ID: 1151635710

View in Genome Browser
Species Human (GRCh38)
Location 17:75346418-75346440
Sequence CCTGGGAGGCAGAAGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151635703_1151635710 16 Left 1151635703 17:75346379-75346401 CCAGCTACTCGGGGGGCTGAGGC 0: 744
1: 98858
2: 263280
3: 219642
4: 133595
Right 1151635710 17:75346418-75346440 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1151635697_1151635710 25 Left 1151635697 17:75346370-75346392 CCTGTAGTCCCAGCTACTCGGGG 0: 605
1: 58876
2: 183596
3: 272313
4: 193066
Right 1151635710 17:75346418-75346440 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1151635701_1151635710 17 Left 1151635701 17:75346378-75346400 CCCAGCTACTCGGGGGGCTGAGG 0: 833
1: 104670
2: 290917
3: 226845
4: 121967
Right 1151635710 17:75346418-75346440 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151635710 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG Intronic
Too many off-targets to display for this crispr