 GAGGGCTGCCCGCAGCCTGCTGG + Intergenic
953798327 3:46002346-46002368 GAGGGCAACCTGGAGGGGGCTGG - Intergenic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
954297369 3:49681744-49681766 GAGGGCTGCCAGGCTGCAGCAGG - Exonic
954441018 3:50521983-50522005 GGGGGCTGCCTGAAGGAAGCTGG + Intergenic
955842312 3:63125316-63125338 GAAGACTACCTGGAGGGTGCAGG + Intergenic
956945553 3:74218485-74218507 AAGGGCTACTTGGAGGCTGGTGG - Intergenic
957060965 3:75481057-75481079 GAAGACTGCCAGGAGACTGCAGG + Intergenic
957215760 3:77317740-77317762 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
957215789 3:77317809-77317831 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
957215798 3:77317831-77317853 GGGGGCTGCTAGGGGGCTGCTGG + Intronic
957215803 3:77317842-77317864 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
957215814 3:77317865-77317887 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
960963690 3:123090137-123090159 CAGGGATGCCTGGAGGATGCAGG - Intronic
961577989 3:127854136-127854158 GATGGTGACCTGGAGGCTGCAGG + Intergenic
961592326 3:127990324-127990346 GAGGGCAGACGCGAGGCTGCAGG - Intergenic
961695139 3:128698857-128698879 GAGGGCTGGCCGCAGGCTGCGGG + Intergenic
961818746 3:129564555-129564577 GAGGGCTGCCTGGAGGATTGTGG - Intronic
961958064 3:130824748-130824770 GAGGGCTGCCCTCAGACTGCTGG + Intergenic
962273308 3:133994046-133994068 GAAGGCTGGGTGGTGGCTGCAGG + Intronic
964500931 3:157347633-157347655 GAGGGCAGCGTGGAGGCACCAGG + Intronic
964501085 3:157348683-157348705 GAGGGCAGCGTGGAGGCACCAGG - Intronic
965071669 3:163923277-163923299 TAGGGCAACCTGGAGGGTGCTGG + Intergenic
965400418 3:168206495-168206517 AAGGGCTGCCAGAAGGCTGTGGG - Intergenic
965736896 3:171830112-171830134 CAGGGCCACCTGGAGGCAGCTGG + Intergenic
966724673 3:183099065-183099087 GAGGGGAGCCTGGAGGATGGCGG + Intronic
966878957 3:184338931-184338953 TAGGCCTGGCTGGAGGCTACTGG + Intronic
967840830 3:194003426-194003448 CGCGGCTGTCTGGAGGCTGCCGG + Intergenic
967920217 3:194608957-194608979 GATGACAGCCAGGAGGCTGCTGG + Intronic
968467932 4:762314-762336 GAGGACGGACTGGAGGCTGGAGG + Intronic
968506873 4:974772-974794 GAGGGCTGCCTGGGGGCAGCAGG + Intronic
968521788 4:1037516-1037538 CAGGGCTGCCTGCAGGAGGCTGG - Intergenic
968521808 4:1037596-1037618 CAGGGCTGCCTGCAGGAGGCTGG - Intergenic
968574038 4:1356725-1356747 GTGGGCTGCGTGGGGGCTGCCGG + Intronic
968605371 4:1532720-1532742 TGGGGGTCCCTGGAGGCTGCTGG - Intergenic
968698455 4:2043653-2043675 GGGGCCTGCCTGGGGTCTGCTGG - Intronic
968726777 4:2251505-2251527 CAAGGCTGCCTGGTGGCTGCGGG - Intronic
968894637 4:3391810-3391832 GAGGGCTGCCTGGGTGCTCCAGG + Intronic
968935620 4:3608668-3608690 GAGGGCTTCCTGGAGGCACTGGG + Intergenic
968965071 4:3765695-3765717 CAGGGCCGCCTGCAGCCTGCGGG - Intergenic
969281564 4:6174381-6174403 GAGGGCTGCTGGGAGGGTCCAGG + Intronic
969452322 4:7281689-7281711 GATGGCAGCCTGGGGGCCGCAGG + Intronic
