ID: 1151636767

View in Genome Browser
Species Human (GRCh38)
Location 17:75354531-75354553
Sequence ATTAGATTCTTACAAGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 5, 2: 53, 3: 88, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151636767_1151636770 -7 Left 1151636767 17:75354531-75354553 CCCGCTCCTTGTAAGAATCTAAT 0: 1
1: 5
2: 53
3: 88
4: 203
Right 1151636770 17:75354547-75354569 ATCTAATGCCTGATGATCTGAGG 0: 605
1: 945
2: 803
3: 457
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151636767 Original CRISPR ATTAGATTCTTACAAGGAGC GGG (reversed) Intronic
901581503 1:10247896-10247918 GTTAGATTCTCATAAGGAGCGGG + Intronic
902313444 1:15599647-15599669 GTTAGATTCTCATAAGGAGTGGG + Intergenic
903122996 1:21228459-21228481 CTGAGGTTCTTACAAAGAGCAGG + Intronic
904125016 1:28232226-28232248 ATTAAATTATTGCAAGGGGCTGG - Intronic
904294659 1:29511506-29511528 GTTAGATTTTCATAAGGAGCAGG + Intergenic
904789233 1:33006114-33006136 ATTAGATTCTCACAAGGAGCGGG + Intergenic
904811535 1:33166112-33166134 ATTAGATTCTCATAAGGAGCAGG - Intronic
905082897 1:35340565-35340587 ATTAGATTCTCATAATGGGCAGG + Intronic
906089879 1:43169928-43169950 ATTAGATTCTCATAAGGAGCAGG - Intronic
906926767 1:50126026-50126048 ATTAGATGCCTACTAGGTGCCGG - Intronic
908172203 1:61516459-61516481 GTTAGATTCTCATAAGGAGCAGG - Intergenic
909093647 1:71259050-71259072 ATTAGCTTCTTAAAAGGTTCAGG + Intergenic
909235388 1:73146795-73146817 ATTAGATTCTCATAAGAAGCAGG - Intergenic
909660489 1:78076493-78076515 ATTAGATTATCATAAGGTGCAGG + Intronic
910045289 1:82906297-82906319 ATTAGATTCTTCTAATGGGCAGG + Intergenic
910545224 1:88408316-88408338 ATTAGATTCTCATAAGAAGCAGG + Intergenic
910712157 1:90193274-90193296 ATTACCTTCTTTCAAAGAGCTGG - Intergenic
910868927 1:91813876-91813898 GTGAGATTCTCATAAGGAGCAGG + Intronic
911147059 1:94562557-94562579 ATTAGACTCTCATAAGGAGCGGG + Intergenic
911494678 1:98616599-98616621 ATTAGATTCTCATAAGAAGGGGG - Intergenic
911898198 1:103466873-103466895 ATTAGATTCTCATAAGGAGTGGG + Intergenic
912062580 1:105690975-105690997 ATTAGATTGTCATAAGGAGCAGG - Intergenic
912248355 1:107984742-107984764 ATTAGATATTCACAAAGAGCTGG + Intergenic
912456470 1:109801705-109801727 ATAACTTTCTTACAAGCAGCTGG + Intergenic
913579427 1:120211051-120211073 ATTAGATCCTCATAAGAAGCAGG - Intergenic
913628745 1:120687337-120687359 ATTAGATCCTCATAAGAAGCAGG + Intergenic
914231882 1:145769674-145769696 ATTAGTTTCATAAAAGGAACTGG - Intronic
918080629 1:181205241-181205263 TTTAAATTCTTACAAGAAGCAGG + Intergenic
918762744 1:188434771-188434793 ATTAGATTCTTATAAGGAGTGGG + Intergenic
918772266 1:188576665-188576687 ATTAGATTCTAAGAAAGGGCTGG + Intergenic
921006001 1:211094192-211094214 ATTAGATTCTCATAAGGAGCAGG + Intronic
922059137 1:222070739-222070761 ATCAGAGTCTTACAAGCAGCGGG + Intergenic
922118616 1:222639370-222639392 ATCAGCTTCATACAATGAGCTGG - Intronic
924072744 1:240298675-240298697 ATTAGGTTCTCATAAAGAGCAGG - Intronic
924337391 1:242997660-242997682 ATCAGGTTCTTAAAAGGATCTGG - Intergenic
1063281960 10:4639438-4639460 ATTATTTTCTTACAATAAGCAGG + Intergenic
1065931554 10:30483766-30483788 ATTAGATTTTCATAAGGAGCAGG - Intergenic
