ID: 1151628571

View in Genome Browser
Species Human (GRCh38)
Location 17:75293955-75293977
Sequence GGGTTGGTCATCTTGAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151628565_1151628571 0 Left 1151628565 17:75293932-75293954 CCAGCACTTTGGGAGGCCAAGCT 0: 232
1: 30889
2: 130470
3: 228627
4: 206076
Right 1151628571 17:75293955-75293977 GGGTTGGTCATCTTGAGGTCAGG No data
1151628558_1151628571 25 Left 1151628558 17:75293907-75293929 CCAGATGCGGTGGCCCACACCTG 0: 3
1: 279
2: 5959
3: 36385
4: 105482
Right 1151628571 17:75293955-75293977 GGGTTGGTCATCTTGAGGTCAGG No data
1151628560_1151628571 11 Left 1151628560 17:75293921-75293943 CCACACCTGTACCAGCACTTTGG No data
Right 1151628571 17:75293955-75293977 GGGTTGGTCATCTTGAGGTCAGG No data
1151628564_1151628571 6 Left 1151628564 17:75293926-75293948 CCTGTACCAGCACTTTGGGAGGC 0: 11
1: 76
2: 346
3: 457
4: 707
Right 1151628571 17:75293955-75293977 GGGTTGGTCATCTTGAGGTCAGG No data
1151628557_1151628571 30 Left 1151628557 17:75293902-75293924 CCTGGCCAGATGCGGTGGCCCAC 0: 2
1: 19
2: 403
3: 2373
4: 6533
Right 1151628571 17:75293955-75293977 GGGTTGGTCATCTTGAGGTCAGG No data
1151628559_1151628571 12 Left 1151628559 17:75293920-75293942 CCCACACCTGTACCAGCACTTTG No data
Right 1151628571 17:75293955-75293977 GGGTTGGTCATCTTGAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151628571 Original CRISPR GGGTTGGTCATCTTGAGGTC AGG Intergenic
No off target data available for this crispr