969488304 4:7484830-7484852 GTGGGCTGCGTGGAGGAGGCAGG - Intronic
969509758 4:7611063-7611085 CTGGGCTGCATGGTGGCTGCAGG - Intronic
969621246 4:8280019-8280041 CGGGGCTGCCTGGAGGAGGCAGG + Intronic
969929267 4:10614186-10614208 GATGTCTGCATGGAGCCTGCTGG + Intronic
970771203 4:19614889-19614911 GGGAGCTGCCTGGAGACTGTGGG + Intergenic
971938975 4:33189434-33189456 GAGGGCTGCCAGGATGGGGCTGG - Intergenic
974115886 4:57578714-57578736 GAGGGCCCCCTGGAAGCTGCTGG - Intergenic
975403726 4:73965891-73965913 GAGGGCTGACTAGATGCAGCTGG - Intergenic
976014991 4:80542151-80542173 GAGAGCCGCTGGGAGGCTGCTGG - Intronic
977719740 4:100225001-100225023 GAGGGCTGACTAGAGGCATCTGG - Intergenic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
978012122 4:103700525-103700547 GAAGCCTGCCTGAAGGCTACAGG - Intronic
980339538 4:131526444-131526466 CTGGGCTGCCTGAAGCCTGCGGG + Intergenic
982017112 4:151165621-151165643 GTGGGCTTCCTGGTGGGTGCTGG + Exonic
982073286 4:151714425-151714447 GAGGTCTGCCTGGAGTCTGCAGG - Intronic
983675643 4:170289207-170289229 GAGAGCTGCCTGCAGGATGAGGG - Intergenic
984862834 4:184255493-184255515 GAGGCCTGGCTGGGGGCAGCTGG - Intergenic
984952744 4:185019136-185019158 AAGTCCTGCCTGGAGGCTGGCGG + Intronic
985025445 4:185735165-185735187 GGGAGCTGCCTGGGGGCTGGTGG + Intronic
985570574 5:642644-642666 CAGGGCTGCCTGCAAACTGCAGG - Intronic
985676528 5:1234370-1234392 GAGAGGTGCCAGGAGGCTGATGG - Intronic
985744043 5:1636612-1636634 GGGGGCTTCCTGGAGGGAGCCGG - Intergenic
985890331 5:2710381-2710403 GAGAGATGTGTGGAGGCTGCTGG - Intergenic
985962638 5:3314358-3314380 GAGGGCTGCAAGGAGGATGAGGG - Intergenic
986350016 5:6868509-6868531 GCGGGCTGCCTGGTTGATGCAGG - Intergenic
986475050 5:8121124-8121146 GAGGGCTATCTGGAGGCTGGGGG + Intergenic
986697856 5:10374474-10374496 GTGGGCTGCCTGGATACTGCTGG + Intronic
987418880 5:17694437-17694459 ATGGGCTGCCTGGAGGAAGCTGG - Intergenic
988734643 5:34008071-34008093 GAGGGCTTCTTGCAGGCTGCTGG - Intronic
990545165 5:56815359-56815381 GAGGGCGGCCCGGCGGCCGCAGG - Intergenic
991015838 5:61931445-61931467 GAGGGCTGCTAGGTGGCTGATGG - Intergenic
991054372 5:62306074-62306096 CGGGGCCGCCTGGAGGCAGCGGG + Intergenic
992140960 5:73796477-73796499 TGGGGCTCCCTGGAGGCTGAGGG + Intronic
992142480 5:73813026-73813048 GAGCTCTTCCTGGAGTCTGCTGG + Intronic
993846812 5:92954105-92954127 GATGGCTGACTGGAGGCATCTGG - Intergenic
995410038 5:111846590-111846612 GAGGGCTGCCTGGATACTGCTGG + Intronic
995592859 5:113717656-113717678 AAGGGCTGCCTTCAGGCTGCTGG + Intergenic
995750906 5:115452303-115452325 GAGTGGTGCCTGGAAGGTGCGGG - Intergenic
997436629 5:133880387-133880409 GAGGGCTTCCTGGAGGAGGCAGG - Intergenic
997469492 5:134108929-134108951 GAGGGCTTCCTGGAGGAAGGAGG - Intergenic
997624749 5:135324208-135324230 GAAGGCTGCTCTGAGGCTGCCGG + Intronic
997682007 5:135763433-135763455 CTGGGCTGGCTGGAGGGTGCTGG - Intergenic
997828307 5:137127408-137127430 CAGGGCTGCCTGGAGCCATCAGG + Intronic