1066242102 10:33547985-33548007 TTTAGATTCTTATAAGGAGAGGG + Intergenic
1066280574 10:33913779-33913801 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1069358450 10:67614493-67614515 ATTAGATTCTCATAAGGAGTAGG + Intronic
1070842722 10:79498786-79498808 GTAAGATTCTCATAAGGAGCCGG - Intergenic
1072672305 10:97439489-97439511 ATTAGATTCTCATAAGGAGTGGG - Intronic
1072990410 10:100186947-100186969 ATTAGATTCTCACAGGGAGCCGG + Exonic
1073199932 10:101727117-101727139 GTTAGATTCTCATAAGGAGTGGG + Intergenic
1074409641 10:113215465-113215487 ATTGAATTCTCAGAAGGAGCAGG - Intergenic
1074568528 10:114603361-114603383 GTGAGATTCTGACTAGGAGCAGG + Intronic
1074821931 10:117186132-117186154 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1075880622 10:125847799-125847821 ATTAGATTCTCATAAGGAGCGGG + Intronic
1075927840 10:126267510-126267532 ATTAGATTCTCATAAGGAGCAGG + Intronic
1075977939 10:126713018-126713040 ATTAGATTCTTATAAGGAGAGGG - Intergenic
1075993447 10:126857549-126857571 ATTAGATCCTCACAAGGAGCTGG - Intergenic
1076201340 10:128561067-128561089 ATTAGATTCTCATAAGGAGTGGG + Intergenic
1076532220 10:131152670-131152692 AGTAAATTCTTACCAGGAGTGGG - Intronic
1076621221 10:131789382-131789404 ATTAGATTCTCATAAGCAGTGGG - Intergenic
1077426493 11:2481730-2481752 ATTAGATTCTTATAAAGAGGAGG - Intronic
1077468285 11:2744161-2744183 AAGAGATTATTACAGGGAGCTGG + Intronic
1077791311 11:5443261-5443283 ATTAGATGGTGACAAGGTGCTGG + Intronic
1080014384 11:27489404-27489426 ATTAGATTCTCACAACAAGTGGG + Intergenic
1080426813 11:32162756-32162778 ATTAGATTGTTAGAAAGAGCAGG - Intergenic
1084158888 11:67333637-67333659 ATTAGATTCTCATAAGGAGCTGG - Intronic
1084768818 11:71329542-71329564 ATTAGATTCTCATAAGGAGTGGG + Intergenic
1085503899 11:77044911-77044933 AGTAGATTCTCATAAGGAGCAGG + Intergenic
1085938254 11:81176751-81176773 ATTAGATTCTCATAAGGAGTGGG + Intergenic
1087325293 11:96714433-96714455 TTTTGATTATTACAAGAAGCTGG + Intergenic
1087445746 11:98250375-98250397 ATTAGTTACATACAAAGAGCAGG - Intergenic
1087656472 11:100929184-100929206 GTTAGATTCTCATAAGGAGCAGG + Intronic
1089208046 11:116780782-116780804 ATTGTCTTCTTACAAGTAGCGGG - Intronic
1090485386 11:127107970-127107992 ATTAGATTCTTATAAGGAGCAGG - Intergenic
1091936069 12:4435378-4435400 GTTAGATTCTCAGAAGGAGCAGG - Intronic
1094344124 12:29448136-29448158 ACTAGATTATCATAAGGAGCAGG + Intronic
1094412403 12:30180642-30180664 ATAATGTTCTTACAAGGAACAGG - Intergenic
1094650028 12:32366822-32366844 ATTAGAATCATGCAAGAAGCTGG - Intronic
1096061320 12:48703037-48703059 ATTAGATTCTCATAAAGAGCAGG - Intronic
1097050114 12:56217805-56217827 ATTAGATTCTCATAGGGAGTGGG - Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1100092792 12:90992133-90992155 ATTAGATTCTCATAAGAAGCAGG + Intronic
1100324827 12:93531016-93531038 ATTAGATTTTCATAAGGAGCGGG + Intergenic
1100715662 12:97302565-97302587 ATTAGATGCTCATAAGGAGTGGG + Intergenic
1103886693 12:124207822-124207844 ATTCGATTCTTACAAGTGGAGGG + Intronic
1104205716 12:126636428-126636450 ATTATATTCTTAGAATGATCAGG + Intergenic
1104624557 12:130340426-130340448 ATTAGATTCTCATAAGGAGCAGG + Intronic
1104680302 12:130746531-130746553 ATTGGATTCTCCTAAGGAGCAGG + Intergenic
