ID: 1151637899

View in Genome Browser
Species Human (GRCh38)
Location 17:75365011-75365033
Sequence CCTAACACCCAAACTTCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151637899 Original CRISPR CCTAACACCCAAACTTCTAA TGG Intronic
904009310 1:27380870-27380892 CCTAAAGCCCTACCTTCTAAGGG - Intronic
905105566 1:35561673-35561695 GCACACACCCGAACTTCTAATGG + Intronic
908161854 1:61417655-61417677 GATAACACCCAAACTTCTCAAGG - Intronic
910637602 1:89426344-89426366 CATAACACCAAAATTTATAAAGG + Intergenic
911717561 1:101151729-101151751 CATAACACCCAAACTTCTAGAGG + Intergenic
912911856 1:113769196-113769218 CCTCACCCCCAAACTCCTCAGGG + Intronic
914771522 1:150690347-150690369 CCAAACTCCCAAACTTTTACTGG - Intronic
914997534 1:152558144-152558166 CCTAACACATAAACTCCTCACGG + Intronic
915100092 1:153492939-153492961 TCTCACCCCCAAACTTCTCATGG - Intergenic
916356425 1:163914776-163914798 CCTAACACCCAAATATTTAAAGG - Intergenic
920768903 1:208861289-208861311 CCTAACACCAAAACCACTAAAGG + Intergenic
1063770393 10:9191270-9191292 CCTAACACTCTAACTTCTAATGG - Intergenic
1063877630 10:10496795-10496817 CCACACCCCCAAACTTCTCATGG - Intergenic
1069810537 10:71156134-71156156 CCTCACATTCAAAGTTCTAAAGG + Intergenic
1071662005 10:87513964-87513986 CCTATCACTCAGACTTCTGACGG + Intronic
1076355562 10:129850501-129850523 CCTCACATCCGAACTTCCAATGG - Intronic
1080128764 11:28768272-28768294 CTTAACAGTCAAACTTCCAAAGG + Intergenic
1080585580 11:33679331-33679353 CCTAACACCAAAACTGGGAAAGG - Intergenic
1081656823 11:44862845-44862867 CCTTACACCCTAAGTCCTAAAGG - Intronic
1081945657 11:46991411-46991433 CCTTTCACCCAGTCTTCTAAAGG + Intronic
1086573084 11:88306974-88306996 CCTACCACCCAAACCCCTAGGGG - Intronic
1088424287 11:109685222-109685244 CCTAACCCCCATACTTATGATGG + Intergenic
1091200275 11:133774227-133774249 GTTAACATCCAAACTTCTAAAGG - Intergenic
1091450489 12:569591-569613 CCTTAAACCCAAACCTCTAGTGG + Intronic
1095187400 12:39216689-39216711 CCTAACCCCCACACTGCTCAAGG + Intergenic
1096164891 12:49414085-49414107 CTGGACACCCAAACTTCTATAGG - Intronic
1097198602 12:57259237-57259259 CCTTCCACTCAAACTTCTACTGG - Intronic
1097745405 12:63296555-63296577 CCTCACACCCAACATTTTAAAGG + Intergenic
1110428737 13:75399179-75399201 CCAAACCCCCAAACTTCTATAGG + Intronic
1113877599 13:113604426-113604448 ACTCACACCCACACTCCTAAGGG + Intronic
1114867342 14:26612889-26612911 CCTACCACTCACACTTATAATGG + Intergenic
1115785370 14:36819842-36819864 CCTAACACCCAATCTTTTAATGG + Intronic
1116929393 14:50674700-50674722 CCTAACACCTGAAATTCTATGGG - Intergenic
1117257086 14:53988915-53988937 TCTAACACACAAACTTTTGAGGG + Intergenic
1118900577 14:69982154-69982176 ACTAACTCCCAGACTTCTTATGG - Intronic
1127713076 15:61620615-61620637 CCTTTCACCCAAACATCTGAGGG - Intergenic
1140666798 16:77235333-77235355 CCTCACACCCAAACCTCTATTGG - Intergenic
1140811640 16:78584568-78584590 CCTAACACTCAAACTTTAAAAGG - Intronic
1144868999 17:18356864-18356886 CCTCTCAGCCAAACTTCTCATGG + Intronic
1146908866 17:36635122-36635144 CTTAACACAGAAACTGCTAATGG + Intergenic
1148074626 17:44928290-44928312 CCTGACACCCAACCTTCACAGGG - Exonic
1148389143 17:47257828-47257850 CCCAACACCCACACGTCCAAGGG - Intronic
1151637899 17:75365011-75365033 CCTAACACCCAAACTTCTAATGG + Intronic
1157676204 18:49570457-49570479 CCTTACTCCCAAGATTCTAAGGG + Intronic
1160396839 18:78578776-78578798 TCTAACAGTCAAACATCTAATGG + Intergenic
1163084713 19:14971187-14971209 CCTAACACCCAAATTGTTCAAGG + Intronic
1202633265 1_KI270706v1_random:19474-19496 CCTCCCACCAAAGCTTCTAAAGG - Intergenic
928416699 2:31098628-31098650 CCTAACCCCCACACTGCTCAAGG - Intronic