998040811 5:138950041-138950063 CAAGGCTGCCCCGAGGCTGCCGG - Intronic
998130273 5:139648298-139648320 GAACGCTGCCCGGGGGCTGCCGG - Exonic
998157110 5:139793345-139793367 GAGGGCTGCCTGGAGGCCACAGG - Intergenic
999241144 5:150128100-150128122 GATGGCTGCCTAGAAGATGCAGG - Intronic
999248541 5:150167973-150167995 GAGGCCTGCCTGGGGGCAGGAGG - Intronic
999683501 5:154081776-154081798 GAGGCCTGCCCTGGGGCTGCCGG + Intronic
1001749309 5:174116789-174116811 GAGGGCTGCGAGGAGGCTGGAGG - Intronic
1001997558 5:176174480-176174502 GAGGGCTCCATGGAGGCTGGGGG + Intergenic
1002104562 5:176873702-176873724 GTCTGCTGCCTGGAGGATGCAGG - Intronic
1002372879 5:178768884-178768906 CATGGCTGCCTGGGGGCTGCAGG + Intergenic
1002441618 5:179267241-179267263 AAGGGCTGGCTGTGGGCTGCAGG + Intronic
1002604229 5:180372289-180372311 CAGGGCTGCTTTGAGCCTGCTGG + Intergenic
1003673630 6:8182428-8182450 GTGTGCTGATTGGAGGCTGCTGG + Intergenic
1004549868 6:16636385-16636407 AAGGGCTGCCTGGGGGCTGGGGG - Intronic
1004799884 6:19134714-19134736 GAGGGATGCCTGGAGGCCAAGGG + Intergenic
1005825131 6:29627856-29627878 GAGGGCTGCTAAGAGGGTGCCGG + Intronic
1006214664 6:32430113-32430135 CAGGGGTGCCTTGTGGCTGCAGG + Intergenic
1006373094 6:33657404-33657426 GAGGGCTGCCTGGAGGCAGTGGG + Intronic
1006375622 6:33670269-33670291 GATGGCAGCCGGGAGGCTGCTGG - Intronic
1006630348 6:35426250-35426272 GAGAGCTGGCTGGAGGAAGCGGG - Exonic
1007222094 6:40286781-40286803 GAGGGCTCCCTGTGGTCTGCAGG + Intergenic
1007237561 6:40401779-40401801 GAGGGGAGGCTGGAGGCTGGAGG - Intronic
1007341000 6:41191583-41191605 ATGGACTTCCTGGAGGCTGCTGG + Exonic
1007398434 6:41590173-41590195 GAGGGTGGGCTGGGGGCTGCAGG + Intronic
1007500846 6:42295600-42295622 GAGGGCTTCCTGGATGAGGCTGG - Intronic
1007704752 6:43783886-43783908 TTGAGCTGCCTGGAGGTTGCAGG - Intronic
1007918702 6:45586574-45586596 GAGGGCCCCCTGGAGGGTGCAGG + Intronic
1008145979 6:47891820-47891842 GTGGTCTGGCTGGAGGATGCTGG + Intronic
1013073469 6:106750310-106750332 GAGTGGTGCAGGGAGGCTGCTGG - Intergenic
1013415479 6:109920833-109920855 GAGGGCTTCCTGGTGTGTGCTGG - Intergenic
1013600645 6:111701343-111701365 GGGGGCTGCCAGGAGGGAGCGGG - Intronic
1014562556 6:122908661-122908683 GAGTCCTGGATGGAGGCTGCAGG - Intergenic
1016383669 6:143511343-143511365 GGGTGGTGGCTGGAGGCTGCGGG + Intronic
1016986816 6:149901367-149901389 CAGGGCTGCCTTGAATCTGCAGG + Intergenic
1017714952 6:157203134-157203156 TGGAGCTGCCTGGAGGCTGGGGG - Intronic
1017753407 6:157509906-157509928 GAGAGCAGAGTGGAGGCTGCAGG - Intronic
1018082719 6:160272196-160272218 GTGTGCTGACTGGAGGCTGCTGG + Intronic
1018845359 6:167551860-167551882 GAGGACTGCGTGGAGGGTGGAGG + Intergenic
1018849794 6:167578643-167578665 CTGGGCTGCGTGGTGGCTGCAGG - Intergenic
1018923742 6:168193082-168193104 GGGGGCTTCCTAGAGGCGGCGGG + Intergenic
1018978198 6:168581773-168581795 GGGGGCTGCAGGGAGGCAGCGGG - Intronic
1019209852 6:170396323-170396345 GGAGTCTGCATGGAGGCTGCGGG + Intronic
