ID: 1151633352

View in Genome Browser
Species Human (GRCh38)
Location 17:75326359-75326381
Sequence GGCCTTTGGGCTTGGTGTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151633341_1151633352 17 Left 1151633341 17:75326319-75326341 CCCTACTGACTCATGACAAAGGC 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG 0: 1
1: 0
2: 1
3: 7
4: 159
1151633339_1151633352 27 Left 1151633339 17:75326309-75326331 CCACTGGACTCCCTACTGACTCA 0: 1
1: 0
2: 0
3: 17
4: 172
Right 1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG 0: 1
1: 0
2: 1
3: 7
4: 159
1151633338_1151633352 28 Left 1151633338 17:75326308-75326330 CCCACTGGACTCCCTACTGACTC 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG 0: 1
1: 0
2: 1
3: 7
4: 159
1151633342_1151633352 16 Left 1151633342 17:75326320-75326342 CCTACTGACTCATGACAAAGGCG 0: 1
1: 1
2: 1
3: 26
4: 287
Right 1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG 0: 1
1: 0
2: 1
3: 7
4: 159
1151633347_1151633352 -7 Left 1151633347 17:75326343-75326365 CCTGGGGAAAAGCTCAGGCCTTT 0: 1
1: 0
2: 3
3: 20
4: 213
Right 1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG 0: 1
1: 0
2: 1
3: 7
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151633352 Original CRISPR GGCCTTTGGGCTTGGTGTAC GGG Intronic
900543125 1:3213938-3213960 GGCCGTTCTGCTTGGTGCACTGG - Intronic
901218821 1:7570655-7570677 GGACCTTGGCCTTGGTGAACAGG - Intronic
901320831 1:8338993-8339015 GGCCTTGGGGCGTGGGGAACTGG + Intronic
903141953 1:21344530-21344552 GGCCTTTGCTCTTGGGGTCCAGG + Intronic
904577978 1:31517715-31517737 GGGTTTTTGCCTTGGTGTACTGG + Intergenic
906787468 1:48628636-48628658 AGCTTCTGGGCTTGGTGTGCAGG - Intronic
907314391 1:53559290-53559312 GGCCTCCTGGCTTGGTGGACTGG + Intronic
910769648 1:90818154-90818176 GGCCTTTGGACTTGGACTTCAGG - Intergenic
911199908 1:95033942-95033964 GGCATTTGGACTTGGTGCAGTGG - Intronic
911798017 1:102098566-102098588 GGCTTTTGGGCTTCATGTATAGG + Intergenic
915272158 1:154760895-154760917 GGCCAGTGGCCTTGGTGGACAGG - Intronic
916459312 1:165006716-165006738 GGACTTTGGGCTGTTTGTACTGG + Intergenic
918304880 1:183236617-183236639 GGCCTGTGTGCTTGATATACAGG + Intronic
918625209 1:186649540-186649562 GGCCTTTAGGCCTGGTGTGGTGG + Intergenic
919644629 1:200082091-200082113 GGCATTTGGGGTTGGTGTGGAGG - Intronic
919778471 1:201208605-201208627 GGCCTTGGGCCTAGGAGTACAGG + Exonic
923708213 1:236363153-236363175 GGCCTCTGGGCCAGGTGTAGTGG - Intronic
1065275142 10:24078267-24078289 GGCCTTGGGGTTTGGAGGACTGG + Intronic
1066253716 10:33658253-33658275 GACCTTTAGGCTTGGAGTAATGG - Intergenic
1068143752 10:53039412-53039434 AGTTTTTGGGCTTGGTGTAGTGG + Intergenic
1069623448 10:69852054-69852076 GGCCTTTGCACTTGCTGTGCTGG + Intronic
1070390723 10:75968132-75968154 GGTCTGTGGTCTTGGTGGACAGG + Intronic
1079328575 11:19515030-19515052 GACCTTTGGGGTTTGGGTACCGG + Intronic
1081136487 11:39445825-39445847 GGCCATTAGGGTTGGTGTATAGG + Intergenic
1081678826 11:44987712-44987734 GGCCTTTGGTCTGGTTGGACTGG - Intergenic
1083408856 11:62478014-62478036 TCCCTTTGCTCTTGGTGTACAGG - Intronic
1084191524 11:67501428-67501450 AGCCTTTGGCCCTGGTGTTCAGG - Intronic
1085399297 11:76225994-76226016 GGCCTTTGGGCTGGGTGTGCAGG - Intergenic
