ID: 1151623194

View in Genome Browser
Species Human (GRCh38)
Location 17:75259904-75259926
Sequence CTTTGTAAGGGAAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35467
Summary {0: 1, 1: 0, 2: 40, 3: 2057, 4: 33369}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151623194 Original CRISPR CTTTGTAAGGGAAAGGTGGG AGG Intronic
Too many off-targets to display for this crispr