1107797195 13:44064921-44064943 ACTAGATTCTCATAAGGAGCAGG + Intergenic
1108588879 13:51894947-51894969 GTTAGATTCTCATAAGGAGTGGG + Intergenic
1109373563 13:61458138-61458160 ATTAGATTCTCATAAAGAGCAGG - Intergenic
1111070625 13:83161224-83161246 GTGAGATTCTTAACAGGAGCAGG + Intergenic
1111225136 13:85260927-85260949 ATTAGACTCTTAAAGGGAGAAGG + Intergenic
1111592665 13:90370184-90370206 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1112022507 13:95383956-95383978 ATTAGATTCTCATAAGGAGGGGG - Intergenic
1112032971 13:95474223-95474245 ATTAGATTCTGATAAGGAGGAGG + Intronic
1113988049 13:114335012-114335034 AATAGATTCATTGAAGGAGCTGG + Intergenic
1114871941 14:26669167-26669189 ATTTGATTCTTGCAAGCAGTGGG - Intergenic
1114890444 14:26915091-26915113 ATTAGATTCTCATAAAGAGCAGG + Intergenic
1116643538 14:47496936-47496958 ATTAGATTCTCATAAGGAGCAGG + Intronic
1116966078 14:51016395-51016417 ATTAGATTCTCATAAGGAGCGGG - Intronic
1119012147 14:71004489-71004511 ATTGGATTCTCATAAGGAGTGGG - Intronic
1119121581 14:72084191-72084213 ATTAGATTCTCATAAGGAGTGGG + Intronic
1119122246 14:72090462-72090484 ATTAGATTCTCATAAGGAGCAGG - Intronic
1119203732 14:72778382-72778404 ATTAGATTCTCATAAGGAGTGGG - Intronic
1119772693 14:77230652-77230674 GTTAGAGTCTCATAAGGAGCAGG - Intronic
1121319503 14:92982837-92982859 CTTAGATGCCTTCAAGGAGCAGG - Intronic
1202833739 14_GL000009v2_random:62644-62666 ATTAGATTATGACAGGGAGAGGG + Intergenic
1202894258 14_KI270722v1_random:189074-189096 ATTAGATTATCATAAGGAGCAGG - Intergenic
1123726658 15:23109893-23109915 ATCTGATTTTTATAAGGAGCTGG + Intergenic
1125860746 15:42997213-42997235 ATTAGATTTTCATAAGGAGTGGG - Intronic
1126434162 15:48618860-48618882 ATTAGATTCTCATAAGGAGTGGG - Intronic
1126907150 15:53380177-53380199 ATTAGATTCTTGTAAGGGTCCGG + Intergenic
1127884085 15:63183932-63183954 ATTAGATTCTCATAAGGAGTGGG - Intergenic
1128110546 15:65073402-65073424 ATTAGATTGTCATAAGGAGCAGG + Intronic
1128855954 15:71015390-71015412 ATTAGATTCTCATAAGGAGTGGG + Intronic
1129150803 15:73686629-73686651 ATTTGAGTTTGACAAGGAGCTGG + Intronic
1131703948 15:94972384-94972406 ATTAGACTCATACAAGGAGCTGG + Intergenic
1132170814 15:99652263-99652285 ATTAGATTCTCATAAGGAATGGG + Intronic
1135191433 16:20357869-20357891 ATTAGATTCTCATAAGGAGCCGG + Intergenic
1135853335 16:25984317-25984339 ATTAGATTCTCATAAGGAGCAGG + Intronic
1138100968 16:54252223-54252245 ATTAGATTCTCATAAGGAGCAGG - Intronic
1139962256 16:70724732-70724754 AGAAGATTCACACAAGGAGCTGG + Intronic
1141281418 16:82632904-82632926 ATTAGACTCTCATAAGGAGAAGG + Intronic
1146168467 17:30612352-30612374 GTTAGATTCTCATAAGGAGCAGG + Intergenic
1146221435 17:31025852-31025874 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1146393328 17:32442846-32442868 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1149086092 17:52717924-52717946 ATTAGACTCTTACAGGTGGCGGG + Intergenic
1149150090 17:53551238-53551260 ATTAGAGTCTAAAAAAGAGCAGG - Intergenic
1149314707 17:55428108-55428130 ATTAGATTCTCATAAGGAGCGGG - Intergenic
1150366364 17:64589654-64589676 ATGAGAGTCTCATAAGGAGCTGG - Intronic