1088507292 11:110539200-110539222 GGGTTTTTGCCTTGGTGTACCGG + Intergenic
1089970122 11:122686576-122686598 GGCTTTTGGCCGTGGTGTGCAGG + Intronic
1090064057 11:123488402-123488424 GGCATTTGGGCATGGTATAATGG + Intergenic
1090623103 11:128579335-128579357 GTCCTTTTGGCTTGGAATACAGG + Intronic
1092027222 12:5251785-5251807 CGCCTTTGGGCCTGGTATAATGG - Intergenic
1093656308 12:21698369-21698391 GGTCTTTGGGTTTGGGGTAGAGG + Intronic
1095739607 12:45592829-45592851 TTCCTTTGGGCATAGTGTACGGG - Intergenic
1096933470 12:55242190-55242212 GGTTTCTGGCCTTGGTGTACTGG - Intergenic
1098396832 12:70028481-70028503 GGGCTCTTGCCTTGGTGTACTGG + Intergenic
1102162171 12:110778371-110778393 GGAGTTTGGGGTTGGAGTACAGG + Intergenic
1103637186 12:122317065-122317087 GACCTTTTGGCCAGGTGTACAGG - Intronic
1112067033 13:95803613-95803635 GGGCTTTTGGGGTGGTGTACAGG + Intronic
1114268153 14:21084857-21084879 GGCCCTTGAGCTTGCTGAACAGG - Exonic
1114585984 14:23814224-23814246 GGGCTTTGGAATTGGTGGACTGG - Intergenic
1116607795 14:47024967-47024989 GGCCTTTTGGCTTTGTGTCTGGG - Intronic
1122295230 14:100701735-100701757 GGCCTTTGGGCTGGGGGGAGGGG + Intergenic
1124859978 15:33429983-33430005 GGCCTTCTGGCTGGGTGTGCTGG + Intronic
1125693445 15:41615636-41615658 GGCCTGTGGGCTGGGTGTGGTGG + Intergenic
1128266032 15:66267322-66267344 TGCCTATGTGCTTGGTGAACTGG + Intergenic
1128359641 15:66953045-66953067 GGCCTTTGGGATGGATGTCCTGG - Intergenic
1130402055 15:83566423-83566445 AGCCTTTGGGCTTGGGGACCTGG + Intronic
1131464708 15:92645899-92645921 GGCCTTGGGGCTGGGTGGAGGGG - Intronic
1132554708 16:567373-567395 GGCCGCTGGGCTTGGTGGCCAGG + Intronic
1132760463 16:1506348-1506370 GGCCTGTGGACTTGGGGGACAGG + Intronic
1140785649 16:78339426-78339448 GTCCTTTTTGCTTGGTGCACAGG + Intronic
1143191066 17:5040596-5040618 GGCCTTGGGGTCTGGTGCACGGG + Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1148718895 17:49736530-49736552 GGCCTTTGGGCCGGGTGCAGTGG - Intronic
1150636764 17:66918611-66918633 GGCTTTTGGGCTTGGAATAAAGG - Intergenic
1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG + Intronic
1152133550 17:78491410-78491432 GGCCTTGGGGCTTAGAGTCCAGG + Intronic
1152387069 17:79980974-79980996 GCCCTTTGGGGTTGGGGTGCTGG - Intronic
1152627587 17:81394948-81394970 GGCCTCTGGGCTTGGAGGTCTGG + Intergenic
1153147911 18:2054944-2054966 GGCCTTTTGGTTTTGTGTATTGG - Intergenic
1155522411 18:26682046-26682068 GGCCTCTGGGTTTGCTGTAAAGG + Intergenic
1157027385 18:43861683-43861705 GGTCTTTGGGCTGAGTGTGCAGG + Intergenic
1157672573 18:49542652-49542674 GACCTTTGGGCTTGGAGAACAGG - Intergenic
1160971460 19:1769566-1769588 GGCCTTTAGGATTGGTGTGGGGG + Intronic
1161078113 19:2296314-2296336 GGCCTGTGGGCTGGGATTACAGG - Intronic
1164463826 19:28470778-28470800 GGCTTTTGGGCTGGATGTAGTGG + Intergenic
1166125047 19:40710104-40710126 GGGCTTGGGGCTAGGAGTACTGG - Exonic
1167159032 19:47755689-47755711 GGGCTTTGGACTGGGTGTCCTGG + Intronic
925829600 2:7881624-7881646 GTCCTTTGGGCTGGATGTAGTGG - Intergenic
926580522 2:14629343-14629365 GGCCTTGGAGCTTGGAGTAAGGG - Intergenic
928819354 2:35342280-35342302 GGTTTTTTGCCTTGGTGTACTGG - Intergenic
929120202 2:38477915-38477937 GGCCGTTGAGCTTGGTGGAGGGG - Intergenic
929425740 2:41842976-41842998 GGGCTTTGGGCTTGTAGTATGGG - Intergenic
