ID: 1151636113

View in Genome Browser
Species Human (GRCh38)
Location 17:75349426-75349448
Sequence AAACCTTCGAGGACACATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151636103_1151636113 26 Left 1151636103 17:75349377-75349399 CCTCCCTGTTGCCTTTAGCCTGC 0: 1
1: 0
2: 4
3: 27
4: 213
Right 1151636113 17:75349426-75349448 AAACCTTCGAGGACACATGTAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1151636109_1151636113 -10 Left 1151636109 17:75349413-75349435 CCTGAGAGCCCAGAAACCTTCGA 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1151636113 17:75349426-75349448 AAACCTTCGAGGACACATGTAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1151636108_1151636113 8 Left 1151636108 17:75349395-75349417 CCTGCTAAGGCTGTAAAACCTGA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1151636113 17:75349426-75349448 AAACCTTCGAGGACACATGTAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1151636104_1151636113 23 Left 1151636104 17:75349380-75349402 CCCTGTTGCCTTTAGCCTGCTAA 0: 1
1: 0
2: 0
3: 27
4: 190
Right 1151636113 17:75349426-75349448 AAACCTTCGAGGACACATGTAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1151636105_1151636113 22 Left 1151636105 17:75349381-75349403 CCTGTTGCCTTTAGCCTGCTAAG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 1151636113 17:75349426-75349448 AAACCTTCGAGGACACATGTAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1151636107_1151636113 15 Left 1151636107 17:75349388-75349410 CCTTTAGCCTGCTAAGGCTGTAA 0: 1
1: 0
2: 1
3: 7
4: 95
Right 1151636113 17:75349426-75349448 AAACCTTCGAGGACACATGTAGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151636113 Original CRISPR AAACCTTCGAGGACACATGT AGG Intronic
907138421 1:52161088-52161110 AATCCTTAGAAGATACATGTGGG - Intronic
922927226 1:229360013-229360035 AAAGCTTGGAGGACATATTTGGG - Intergenic
1064142095 10:12799101-12799123 AAACCCTGGAGGACACGGGTGGG + Intronic
1066973751 10:42344073-42344095 AAATCTTAGAAGACAAATGTAGG + Intergenic
1070511074 10:77161119-77161141 CAGCCTTCAAGGACAGATGTGGG + Intronic
1074430204 10:113387867-113387889 AAACCCTGGAGCACAGATGTTGG + Intergenic
1075129764 10:119727433-119727455 CAACCTTACAGGACACGTGTGGG + Intronic
1081520818 11:43879426-43879448 AAAACCTCTAGGACATATGTAGG - Intergenic
1090371453 11:126256731-126256753 AAAGCTTCGAGAAAACATGCTGG + Exonic
1090865411 11:130696519-130696541 AAACCTTTGAGCACACATATGGG - Intronic
1096385972 12:51195797-51195819 GAACCTGTGTGGACACATGTGGG + Intronic
1098865634 12:75760031-75760053 AAACCTTCAAAGTCACATGTGGG + Intergenic
1099178574 12:79452290-79452312 AAACCCTGAAGGACACATGCTGG - Intergenic
1101921753 12:108938726-108938748 ATGCATGCGAGGACACATGTGGG - Intronic
1104289230 12:127453765-127453787 AAAAGTTGGAGGACACATTTTGG + Intergenic
1109675414 13:65669507-65669529 AAATCTTTAAGGACACATATAGG - Intergenic
1114013634 14:18402667-18402689 AAATCTTAGAAGACAAATGTAGG + Intergenic
1116279471 14:42884464-42884486 TAACTTTGGAGGACACATTTAGG + Intergenic
1128079676 15:64848917-64848939 ATACCTCCGAGGACAAATCTAGG + Intronic
1129449863 15:75645216-75645238 AACCCGTCTAGAACACATGTGGG + Intronic
1131398547 15:92106293-92106315 CAACCTTAGAGGACACAGATTGG - Intronic
1139784020 16:69376155-69376177 AAAACTTAGAGGAAACATGAAGG - Intronic
1140332048 16:74067931-74067953 AAACAATCGAGGTCAGATGTGGG - Intergenic
1144017531 17:11210104-11210126 CAACCTTCCAGGGCTCATGTGGG - Intergenic
1147765660 17:42833889-42833911 ACACCTCCGCGGACACGTGTTGG + Intronic
1151636113 17:75349426-75349448 AAACCTTCGAGGACACATGTAGG + Intronic
1162607630 19:11722981-11723003 AAACCTCCGAAGACACATGGCGG - Exonic
1162672907 19:12273099-12273121 AAGCTTTCGAAGACACATGATGG - Exonic
1162779003 19:12996853-12996875 AAAGCTTCGAGGATGCCTGTCGG + Intronic