1151413425 17:73946235-73946257 ATTAGATTCTCATAAGAGGCTGG + Intergenic
1151573712 17:74940652-74940674 ATTAGATTCTCATGAGGAGTGGG - Intronic
1151636767 17:75354531-75354553 ATTAGATTCTTACAAGGAGCGGG - Intronic
1153144594 18:2016248-2016270 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1153218308 18:2840298-2840320 ATTAGGTTCTTACAAGCCTCTGG - Intergenic
1153342342 18:3988507-3988529 ATTAGATTCTCATAAGGAGCGGG + Intronic
1153540145 18:6145327-6145349 AGTACATTCTTAGAAGGAGGAGG - Intronic
1155394153 18:25368471-25368493 ATTAGATTCTCATAAGGAGCTGG + Intergenic
1155668759 18:28344071-28344093 ATTAGATTCTCATAACGAGCAGG + Intergenic
1155908308 18:31478860-31478882 ATTAGATTATCATAAGGAGCAGG + Intergenic
1156053033 18:32961651-32961673 ATTCGATTCTCATAAGGAGCAGG + Intronic
1156215739 18:34996333-34996355 ATTAGATTTTCATAAGCAGCGGG + Intronic
1157474055 18:48010120-48010142 GTTAGATCCTCATAAGGAGCAGG - Intergenic
1158421080 18:57294885-57294907 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1159853549 18:73556970-73556992 ATCAGATTCTCACTAGGAGGGGG - Intergenic
1161874960 19:6901239-6901261 GTTACATTATTACAAGGAGGAGG + Intronic
1161922088 19:7274190-7274212 GTTAGATTCTCATAAGGAGCAGG + Intronic
1163272659 19:16263484-16263506 ATTGGCTTCTTAGAAAGAGCTGG - Intergenic
1165479233 19:36052348-36052370 ATTAGATTCTCATAAAAAGCGGG - Intronic
1166017177 19:39991083-39991105 ATCAGATTCTCATAAGGAGCGGG + Intronic
1166233749 19:41441394-41441416 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1202638933 1_KI270706v1_random:65048-65070 ATTAGATTATGACAGGGAGTGGG - Intergenic
924982714 2:237775-237797 ATTAAATTATTACAAGTACCAGG + Intronic
925852322 2:8094452-8094474 ATTAGAATCTTCTAAGGAGAGGG + Intergenic
925892983 2:8451075-8451097 ATTAGATTCTCATAAGGAGCAGG + Intergenic
926374746 2:12215359-12215381 ATTAGATTCTCACAAGGAGCAGG - Intergenic
926919273 2:17924849-17924871 ACTAGCTTCATAGAAGGAGCTGG + Intronic
927316126 2:21685345-21685367 ATTATATTATTACTAGGAGATGG - Intergenic
928098678 2:28422083-28422105 ATTATATTCTTACAGGGATGAGG + Intergenic
929209473 2:39339204-39339226 ATTAGATTATTTTAAGGACCGGG + Intronic
930390050 2:50749335-50749357 TTTAGATTCTAACATAGAGCAGG - Intronic
930797168 2:55405742-55405764 ATTAGATTCTCATAAGGAGTGGG - Intronic
932075516 2:68659260-68659282 ATCAGAGTCTTACAAAGGGCAGG + Intergenic
932638501 2:73415749-73415771 ATTGGATTCATGCAAGGAGACGG + Intronic
933227833 2:79771572-79771594 ATTAAATTCTCATAAGGATCTGG + Intronic
935419096 2:102848432-102848454 ATTAGATTCTTATCATCAGCAGG + Intergenic
937014216 2:118588884-118588906 CTTAGATTCTCATAAGGAGGAGG + Intergenic
938580607 2:132642981-132643003 ATGAGATGCAAACAAGGAGCAGG + Intronic
938602981 2:132862180-132862202 ATTAGATTCATACAAGGTTATGG - Intronic
939296531 2:140272947-140272969 ACCAGATTCTCACAATGAGCAGG - Intronic
939342722 2:140920047-140920069 TTTACATTCCTACAAGTAGCTGG + Intronic
939739576 2:145888821-145888843 TTTTGGTTCTTACAAGGAGGAGG - Intergenic
940646067 2:156394086-156394108 ATTAGATTCTTATAAGGAGCCGG + Intergenic
941350059 2:164420738-164420760 GTTAGATTCTCATAAGGAGCAGG + Intergenic
941466651 2:165836012-165836034 ATTAAATTATTACAAGGAACTGG + Intergenic