933068731 2:77832462-77832484 GGACTTGGGGCTTGGAATACGGG - Intergenic
934717384 2:96551752-96551774 AGGCTTTGGGCTTGGGGTAGAGG - Exonic
934957079 2:98631768-98631790 GGTCTCTTGCCTTGGTGTACCGG - Intronic
936263427 2:110981073-110981095 GGACTCTGGGCTGGGTGTAGTGG + Intronic
937903635 2:127041012-127041034 GGCCTTTGGGCCGGGTGCAGTGG - Intergenic
939547749 2:143574294-143574316 GGTCTTTGGGCTTTGTATATTGG - Intronic
940481668 2:154240781-154240803 GGGTTCTTGGCTTGGTGTACCGG + Intronic
942082382 2:172412908-172412930 GGCCATGGGGCTTGTTGTAAGGG + Intergenic
942766132 2:179459338-179459360 GGCATCTGGGCTTGGTGGAGTGG + Intronic
945945817 2:215994663-215994685 GGTCCTTGGGCTTGGTGTGATGG - Intronic
1172916711 20:38448801-38448823 GGGCTTTGGGGTTGGTGTAGGGG + Intergenic
1175632645 20:60555282-60555304 TGCCTTCAGGCTTGGTTTACTGG - Intergenic
1180930425 22:19586820-19586842 GGGTTTTTGACTTGGTGTACCGG + Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183923705 22:41189993-41190015 AGCTTTTGGGCTTGGGGGACAGG + Intergenic
1184388997 22:44192353-44192375 GGCCCCTGGGTTTGGGGTACAGG + Intronic
1184519771 22:44986485-44986507 GGCCTTGGGTCTTGGTGGATGGG + Intronic
1185332067 22:50256380-50256402 GGCTGCTGGGCTTGGTGCACTGG - Intronic
949879470 3:8650041-8650063 GGCCTTTGCACTTGCTGTACTGG + Intronic
951019645 3:17768278-17768300 GGCCTTTGCCAGTGGTGTACTGG + Intronic
952590881 3:34952605-34952627 GGCCATTTGGCTTAGTGTCCTGG - Intergenic
954115180 3:48463145-48463167 TGCCTTGGGGCTTGGTTTATTGG + Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
959834837 3:110906134-110906156 GGCCTTTGGGTTTGGGGTGAGGG - Intergenic
961179797 3:124867572-124867594 GGAGAATGGGCTTGGTGTACTGG - Intronic
962772010 3:138620774-138620796 GGACTTTGGGCTGGGTGCAGGGG - Intronic
965534993 3:169814105-169814127 GGGTTCTGGCCTTGGTGTACCGG + Intergenic
968019508 3:195371944-195371966 GGATTTTGGGCTGGGCGTACCGG - Intronic
968356363 3:198110689-198110711 TGGCTTTGGGCTTGGTCTCCTGG - Intergenic
970198025 4:13572433-13572455 TGCCTTTGGTCTTGGTGGATGGG + Intronic
977472248 4:97455673-97455695 GGCTTCTTGCCTTGGTGTACTGG - Intronic
978320024 4:107482750-107482772 GGTCTTTGGTCTTTGTTTACTGG - Intergenic
978634734 4:110790627-110790649 GGCCTTTGGATTTGGTGATCCGG + Intergenic
980159036 4:129137628-129137650 GGCCCTGGGACTTGGTTTACAGG - Intergenic
982244762 4:153340552-153340574 AGCCTTTTGGCTAGGTGGACGGG + Intergenic
986177648 5:5365441-5365463 GGCCTGTGGGCCTGGGGTCCTGG + Intergenic
988553294 5:32216125-32216147 GTCCTTTGGGTTTGGTGGCCTGG + Intergenic
990747987 5:58980904-58980926 GGCCTTTGGACTTGCTTTCCTGG - Intronic
994710513 5:103259133-103259155 GTCCCTTGGCCTTGGTGGACCGG + Intronic
994790440 5:104219043-104219065 GACCTTTGGAATGGGTGTACTGG - Intergenic
995216124 5:109596985-109597007 AGCCTCAGGGCTTGGTGTAGAGG + Intergenic
1001287731 5:170435984-170436006 GGGCTTTGGGCATGGTGGGCAGG - Intronic
1001766008 5:174247659-174247681 GGGCTGTGAGCTTGGTGTACAGG - Intergenic
1004688658 6:17972925-17972947 GGTCTGTGGGCTTGATGAACTGG - Intronic
1006268942 6:32949325-32949347 GGCCTTTGGCCTGGGTGTGCTGG - Exonic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1007909191 6:45496237-45496259 GGCCCTTGGGTTTGGTGGATTGG + Intronic