1019314040 7:376451-376473 GGGGGCTGAGGGGAGGCTGCCGG - Intergenic
1019338598 7:496706-496728 CAGGGCAGCCTGGAGGCTGGAGG - Intergenic
1019543776 7:1563110-1563132 GCAGGTTGCCTGGAGGCTCCTGG - Intergenic
1019605074 7:1906101-1906123 CAGTGCTGCCTGGTGCCTGCGGG - Intronic
1019757948 7:2787374-2787396 GAGGGGCGCCTGAGGGCTGCCGG - Intronic
1020013783 7:4819815-4819837 CAGGGATGCCTGCAGGCTCCGGG - Intronic
1020096886 7:5374408-5374430 AAGCGGGGCCTGGAGGCTGCGGG - Exonic
1020106387 7:5424056-5424078 GAGGGGAGCCTGGAAACTGCTGG - Intronic
1020375379 7:7478881-7478903 CAGGGCTGCCTGGCGCTTGCAGG - Intronic
1021338472 7:19433724-19433746 GAGAGCTCCCAGGAAGCTGCTGG - Intergenic
1021813287 7:24424381-24424403 GTGGGCAGCCTGGGGGCAGCAGG - Intergenic
1022666485 7:32416053-32416075 GAAGGCTGCCTGGGGGAGGCGGG - Intergenic
1023139194 7:37083995-37084017 GAGAGCTGTCTGGAGGCAGTTGG + Intronic
1023939960 7:44763002-44763024 GATGGCTGCCTGGCAGCTGAGGG - Intronic
1023965684 7:44962114-44962136 GTGGTCAGCCTGGGGGCTGCAGG + Intergenic
1025294036 7:57761476-57761498 GAGGCCTGCCTAGAGGGTGCAGG + Intergenic
1026658697 7:72279600-72279622 CAAGGCTGACTGGAGGCTCCAGG + Intronic
1026911067 7:74092380-74092402 GATGGGGGCCTGCAGGCTGCTGG + Intronic
1026976605 7:74502592-74502614 CAGGGCTGCCTCCAGGCTGGGGG - Intronic
1027249469 7:76389989-76390011 GAGGGCTTCCTGGAGGAGGAAGG + Exonic
1029113545 7:98225053-98225075 GAGCGATGCCTCGGGGCTGCAGG - Exonic
1029456074 7:100673319-100673341 GGGGCCGGCCTCGAGGCTGCTGG - Intergenic
1029736654 7:102469116-102469138 GAGGGGAGCGTGGAGGCTACTGG - Intronic
1030108884 7:106009634-106009656 GAGGGCGGCGTGGAGGAGGCGGG + Intronic
1032506164 7:132436167-132436189 GAGTGCAGCCTGGAGTATGCAGG - Intronic
1032742188 7:134749977-134749999 GAGGGCTCCCAGAAAGCTGCTGG + Intronic
1033271649 7:139937865-139937887 AGGGGCTGTCTGGAGGATGCAGG + Intronic
1034204630 7:149304799-149304821 TCGGGCTGCGTGGAGGCTGCCGG + Intergenic
1034550375 7:151816679-151816701 GGGGGCTGGCTGCAGGCTGCAGG - Intronic
1034860160 7:154587956-154587978 CAGTGCTGCCTGAGGGCTGCAGG - Intronic
1034967444 7:155400067-155400089 TAGGGCTGCCTCCAGGGTGCTGG - Intergenic
1035323566 7:158050568-158050590 GAGGGAAGCCGGGAGGCTGTGGG - Intronic
1036813714 8:11885878-11885900 GGGGGCTTGCAGGAGGCTGCAGG - Intergenic
1037316768 8:17606599-17606621 GATGGGTGGGTGGAGGCTGCAGG + Intronic
1037776103 8:21836702-21836724 GAGGGCTGCCGGCAGGGTGGGGG - Intergenic
1037776597 8:21839586-21839608 GAGGACTTCCTGGTGGCTGTGGG + Intergenic
1037778102 8:21849004-21849026 GAGGGCTGTATGGTGGCTCCAGG + Intergenic
1037816298 8:22114551-22114573 GAGCGCCACCAGGAGGCTGCGGG + Exonic
1037823801 8:22148607-22148629 GACGGGTGCCTGGGAGCTGCTGG + Exonic
1038268235 8:26052208-26052230 GGTGGCTGACTGGAGGCTGCGGG + Intergenic
1038803691 8:30771730-30771752 GAGGTCTGTCATGAGGCTGCAGG - Intergenic
1039845262 8:41321438-41321460 GAGGGCAGCCTGGAGGCTAGGGG - Intergenic
