ID: 1151632676

View in Genome Browser
Species Human (GRCh38)
Location 17:75321574-75321596
Sequence GGGCGCCTCCCCTTTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151632674_1151632676 -10 Left 1151632674 17:75321561-75321583 CCCGCATGTTGAGGGGCGCCTCC 0: 1
1: 0
2: 0
3: 3
4: 98
Right 1151632676 17:75321574-75321596 GGGCGCCTCCCCTTTCCTACAGG 0: 1
1: 0
2: 0
3: 9
4: 105
1151632668_1151632676 13 Left 1151632668 17:75321538-75321560 CCAGCGGCAATCCCTGAAGGGCG 0: 1
1: 0
2: 0
3: 14
4: 42
Right 1151632676 17:75321574-75321596 GGGCGCCTCCCCTTTCCTACAGG 0: 1
1: 0
2: 0
3: 9
4: 105
1151632669_1151632676 2 Left 1151632669 17:75321549-75321571 CCCTGAAGGGCGCCCGCATGTTG 0: 1
1: 0
2: 1
3: 3
4: 48
Right 1151632676 17:75321574-75321596 GGGCGCCTCCCCTTTCCTACAGG 0: 1
1: 0
2: 0
3: 9
4: 105
1151632665_1151632676 15 Left 1151632665 17:75321536-75321558 CCCCAGCGGCAATCCCTGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 113
Right 1151632676 17:75321574-75321596 GGGCGCCTCCCCTTTCCTACAGG 0: 1
1: 0
2: 0
3: 9
4: 105
1151632670_1151632676 1 Left 1151632670 17:75321550-75321572 CCTGAAGGGCGCCCGCATGTTGA 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1151632676 17:75321574-75321596 GGGCGCCTCCCCTTTCCTACAGG 0: 1
1: 0
2: 0
3: 9
4: 105
1151632667_1151632676 14 Left 1151632667 17:75321537-75321559 CCCAGCGGCAATCCCTGAAGGGC 0: 1
1: 0
2: 0
3: 12
4: 67
Right 1151632676 17:75321574-75321596 GGGCGCCTCCCCTTTCCTACAGG 0: 1
1: 0
2: 0
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151632676 Original CRISPR GGGCGCCTCCCCTTTCCTAC AGG Intronic
900477185 1:2881551-2881573 AGGCGCCTCCCCTTCCACACTGG + Intergenic
901069121 1:6508474-6508496 GGGGGCCTCCCCTGACCCACTGG - Intronic
901475549 1:9486831-9486853 GGGGGCCTTCCCTTTCTTTCGGG - Intergenic
905028202 1:34865531-34865553 GGGCCTCTCCCCTTTCCCAGCGG - Exonic
906034474 1:42741760-42741782 GGGAGCCTCCTCCATCCTACTGG + Intergenic
907332784 1:53682149-53682171 GGGTGCCTCACCTTTACAACAGG - Intronic
912006528 1:104908918-104908940 GGGTGCCTCCCCCTTCCACCAGG + Intergenic
912058665 1:105636687-105636709 GAGCACCTCCTCTTTCCTGCAGG + Intergenic
918105683 1:181413440-181413462 GGGCTCCAGCCCTTTCCTGCCGG + Intronic
921043936 1:211460498-211460520 GGGCTCCTCACCTCTCATACGGG - Intergenic
1063543935 10:6961834-6961856 GGCCGCCTGCCCTTTCCCTCGGG - Intergenic
1065717356 10:28585227-28585249 GGGCTCCTCCTCTATGCTACTGG - Intronic
1068763096 10:60733701-60733723 GGGCGAGTCCTCTTTCCTCCGGG + Intergenic
1072578581 10:96720919-96720941 TGTCCCCTCCCCTTTCCTGCTGG - Intergenic
1076305775 10:129464979-129465001 GACCGCCTCCCCATTCCCACAGG + Intergenic
1076440883 10:130480748-130480770 GGGCGCCTCCCTTTGCCTCCTGG - Intergenic
1076993860 11:289153-289175 GGGCGGCTCCTCCTTCCTCCCGG + Exonic
1077080000 11:720979-721001 GGGCTCCTCCCCTCCCCTGCCGG - Intronic
1077146774 11:1050055-1050077 GGACCCCTCCACTTTCCTCCAGG + Intergenic
1093198254 12:16155155-16155177 GGGCTCCTCCCCTTCCATATGGG + Intergenic
1095089234 12:38088300-38088322 GTGCTCCTTCCCTTTCCTGCTGG + Intergenic
1103344725 12:120241642-120241664 AAGCCCCTCCCCTTTCCTCCTGG - Intronic
1108024398 13:46162915-46162937 GGGCGCCTCACTTTTCAGACAGG - Intronic