1007979484 6:46136632-46136654 GGCATTTGGGCTTTTTGTATAGG + Intronic
1010243522 6:73640601-73640623 GGCCACTGGGCTTGGTGTAGAGG - Intronic
1011242246 6:85285405-85285427 GGCCTCTGGGCTTGCAGTGCTGG - Intergenic
1015361710 6:132347387-132347409 GTCATTTGGGCTGGGTGTAGTGG + Intronic
1015497064 6:133893183-133893205 GGCCTGTGGGGTTGGTGGAAGGG - Exonic
1016952577 6:149594483-149594505 AGCCTGTGGTCTTGGTGTGCTGG - Intergenic
1018381301 6:163260360-163260382 GGCCTTTGTTCTTTGTGTATGGG - Intronic
1018843061 6:167532290-167532312 GGGCTCTTGCCTTGGTGTACTGG - Intergenic
1020354676 7:7263521-7263543 GCCCTTTGGTCTTGTTCTACTGG + Intergenic
1022834445 7:34100507-34100529 AGCCTTTGGGATGGGTGCACAGG - Intronic
1023366654 7:39471221-39471243 GGCCTGTGGACTTGGCTTACGGG + Intronic
1024291192 7:47805736-47805758 GGCCTCTGGTCTTGGGGTCCTGG - Intronic
1024580510 7:50796852-50796874 GGCCTTTGGGGTTGAGGGACAGG + Intergenic
1025970681 7:66321448-66321470 GGCCTTGGGCCATGCTGTACTGG - Intronic
1026680790 7:72465053-72465075 GACTTTTGGGCTTGGTGGCCTGG - Intergenic
1028724408 7:94071065-94071087 GGGCTCTTGCCTTGGTGTACCGG + Intergenic
1029748371 7:102529264-102529286 GGCCCTTGGGCTGGGTGCAGTGG - Intergenic
1029766318 7:102628351-102628373 GGCCCTTGGGCTGGGTGCAGTGG - Intronic
1030096659 7:105906639-105906661 GGCCATTGGTCATGGTGTCCTGG + Intronic
1030101808 7:105953295-105953317 GGGTTCTGGCCTTGGTGTACCGG - Intronic
1031110723 7:117605396-117605418 GGCCTTTTTGCTTGGGGTATGGG + Intronic
1032672595 7:134099007-134099029 GGCATTTGGGCTTGGCCTAAAGG + Intergenic
1032701623 7:134385380-134385402 GGCCTCTTGGCTGGGTGTAGTGG + Intergenic
1034819448 7:154203290-154203312 GGGCTTTGGGCCTGGTTTATGGG - Intronic
1036519174 8:9474619-9474641 GGCATTTCTGCTTGGTCTACCGG + Intergenic
1040299026 8:46178437-46178459 GCCCTGTGGGCTTGGGGTATGGG - Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1049206137 8:141364520-141364542 GGCCTGTGGGCGTGGGGGACAGG - Intronic
1050479312 9:6073487-6073509 GGGTTTTTGCCTTGGTGTACCGG - Intergenic
1052227119 9:26103353-26103375 GGCCTTTGGGGATGGTGTGTAGG - Intronic
1055859375 9:80730201-80730223 GGGCTTTGAGCTTGGGGAACAGG + Intergenic
1056000395 9:82210331-82210353 GGCATTTGTGCTTGGTATGCAGG + Intergenic
1056639365 9:88357538-88357560 TGCCTATGGACTTGGTGTCCTGG + Intergenic
1060102787 9:120855576-120855598 GGCTTTTGCACTTGGTTTACTGG - Intergenic
1060558280 9:124521445-124521467 GGGCCTTGGGCTTTGTGTCCTGG + Exonic
1060813304 9:126622216-126622238 GGCCTTGGCACTTGGTGAACTGG + Intronic
1061781682 9:132999903-132999925 GGCCTTGGGGCTTGGGGTTAGGG - Intergenic
1061952717 9:133945319-133945341 GGCCTTTGGGCTTGAGGGGCAGG + Intronic
1186953777 X:14657512-14657534 GCCCTCTGGGCATGGTGTCCTGG + Intronic
1188797530 X:34484175-34484197 GGCCTGGGGGCTTGTTGTGCAGG + Intergenic
1189926091 X:45957138-45957160 GGACTTTGGGCTGGGTGCAGTGG + Intergenic
1190243523 X:48676238-48676260 GGCCTTGGCGCCTGGTGCACTGG - Intergenic
1192960388 X:76124315-76124337 GGCCTTTGGACTAGGTGTCCAGG - Intergenic
1197459626 X:126724238-126724260 GGGTTCTTGGCTTGGTGTACTGG - Intergenic
1197487675 X:127074352-127074374 GGACTTTGGGCTGGGTGTGGTGG - Intergenic
1200057106 X:153467408-153467430 GGCCTTTGAGCTTTATGTTCTGG - Intronic