1043344809 8:79286779-79286801 TAGGGCCACCTGGAGGGTGCTGG + Intergenic
1044659190 8:94578730-94578752 GAGGGCAACCTGGAGGGGGCTGG + Intergenic
1045215571 8:100145638-100145660 GCCGCCTGCCTGGAGGCCGCGGG + Intronic
1047456453 8:125017416-125017438 GAGTACTGCCTGGCTGCTGCTGG + Intronic
1047571058 8:126099093-126099115 GAGGGCTCCAAGGAGACTGCTGG + Intergenic
1048396696 8:134020727-134020749 GAGGGCTCCCTGGAAGCTTACGG + Intergenic
1048522661 8:135171152-135171174 GGGGGCTGGGTGGAGGCTCCCGG + Intergenic
1049011408 8:139890068-139890090 GAGGGGTGCCTCGCTGCTGCTGG - Intronic
1049105202 8:140608511-140608533 GACGCCTGCCTGCCGGCTGCGGG - Intronic
1049127453 8:140804824-140804846 GAGGGCTGCCTGTGGCCTCCCGG - Intronic
1049344298 8:142130285-142130307 GAGTGCTCCCTGGAAGCTGTGGG - Intergenic
1049344308 8:142130319-142130341 GAGTGCTCCCTGGAAGCTGGGGG - Intergenic
1049344318 8:142130349-142130371 GAGTGCTCCCTGGAAGCTGGGGG - Intergenic
1049344328 8:142130381-142130403 GAGTGCTCCCTGGAAGCTGTAGG - Intergenic
1049344336 8:142130412-142130434 GAGTGCTCCCTGGAAGCTGTGGG - Intergenic
1049352197 8:142170343-142170365 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1049424586 8:142532430-142532452 GAGGGCTGCTGTGAGGCTCCTGG + Intronic
1049541075 8:143209285-143209307 TAGGGGTGCCTGGGAGCTGCAGG + Intergenic
1049708661 8:144054051-144054073 GAGAGTGGCCTGGAGGCTGGGGG - Intronic
1049735344 8:144202216-144202238 GTGGGCTGTCTGGAGGCTGGCGG + Intronic
1049861625 8:144902450-144902472 GGGGGCTGCGTGGGGGCGGCGGG + Intergenic
1050001650 9:1083802-1083824 AAGAGCTGCCTCCAGGCTGCGGG + Intergenic
1052855705 9:33404922-33404944 CAGGGCTGCCCAGAGGCTGATGG + Intergenic
1053393749 9:37753873-37753895 GGGGGCTGGCTGGGGGCTGCGGG + Intronic
1054454564 9:65423203-65423225 GAGGGCTTCCTGGAGGCACTGGG - Intergenic
1054735374 9:68745070-68745092 GAGAGCTGGCTGGATGCTGACGG - Intronic
1056307577 9:85305245-85305267 GTGGGCTGCCTGGTGGGAGCTGG + Intergenic
1056335469 9:85564128-85564150 CAGGACTGCCTGGAGGCTTAGGG + Intronic
1056543564 9:87594795-87594817 AAGGGCTGCCTAGAGGCCACAGG - Intronic
1056765339 9:89441587-89441609 GAGGGCAGCCTGGAAGCAGCAGG + Intronic
1057177437 9:93010398-93010420 AAGGGCTCCCAGGAGGGTGCAGG + Intronic
1057593612 9:96395310-96395332 GAGGCCGGCCAGGAGGCTGTCGG - Intronic
1057705611 9:97392941-97392963 CAGGGCTCCCTGGGGGCTGGTGG - Intergenic
1057799159 9:98179447-98179469 GAGGACAGCCTGGAGGAGGCAGG - Intronic
1057894282 9:98894668-98894690 GAGGGCTGCCTGGGGGTTGGGGG + Intergenic
1057996557 9:99824895-99824917 GTGGGCGGCTTGGAGGCTCCTGG - Intronic
1058765604 9:108180102-108180124 GAGAGCCCCCAGGAGGCTGCTGG - Intergenic
1058885869 9:109320778-109320800 GCGGGCTGCCAGGGGGCTGCCGG + Exonic
1060530802 9:124346189-124346211 GAGTGCAGCCTGGAGACTGTGGG - Intronic
1060876062 9:127084433-127084455 GAGGGCTGCCTGGATGGTGGGGG - Intronic
1061179269 9:129014272-129014294 GATGCCTGGCTGGGGGCTGCTGG - Intronic
1061290701 9:129649078-129649100 GAGGGCTTCCTGGTGGGGGCGGG - Intergenic