1166933472 19:46316431-46316453 AAAGCTTCTATGACACATGATGG - Intronic
926908413 2:17827294-17827316 AAATTTTCGAGGACACATTCAGG + Intergenic
927948569 2:27152322-27152344 AAACCTTGGAGGACCCAGCTTGG + Intronic
929434227 2:41915168-41915190 AAATCTTAGAGGACACTTGCTGG - Intergenic
931097569 2:58958466-58958488 AAACCTTCATGGACACAGGGTGG + Intergenic
942726181 2:179010208-179010230 AAACCTTGGAAGACATATTTGGG + Intronic
948612216 2:239177072-239177094 CCACCTTCGAGGGAACATGTGGG - Intronic
948862191 2:240758034-240758056 AAACTTTCCAGGTCACCTGTTGG - Intronic
1169414316 20:5402975-5402997 AAACCTGTGAGAACACCTGTGGG - Intergenic
1171095108 20:22325376-22325398 AAACCTCCTAGGACAGATTTGGG - Intergenic
1173438604 20:43055371-43055393 AAAACGTCGAGGAAACATCTGGG + Intronic
1180438129 22:15333482-15333504 AAATCTTAGAAGACAAATGTAGG + Intergenic
949619692 3:5796546-5796568 AACCCTTCAAGGTCACAAGTGGG + Intergenic
958810524 3:98856284-98856306 AAACCTCAGAGGAAACATTTAGG + Intronic
959279906 3:104324528-104324550 AAAGCTTGGAAAACACATGTGGG + Intergenic
960600928 3:119457543-119457565 CCACCTTGGAGGTCACATGTTGG + Intronic
961944427 3:130671234-130671256 AATGCTGCAAGGACACATGTGGG + Intronic
962025442 3:131542474-131542496 AAACATTGGTGGACAAATGTGGG + Intronic
964838150 3:160963617-160963639 AAACCTTGAAGGACAAATGGTGG + Intronic
968059645 3:195717552-195717574 AAAGCTTCCAGGTCACAGGTGGG - Intergenic
971192994 4:24445546-24445568 AAACCTCTCAGGAAACATGTTGG + Intergenic
972010264 4:34170605-34170627 AAACTTTCAAGAACACATTTTGG - Intergenic
972101755 4:35428826-35428848 ATAGATTCCAGGACACATGTGGG - Intergenic
977789696 4:101084952-101084974 AAGCCTTTGAAGACACATGTTGG - Intronic
980008736 4:127570962-127570984 AAACCTTTGAATTCACATGTGGG + Intergenic
981878982 4:149585358-149585380 AAACTTTAGAGTCCACATGTTGG - Intergenic
983236254 4:165183165-165183187 AACTCTTCGAGGCCACATTTTGG - Intronic
990276572 5:54203212-54203234 AAACCTCAGAGGACACAAATCGG + Intronic
992855733 5:80859638-80859660 AAACAGTGGAAGACACATGTAGG - Intronic
994442349 5:99825335-99825357 ACACCTTCCTGGACACATATTGG - Intergenic
996961038 5:129250145-129250167 ACACATTCGATGACACATTTAGG + Intergenic
1000091502 5:157933271-157933293 AAACCTTTTAGGCCACATCTGGG + Intergenic
1001239349 5:170056323-170056345 AATCCTTTGAGGACACCTCTGGG + Intronic
1004362160 6:14980811-14980833 CACCCTTCGAGGACAAAGGTGGG - Intergenic
1012521036 6:100121518-100121540 AAACCTGCCAGAAAACATGTTGG + Intergenic
1017502099 6:155035035-155035057 AAAGCTTCGTGGACCCATATAGG - Intronic
1024941886 7:54772008-54772030 AAAACTTCTAGGAAAAATGTAGG + Intergenic
1028362491 7:89985911-89985933 AGACCTTCCAGGTCACAGGTGGG - Intergenic
1028993319 7:97074077-97074099 AAAGCTTGGAAGACACATTTAGG - Intergenic
1032766164 7:134995933-134995955 AAGCCATCAAGGACACATGTGGG - Intronic
1033621610 7:143066754-143066776 AAACCAATGAGCACACATGTTGG + Intergenic
1034729654 7:153375690-153375712 AAACCTTAGAAGAAAAATGTAGG - Intergenic
1037225733 8:16587328-16587350 AAACCTTGGCTGACATATGTAGG + Intergenic
1038707205 8:29905656-29905678 AAATGTTAGAGGACACAGGTGGG + Intergenic
1040326695 8:46348461-46348483 AAACCTGCGAGGTGACATTTTGG + Intergenic
1043808798 8:84708265-84708287 AAACCTTTGAAGATTCATGTGGG + Intronic
1045775685 8:105799781-105799803 AAACCTTGTAGGACACCTCTGGG + Intronic
1049361768 8:142215458-142215480 CAATCTTGGGGGACACATGTGGG - Intronic
1058909069 9:109504592-109504614 AGACCTTCAAGGACACTTGTGGG + Intergenic
1059584931 9:115595900-115595922 CAACCTTCCATTACACATGTGGG + Intergenic
1059903205 9:118952185-118952207 AAACCTACGAGGGTACATATTGG + Intergenic
1194164181 X:90494445-90494467 AAACCTAAGAGCACACTTGTTGG + Intergenic
1194653758 X:96546534-96546556 AAGCCTCAGAGGACACATGAAGG + Intergenic
1200510441 Y:4072257-4072279 AAACCTAAGAGCACACTTGTTGG + Intergenic