1115967890 14:38912406-38912428 GGCGGCCTGCCCTTTCCTATGGG - Intergenic
1117999041 14:61505941-61505963 GGGCTCCTCACCTTTCTTAACGG - Intronic
1121279410 14:92688263-92688285 GGGCGCCTCCCCTCACCCCCAGG + Exonic
1122059486 14:99127078-99127100 GGTGGTCTCCCCTTTCCTGCAGG - Intergenic
1122623105 14:103070850-103070872 GGGTGCCAGCTCTTTCCTACTGG - Intergenic
1130895410 15:88166517-88166539 GGGAGCCCTCCCTTTCCTCCTGG - Intronic
1132766580 16:1537413-1537435 GGGCGCGTCCCCTGTCCCTCAGG - Intronic
1132810212 16:1793626-1793648 GGGGGCCTCACCTTTCCTCAGGG + Exonic
1134215147 16:12311489-12311511 GGCCGCCTCCCATTTCCTCCAGG + Intronic
1134847137 16:17449447-17449469 GGGCGCCTCCCCTGTCTGGCTGG + Intronic
1135252994 16:20916710-20916732 GAGTGCCTCCCCTTCCCCACTGG + Intronic
1137597508 16:49734566-49734588 TGGCTCCTCCCCTGTCCTCCTGG + Intronic
1138351564 16:56348758-56348780 CGGCGCCTCCCCTGCCCTGCAGG + Intronic
1138829428 16:60359151-60359173 GGCCGCTTCCCCATTGCTACAGG + Exonic
1139573865 16:67829333-67829355 AGGGTCCTCCCCCTTCCTACGGG - Intronic
1142002643 16:87672178-87672200 TGCCGCCTCCCCTCACCTACAGG - Intronic
1143115303 17:4578523-4578545 GGGCTCCTCACCTCTCATACGGG + Intergenic
1143193216 17:5055760-5055782 GGGCGCCTCCCTGGTCCTCCAGG + Intergenic
1147155847 17:38544161-38544183 GGGCCCCACCCCTCTCCTGCAGG - Intronic
1147193485 17:38749967-38749989 GGGAGGGTCCCCTTTCCTCCGGG - Exonic
1151499553 17:74480248-74480270 GGGCTCCTCCCCTTTAATTCTGG + Intronic
1151632676 17:75321574-75321596 GGGCGCCTCCCCTTTCCTACAGG + Intronic
1156478872 18:37423714-37423736 GGCTTCCTCCCCTTTCCTAGAGG - Intronic
1156500616 18:37555055-37555077 GGGGGCCTTTCCTTTCCTCCTGG + Intronic
1158648064 18:59264891-59264913 GGGCGCCTCCGCGGTCCTACGGG + Intergenic
1161169325 19:2805133-2805155 GGCCTCCTCCACTTTCCTCCTGG - Exonic
1164561683 19:29296674-29296696 GGGAGCCTCCTCTTTCCCCCAGG - Intergenic
1166822976 19:45591887-45591909 GGGCGCTTCCCCTGGCCCACGGG + Exonic
1166932324 19:46308669-46308691 GGGGGCCTCCACCTTCCTCCTGG - Exonic
1166983796 19:46648289-46648311 GGGCTCCTCCCCATTCCTCTCGG + Exonic
1167608376 19:50493708-50493730 GTGCCCTTCCCCTTTCCTAGGGG + Intergenic
1167698077 19:51026509-51026531 GGGCAGCTTCCCTTTCCTCCTGG + Intronic
925860964 2:8174659-8174681 GTGCGTCTCCCCTTTCCCACCGG + Intergenic
932625365 2:73292449-73292471 GGGCGCTGCCCCTTTCCCAGAGG - Exonic
932887709 2:75561820-75561842 GAGCTCCTCTCCTTTCCTAACGG - Intronic
936118578 2:109722254-109722276 GGACACCTCCCCTTTCATAGAGG + Intergenic
936795946 2:116204298-116204320 CCTCGCCTCCCCTTCCCTACTGG - Intergenic
939860551 2:147415284-147415306 GGGTGCCTGCCCTTTCCTCTGGG + Intergenic
946002255 2:216492384-216492406 GAGGGCCTCACCTTTCCTGCTGG + Intergenic
947028988 2:225771090-225771112 GAGCGTCTCCCCTTTACTGCAGG + Intergenic
948710843 2:239824635-239824657 TGGTGCCTCCCCCTTCCTTCTGG + Intergenic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1176110499 20:63408584-63408606 GGGCCCCTGCCCTCTCCTCCTGG + Intronic
1176173855 20:63708458-63708480 GGGCACGTCCCCTTTCCCTCGGG - Intronic
1176304389 21:5115660-5115682 GGGCTCCTCCCCTTTCTCATAGG - Intergenic
1177897219 21:26868009-26868031 GGTCTCTTCCCCTTTCCTCCGGG - Intergenic