1061486038 9:130920961-130920983 GTGGGAGGCCTGGAGGCTGCTGG + Intronic
1061497846 9:130985850-130985872 GAGGGGTGCCCGGCGGGTGCTGG + Intergenic
1061498614 9:130989914-130989936 CAGGGCTGCCTGGAGGATGGCGG + Intergenic
1061659939 9:132122850-132122872 GAGGGCACCCTGAAGACTGCGGG - Intergenic
1061728560 9:132595587-132595609 GAGGGCTGCGTGGAACTTGCTGG - Intronic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1061868659 9:133508337-133508359 GAAGGCTGCCTGGAAGAGGCAGG - Intergenic
1061953545 9:133949746-133949768 CAGGGCTGCCTGCGTGCTGCAGG - Intronic
1062141185 9:134959971-134959993 GAGGACGGCATGAAGGCTGCAGG + Intergenic
1062146850 9:134994344-134994366 GAGCGGTGCCTGGGGGCTGGAGG + Intergenic
1062174143 9:135151645-135151667 GAGGGCGGCCTGGAGGCTGGGGG - Intergenic
1062230646 9:135479923-135479945 GGGGGCGGGCCGGAGGCTGCAGG - Exonic
1062277616 9:135738164-135738186 GAGGGCTTCCTGGAGGAGGTGGG - Intronic
1062452129 9:136620244-136620266 GAGGACAGCCTGGAGTGTGCAGG + Intergenic
1062564859 9:137159794-137159816 AAATGCTGCCTGGAGGCTGAGGG + Intronic
1062616068 9:137396463-137396485 GAGGGCTGCCTGGGGGAGGGCGG - Intronic
1062636228 9:137492972-137492994 GAGGGCTCCCAGGAGGCTCTGGG + Intronic
1062737068 9:138143440-138143462 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1185530465 X:814441-814463 GAGGGATGCCTGGAGCCCCCAGG + Intergenic
1185530526 X:814780-814802 GAGGGATGCCTGGAGCCCCCAGG + Intergenic
1185691022 X:2155325-2155347 CAGGGATGCCTGGAGCCTCCAGG - Intergenic
1185924072 X:4127276-4127298 CAGGGATGCCTGGAGCCTCCAGG - Intergenic
1186669855 X:11757919-11757941 GGGCGCAGCCTGGAGGCCGCGGG + Intergenic
1186673183 X:11787928-11787950 GAGGGCTACCCGGCTGCTGCTGG - Intergenic
1188284849 X:28315079-28315101 GATGGCTGACTAGAGGCAGCTGG + Intergenic
1189155337 X:38750901-38750923 GAAGGCTGCCAGGTGGGTGCTGG + Intergenic
1189272285 X:39759962-39759984 CGGGGCTGTCTGGAGGGTGCCGG - Intergenic
1189330362 X:40141101-40141123 GAGGGCTGCCAAGGGGCAGCAGG + Intronic
1189787570 X:44573074-44573096 CAGAGCTGCCTGAGGGCTGCTGG + Intergenic
1190597876 X:52065191-52065213 GAGGGCTGCCTGGTGACTGCTGG - Intronic
1190610948 X:52188882-52188904 GAGGGCTGCCTGGTGACTGCTGG + Intronic
1194977933 X:100411424-100411446 GAAGGCTCCCTGGGGGCAGCGGG + Intergenic
1198874670 X:141210763-141210785 GAGGGCTGTCAGGAGGGTACGGG - Intergenic
1200045684 X:153400280-153400302 GAGCGCCCCCTGGAGGCTGTCGG - Intergenic
1200213200 X:154356027-154356049 GAGAGCTGCCTGGCCGCGGCAGG - Intronic
1200399255 X:156009701-156009723 GAGGGCTTCCTGGAGGAGGAGGG + Intronic
1201180039 Y:11334108-11334130 GGGGGCAGCTGGGAGGCTGCAGG - Intergenic
1202273817 Y:23095659-23095681 AAGGGAAGCCTGGAGGCTTCAGG - Intergenic
1202292209 Y:23325018-23325040 AAGGGAAGCCTGGAGGCTTCAGG + Intergenic
1202426813 Y:24729404-24729426 AAGGGAAGCCTGGAGGCTTCAGG - Intergenic
1202443978 Y:24940690-24940712 AAGGGAAGCCTGGAGGCTTCAGG + Intergenic