942477648 2:176344818-176344840 GTTAGATTCTTATAAGGATCAGG - Intergenic
942486731 2:176447614-176447636 CTTACATGCTTACAAGGTGCAGG - Intergenic
942565062 2:177257828-177257850 ATTAGATTGTCCTAAGGAGCTGG - Intronic
942570647 2:177310732-177310754 ATGACATTCTTCCAAGGGGCAGG + Intronic
943120019 2:183724142-183724164 ATTAGATTCTCGTAAGGAACAGG - Intergenic
943244674 2:185431417-185431439 AATAGATTCTCATAAGGAGTAGG - Intergenic
944991605 2:205243822-205243844 ATTCGATTCTCACAACGACCTGG - Intronic
947794884 2:232888038-232888060 TTTGGATGCTCACAAGGAGCTGG - Exonic
948654724 2:239469469-239469491 ATTAGATTCTCATAAGAGGCAGG + Intergenic
1170435533 20:16324211-16324233 AACAGATTTTTACAGGGAGCAGG + Intronic
1171096357 20:22335957-22335979 ATTTGATTCTTACAACAAGCTGG - Intergenic
1174906470 20:54557333-54557355 ATTAGATTCTCATAAGGAGCAGG + Intronic
1175555978 20:59857184-59857206 ATGAGGAACTTACAAGGAGCTGG + Intergenic
1176945275 21:14972777-14972799 ATTAGATTCTTATAAACAGTGGG + Intronic
1177127419 21:17212821-17212843 GTTAGATTCTCATAAGGAGCAGG + Intergenic
1177264993 21:18771219-18771241 ATTTGATAGTTACTAGGAGCAGG - Intergenic
1178672948 21:34608002-34608024 ATTAGATTCTCATAAGGAGTGGG - Intronic
1178694488 21:34781192-34781214 ATTAGTGTCTTACAAAGGGCTGG - Intergenic
1180363018 22:11916815-11916837 ATTAGATTATGACAGGGAGTGGG + Intergenic
1183700946 22:39450629-39450651 ATCAGATTCTCAAAGGGAGCAGG - Intergenic
951011187 3:17681968-17681990 GTTAGATTCTCATAAGGTGCAGG - Intronic
951374339 3:21895255-21895277 ATGAGATTCCTACAAGTAGCTGG + Intronic
953203711 3:40801017-40801039 ATTATATTCCTACCAGGAACTGG - Intergenic
953861592 3:46548838-46548860 ATTAGATTCTCATAAGCAGTGGG + Intronic
955291995 3:57700803-57700825 ATTAGATTCTCCTAAGGAGCAGG + Intergenic
955572810 3:60326360-60326382 ATTAGGTTCTCATAAGGAGCGGG + Intronic
955698881 3:61663757-61663779 ATTAGAGCCTCATAAGGAGCGGG + Intronic
956192142 3:66618231-66618253 ATTGGATTTTAACAAGGAGTAGG + Intergenic
956287289 3:67624083-67624105 ATTAGATCCTTAGAAGGAGCAGG - Intronic
956438668 3:69259171-69259193 ACTAGATTCTCAAAAGGAGTAGG + Intronic
956545499 3:70396777-70396799 ATTTTTTTCTTACAAGGAGCAGG + Intergenic
956727492 3:72168448-72168470 ATTAGATTGTCATAAGGAGCGGG - Intergenic
957030478 3:75235255-75235277 AGTAAATTGTTACAAGGAGTTGG + Intergenic
957212787 3:77281806-77281828 AGTAGATTCTCATAAGGAGCAGG + Intronic
957377070 3:79371965-79371987 ATTAGATTCTCATAGGGAGCAGG + Intronic
959638638 3:108605565-108605587 ATTAGATTCTCACAAGGAGTGGG + Intronic
961230536 3:125303564-125303586 ATTAGGTTCTCATAAGGAGCAGG - Intronic
961741751 3:129037297-129037319 ATTAGCTTCTTAAAATGACCTGG - Intronic
962959499 3:140297449-140297471 ACTTGATTCTCACAATGAGCTGG + Intronic
964566309 3:158057747-158057769 ATTAGATGCAGAAAAGGAGCTGG + Intergenic
965724905 3:171704902-171704924 GTTAGACTCTCATAAGGAGCGGG + Intronic
966158679 3:176945775-176945797 GTTAGATTCTCATAAGGAGCGGG - Intergenic
966363418 3:179154399-179154421 ATTAGATTCTCATTAGGAGCAGG - Intronic
966556817 3:181271656-181271678 ATTAGATCCCCATAAGGAGCAGG - Intergenic
966859001 3:184218086-184218108 GTTAGATTCTCATGAGGAGCAGG - Intronic
967208673 3:187147637-187147659 ATTAGATTACCATAAGGAGCGGG + Intronic