1179852669 21:44146370-44146392 GGGCTCCTCCCCTTTCTCATAGG + Intergenic
1180713934 22:17858839-17858861 GGTCCCCTCCCCTTTATTACTGG + Intronic
1182692211 22:32171972-32171994 GAGCACCTCCTCTTTCCTGCAGG + Intergenic
1183163073 22:36127773-36127795 GAGCACCTCCTCTTTCCTGCAGG - Intergenic
1183235519 22:36614093-36614115 CAGTGCCTCCCCATTCCTACAGG + Intronic
949980784 3:9500676-9500698 GGGCACCGCCCCTTCCCTGCAGG + Exonic
958944391 3:100347673-100347695 GGGGGCCTCCCCTAGCCCACCGG - Intronic
964195533 3:154059831-154059853 GGGCTCTTCCTCTTTCCTTCTGG - Intergenic
968232074 3:197010116-197010138 CTGCGCCTCCACTTTCCTCCTGG - Intronic
972564591 4:40258676-40258698 GGCCCCCTCCCCTTTCTTCCTGG - Intergenic
973736279 4:53874749-53874771 GGCGGAGTCCCCTTTCCTACCGG + Intronic
976106757 4:81627369-81627391 GGGGCCCTCTCATTTCCTACAGG - Intronic
982151170 4:152459075-152459097 GGGCTCCTCACCTCTCCTAGGGG - Intronic
985264275 4:188143831-188143853 GGGCTCCTCTCACTTCCTACGGG - Exonic
986123330 5:4863422-4863444 GGGCCCCTCCCCTCTCCTTGGGG - Intergenic
991521069 5:67496718-67496740 GGGCGCCCATCCTTTCCTCCCGG - Intergenic
992070310 5:73142204-73142226 TAGCGCCTCCCCTCTCCTCCCGG - Intergenic
995841378 5:116446562-116446584 GGGCACCTCGCCTTGCCTGCTGG + Exonic
995995334 5:118291654-118291676 GGCAGCCTTCCCTTTCCTGCTGG + Intergenic
999101270 5:149027940-149027962 GGGCACCTGCCTTTTCCAACAGG + Exonic
999959536 5:156739506-156739528 GTGGGCCTCCCATTTCCTGCAGG + Intronic
1000328305 5:160188511-160188533 AGGCGCCTCCCCTTTCCCGCTGG + Intronic
1003535174 6:6970123-6970145 AGGCGCCTCCTATGTCCTACGGG + Intergenic
1006860711 6:37170137-37170159 GCGCTCCTCCCCTTTACTCCTGG + Intergenic
1017007567 6:150038594-150038616 GGGGACCTCCCCTTGCCCACTGG - Intergenic
1017146487 6:151240170-151240192 GGGCGCCTCCCGTTTCTAACAGG - Intronic
1017823516 6:158065145-158065167 GGGAGCCTGCGCTTTCCTGCTGG + Intronic
1018329332 6:162710531-162710553 GTTCACCTCCCCTTTCCCACTGG - Intronic
1019651132 7:2159201-2159223 GGGAGCAACCACTTTCCTACGGG + Intronic
1021899399 7:25268576-25268598 GAGAGCCTCCCCTCTCCTAGAGG - Intergenic
1024566453 7:50685438-50685460 GGGTGCCCACTCTTTCCTACGGG - Intronic
1025850619 7:65240185-65240207 CGGCGCCTGCCCTGTCCTTCTGG + Intergenic
1026817330 7:73522707-73522729 GGGCGCCTCCCCCTTCTTAAAGG + Intergenic
1026853415 7:73738442-73738464 GGCCGCTTCCGCTTTCCTACAGG - Exonic
1031927194 7:127650244-127650266 GGGTGCCTGCCTTTTCCTCCAGG - Intergenic
1035636830 8:1153924-1153946 TGTCTCCTCCCCTTTCCTAGGGG + Intergenic
1036701091 8:11014492-11014514 TGGAGCCTCCCCTTTCCTATGGG + Intronic
1038963644 8:32548565-32548587 GGGCGTCTCCCGTTGCCTGCAGG - Intronic
1039504642 8:38043124-38043146 GGGCCATTCCCCTTTCCAACTGG + Intronic
1049655198 8:143794125-143794147 GGGCTCGTCCCCGTTCCCACAGG + Intronic
1061394055 9:130333679-130333701 TGCCGCCTCCCCTTCCCTGCTGG + Intronic
1061985155 9:134126372-134126394 GGGCTCCTCCCCAGACCTACCGG + Intergenic
1062029979 9:134357903-134357925 TGGCTCCTCCCCTTGCCCACAGG - Intronic
1190279102 X:48917981-48918003 GGGCGTCTCCCCTGCCCTCCAGG + Intronic
1198212443 X:134528950-134528972 GGAAGCCTCCTGTTTCCTACAGG - Intergenic
1200222650 X:154398906-154398928 GGCCGCCTCCTGTGTCCTACAGG + Intronic