967601084 3:191390155-191390177 ATCAGATTCTTAAAAGGTGGTGG + Intronic
968034532 3:195535165-195535187 ATTAGACTCTCATAAGGAGTGGG + Intronic
969957045 4:10901610-10901632 AAAAGATTCTTACAGGCAGCAGG + Intergenic
971541095 4:27817624-27817646 ATTAGATTTTCATAAGGAACAGG - Intergenic
971599351 4:28572417-28572439 CTTAGATTCTTCCAGGGAGCAGG - Intergenic
972368645 4:38399823-38399845 ATTAGATTCTCACAAGGAGCAGG - Intergenic
972660468 4:41111040-41111062 ATTAGATTCTCATAACGAGTGGG + Intronic
973829844 4:54747626-54747648 ATTAGATTCTCATAAGAAGTGGG + Intergenic
974354484 4:60794705-60794727 GTTAAACTCTCACAAGGAGCGGG - Intergenic
974401723 4:61416976-61416998 ATTAGATTCTCATAAGAAACAGG + Intronic
976508501 4:85879893-85879915 ATTAGATTCTCATAAGGAGCAGG + Intronic
976691473 4:87871994-87872016 ATTTTATTCATACAAGAAGCAGG - Intergenic
976705605 4:88016012-88016034 GTGAGATTCTCATAAGGAGCAGG + Intronic
977810539 4:101350270-101350292 ATTAGATTCTCATAAGGAGCGGG + Intergenic
977910134 4:102524748-102524770 GTTAGATTCTCATAAGGAGCGGG + Intronic
978754496 4:112287301-112287323 ATTAGATTCTCATAAGAAGCGGG + Intronic
979055147 4:115984174-115984196 ATTAGATTCTCATAAGGTGTGGG - Intergenic
979351146 4:119645955-119645977 GTTAGATTCTTATAAGGAATGGG - Intergenic
979379453 4:119992247-119992269 AGTAGATTGTTACCAGAAGCTGG + Intergenic
979478257 4:121183766-121183788 ATTAGATTCTCATAAGGAGCAGG - Intronic
979911076 4:126366352-126366374 ATTATATTCTTACTATGATCTGG - Intergenic
982282980 4:153704836-153704858 ATTTGTTTCTTACAGTGAGCGGG + Exonic
982635673 4:157893964-157893986 TTCAGATTCTAACAAGGAGGAGG + Intergenic
983358732 4:166700607-166700629 CTTAGCTTTTTGCAAGGAGCAGG - Intergenic
983437009 4:167729167-167729189 AGTAGATGCTAACAAGCAGCTGG - Intergenic
983700114 4:170581480-170581502 GTTAGATTCTCATAAGGAGCAGG + Intergenic
983813441 4:172093293-172093315 ATTAGATTATTATAAGCAGTAGG - Intronic
984079817 4:175233422-175233444 ATTAGATTCTCATAAGGAGCGGG - Intergenic
984610727 4:181834056-181834078 TTTAGATTCATACATGCAGCAGG + Intergenic
1202766280 4_GL000008v2_random:150907-150929 ATTAGATTATGACAGGGAGTGGG - Intergenic
986021421 5:3807605-3807627 ATTAGATTCTCCTAAGGAGTGGG - Intergenic
986293374 5:6417991-6418013 ATTAGATTCTCATTAGGAGCTGG - Intergenic
987017875 5:13838527-13838549 ATTAGATTCTTGTAAGGAGTGGG - Intronic
987835163 5:23151104-23151126 ATTAGATTATTATAAGGAGCGGG - Intergenic
988174404 5:27702776-27702798 ACTAGATTCTTAAAAGCAGAGGG - Intergenic
988852591 5:35194220-35194242 ATTAGATGCCTACAAAGTGCTGG + Intronic
989465656 5:41752279-41752301 ATTTGATTCCTACAATGATCAGG - Intronic
990044901 5:51417234-51417256 GAGAGATTCTTACAAGAAGCAGG - Intergenic
990660801 5:58013308-58013330 ATTAAATTCTTACATGAAGTTGG + Intergenic
991168177 5:63588083-63588105 ATTAGATGCTTACAAAGTCCTGG + Intergenic
991316170 5:65309323-65309345 ATTAGATTCTCAGAAAGAGTGGG + Intronic
991580667 5:68151953-68151975 CGTAGATTCCTACAAGGGGCTGG + Intergenic
992096375 5:73366641-73366663 GTTAGATTCTCATAAGGAGCAGG + Intergenic
992151207 5:73905218-73905240 ATTAGATTCTCATAAGGAGGGGG - Intronic
996136599 5:119849964-119849986 ATATGAATCTTACAATGAGCTGG - Intergenic
996614356 5:125422631-125422653 TTTAGATTCTCACAAGGAGCAGG - Intergenic
996622276 5:125521645-125521667 ATTAGAATCTTCCAAGTAGAAGG - Intergenic
997272672 5:132555003-132555025 ATTAGATTCTCATAAGGAATGGG + Intronic
997693868 5:135846158-135846180 ATCAGATTCTCATAAAGAGCGGG - Intronic
997959431 5:138307956-138307978 CTCAGATTCTCACAAGGAACCGG + Intronic
999463016 5:151772642-151772664 ATTTGATTCTTGCAGTGAGCTGG + Intronic
1000308759 5:160020699-160020721 ATTAGATTCTTGTAAGGAGCAGG - Intronic
1000469331 5:161621101-161621123 ATTAGATTTTTTAAAGTAGCAGG + Intronic
1001842999 5:174895430-174895452 ATTAGATTCTAAGAAGGTGCAGG + Intergenic
1001910810 5:175515953-175515975 ACTAGATTCTCATAAGGAGCGGG + Intronic
1002547108 5:179956530-179956552 ACTTGATTCTTATAAAGAGCTGG - Intronic
1002669437 5:180854518-180854540 AGGAAATTCTGACAAGGAGCAGG + Intronic
1004148460 6:13091738-13091760 ATTAGATTCTCATAAGAAGCGGG + Intronic
1004790794 6:19024029-19024051 ATTAGATTCTCATAAAGAGCAGG - Intergenic
1004875193 6:19944356-19944378 GTTAGATTCTCATAAGGAGCAGG + Intergenic
1005638952 6:27776546-27776568 ATTAGATTCTCATAAAGAGTGGG + Intergenic
1005978499 6:30818069-30818091 ATAATATTATTACAAGGAGGTGG - Intergenic
1007141981 6:39585273-39585295 ATTAGATTCTCATAAGGAGCGGG + Intronic
1007147151 6:39647478-39647500 ATTATATCATTACAAGAAGCTGG + Intronic
1011119461 6:83935655-83935677 AATATATTCTTAGAAGTAGCTGG + Intronic
1011964222 6:93133584-93133606 ATTAGAATCCTAAAAGGAGAAGG + Intergenic
1012741280 6:103018947-103018969 ATTAGAATATTACAGGGAGGCGG - Intergenic
1013227082 6:108127580-108127602 ATTAGATTCTCATAAGGAGCGGG + Intronic
1013355928 6:109346018-109346040 GCTAGATTCTCATAAGGAGCAGG - Intergenic
1013362029 6:109402649-109402671 ATTATATTTTTAAAAGGTGCAGG + Intronic
1014108925 6:117598566-117598588 ATTAGACTCTCACAAGAAGCTGG + Intronic
1014474672 6:121857848-121857870 GTTAGATTCTCATAAGAAGCAGG - Intergenic
1015593472 6:134844084-134844106 ATTAGATTCCTATAAGGAGCAGG + Intergenic
1015856400 6:137629752-137629774 ACTAGATTCTTATAAGTAGCCGG - Intergenic
1015856649 6:137632188-137632210 ACTAGATTCTTATAAAGAGTTGG + Intergenic
1016462847 6:144296322-144296344 ATTAGATTCTCATAAGGAGCAGG - Intronic
1018373090 6:163186552-163186574 CTTAGATTCTTACTAAGAGTTGG + Intronic
1020154397 7:5710496-5710518 ATGAGTTGCTTAGAAGGAGCTGG - Intronic
1020221115 7:6238021-6238043 ATTAGAATGTTACAATGAGTGGG - Intronic
1022963924 7:35455473-35455495 ATCAGATTCTCAAAAGGACCTGG - Intergenic
1023327003 7:39071217-39071239 ATTAGATTCTCACAAGGAATGGG + Intronic
1024393501 7:48840976-48840998 ATTAGATTCTCATAAGGCTCAGG - Intergenic
1024758040 7:52559836-52559858 ATTTGATTATTACAGGGAACAGG - Intergenic
1025625573 7:63218371-63218393 ATTAGACTCTCATAAGGAGTAGG + Intergenic
1025656533 7:63524758-63524780 ATTAGACTCTCATAAGGAGTAGG - Intergenic
1026118458 7:67516078-67516100 AGTAAATGCTTACAAGGGGCTGG - Intergenic
1026260130 7:68747856-68747878 ATTAGATTTTCATAAGGAGCCGG + Intergenic
1027426654 7:78068171-78068193 ATTACATGCTCATAAGGAGCAGG + Intronic
1028218353 7:88163189-88163211 AATAGATTCTGACAAGGTACTGG - Intronic
1028479342 7:91287625-91287647 AGTAAATTCTTACATGTAGCTGG + Intergenic
1030687966 7:112505964-112505986 ATAAGACTCTTACAAGGATATGG - Intergenic
1031120153 7:117713087-117713109 ATTAGATTCTCGCAAGGACTGGG - Intronic
1031447124 7:121868436-121868458 ATGAGATTCTTGCAAGAAGATGG + Intergenic
1032073413 7:128823969-128823991 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1032305745 7:130731943-130731965 ACTGGTTTCTTCCAAGGAGCTGG - Exonic
1032795591 7:135273644-135273666 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1033397147 7:140986048-140986070 ATCAGATTCTCACAAAGAGCAGG - Intergenic
1034319635 7:150168377-150168399 ATTAGATTCTCATAAGGATCAGG - Intergenic
1034773121 7:153798842-153798864 ATTAGATTCTCATAAGGATCAGG + Intergenic
1035015040 7:155758419-155758441 ATTAGAGTCTTATAAGGAGCTGG + Intronic
1037463611 8:19137732-19137754 ATTAGAGTCTTATAAGGAGAGGG - Intergenic
1038081221 8:24138810-24138832 ATTTTATTCTTACATGGACCTGG + Intergenic
1040907475 8:52483512-52483534 ATTAGATTCTCATAAGAAGCAGG + Intergenic
1043963104 8:86440524-86440546 ATAAGGTTCTTACAAGGGGCTGG - Intronic
1044815555 8:96108777-96108799 ATTGGATGCTTACTATGAGCTGG - Intergenic
1046870655 8:119202531-119202553 ATTAGAGTCTCAGAAGGAGAAGG - Intronic
1047230632 8:122995343-122995365 ATCAGATGCCGACAAGGAGCAGG + Intergenic
1048779413 8:137985292-137985314 ATTAGATTCTCATAAGGAGTGGG - Intergenic
1048802128 8:138203895-138203917 ATTAGATTCTCATAAGGAATGGG + Intronic
1050057044 9:1666571-1666593 ATTAGATTCTCACAGGGAGCAGG - Intergenic
1050712061 9:8476230-8476252 ATTAGATTCTCATAAAGAGCCGG + Intronic
1050871151 9:10571770-10571792 ACTAGATTCTCATAAGGAACAGG + Intronic
1052620631 9:30904687-30904709 ATTAGATTCCTACAAGACTCTGG - Intergenic
1053403065 9:37845303-37845325 ATTAGCTTTTTTCAAAGAGCAGG - Intronic
1055374664 9:75636041-75636063 ATTACATTCTCATAAGGAGCAGG - Intergenic
1056751660 9:89356225-89356247 GTTAGATTCTCATAAGGAGCAGG - Intronic
1058646117 9:107132856-107132878 ATAAGATTCTCATAATGAGCAGG - Intergenic
1060333941 9:122704086-122704108 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1060344694 9:122805982-122806004 ATTAGATTCTCATAAGGAGCAGG - Intronic
1203491274 Un_GL000224v1:107735-107757 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1203503898 Un_KI270741v1:49605-49627 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1203547030 Un_KI270743v1:135796-135818 ATTAGATTATGACAGGGAGTGGG - Intergenic
1186079903 X:5919697-5919719 ATTAGATTCTCATAAGGAGCAGG - Intronic
1186741367 X:12521862-12521884 TTTAAATTCCTATAAGGAGCAGG + Intronic
1189401581 X:40674326-40674348 ACTAGATTCTTACTAGAAGGAGG - Intronic
1189641939 X:43082075-43082097 ATTAGATTCTAATAAAGAGCAGG - Intergenic
1190406351 X:50091589-50091611 AGTACCTTCTTACATGGAGCAGG - Intronic
1190444230 X:50507078-50507100 ATTAGTTGCTTAAAAAGAGCAGG + Intergenic
1190946412 X:55098517-55098539 ATTGGATTTTGACAAGGAACTGG + Intronic
1195814881 X:108873824-108873846 ATTACATTATCACAAGGAGGAGG - Intergenic
1198816488 X:140597194-140597216 ACTAGTTTCTTCCAAGGAGCTGG + Intergenic
1199009233 X:142739601-142739623 TTTACATTATAACAAGGAGCAGG - Intergenic
1200823027 Y:7607298-7607320 AGTAAATTGTTACAAGGAGTGGG - Intergenic
1202237028 Y:22723797-22723819 AGTAAATTGTTACAAGGAGTGGG + Intergenic