930798103 2:55414026-55414048 CTTCAAACCCAAAATTCTAAAGG + Intronic
932059045 2:68476755-68476777 CTTAAAACCCAAAGTCCTAATGG + Intronic
933565374 2:83943995-83944017 CCTTACACTCCAACTTATAAAGG - Intergenic
942569942 2:177303629-177303651 CCTTACTCCCTAACTTCAAAAGG + Intronic
942995135 2:182251368-182251390 TCTAACCACCAAATTTCTAATGG + Intronic
944002676 2:194859908-194859930 CTTGACACCCAAACATCTGATGG - Intergenic
946350294 2:219146593-219146615 CCTAACACCCAAAACACAAATGG + Intronic
947273986 2:228370839-228370861 CCTTCCACCCAAACTTTTATAGG - Intergenic
1170612526 20:17926279-17926301 CCTAACACCCCAACTCCTGAGGG + Intergenic
1176645479 21:9345335-9345357 CCTCCCACCAAAGCTTCTAAAGG - Intergenic
1179166951 21:38942881-38942903 CCTAGCAACCAGACTGCTAAGGG - Intergenic
1180367446 22:11953821-11953843 CCTCCCACCAAAGCTTCTAAAGG + Intergenic
1181942355 22:26488189-26488211 CGTAACACACACACTTCAAATGG - Exonic
949849617 3:8409999-8410021 CCTAACACCCCACTTTCTTAAGG + Intergenic
952756707 3:36875251-36875273 CCTAACAGTCAAAGTTCTAGAGG + Intronic
957757949 3:84515168-84515190 CCAGACACGCAAAATTCTAAGGG - Intergenic
959426230 3:106192419-106192441 CTTATCTCCCCAACTTCTAATGG - Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
968187210 3:196640887-196640909 TCTAGCACCCAGACTCCTAACGG - Intronic
1202741409 3_GL000221v1_random:59733-59755 CCTCCCACCAAAGCTTCTAAAGG + Intergenic
970251483 4:14120870-14120892 CCTGACACCTAGGCTTCTAACGG - Intergenic
975237727 4:72019783-72019805 CATGTCACCCATACTTCTAACGG - Intergenic
976679270 4:87737266-87737288 CCTAACATCCAAACATCTTTTGG + Intergenic
977906871 4:102487112-102487134 CCTAACACCAAAACCAGTAAAGG + Intergenic
978391082 4:108226085-108226107 CCTTGCACTCAAACTTATAATGG - Intergenic
979079397 4:116314854-116314876 CCTGACACACAATCTTGTAAGGG + Intergenic
979325190 4:119370885-119370907 CCTAATAAACAAACTGCTAATGG + Intergenic
979796580 4:124853990-124854012 CCTGAAACCCAAACTACTTAAGG - Intergenic
983243094 4:165255909-165255931 CCTAATAAGCAAACTGCTAATGG + Intronic
989525593 5:42450119-42450141 CCTAATACCTAAACTTGGAAAGG - Intronic
989608683 5:43270906-43270928 CCTAACACCCAAACACCAAGTGG + Intronic
990187456 5:53223547-53223569 CCTAAGACCCAAAGCTCAAAAGG - Intergenic
991250863 5:64559481-64559503 CCTAGCACCCCAACATCCAAAGG - Intronic
995208201 5:109506338-109506360 ACTAAGACCCAAACATGTAATGG - Intergenic
995461279 5:112405858-112405880 CCTAACAGTTAAACTTCTACAGG + Intronic
997145292 5:131426604-131426626 CCTAACACCTCAACTGCAAAGGG + Exonic
997554686 5:134785418-134785440 CCTAACCACCAAAATTCTTAAGG - Intronic
997929554 5:138061098-138061120 CCTAACACGAAAACATCTTAAGG - Intergenic
1001465173 5:171957802-171957824 CCTAACCTCCAAACTGCCAAGGG - Intronic
1003342145 6:5231919-5231941 CCTAACACACAAACACCTACTGG - Intronic
1014973355 6:127846803-127846825 CCTAACACCCAAACCAGGAAAGG + Intronic
1024272000 7:47649688-47649710 ATTCACACCCAAAGTTCTAAAGG - Intergenic
1026253020 7:68687223-68687245 CCTAAACCCCTCACTTCTAAAGG - Intergenic
1026508585 7:71007924-71007946 CATACCACCCAAATTTCAAAGGG + Intergenic
1028752650 7:94398010-94398032 CCTAAAACTCAAACTTCTATTGG - Intronic
1028755649 7:94430742-94430764 TTTAAAACCCAAACTTCCAAAGG + Exonic
1030346660 7:108441497-108441519 GTTATGACCCAAACTTCTAAGGG - Intronic
1033721665 7:144066216-144066238 CCTAATACCCAAACTAGGAAAGG - Intergenic
1034948671 7:155281554-155281576 CCACACACCCCAACTCCTAATGG - Intergenic
1034948752 7:155282329-155282351 CCACACACCCCAACTCCTAATGG - Intergenic
1038502110 8:28053586-28053608 CCTAAAACCCACACCTCTGATGG - Intronic
1041150610 8:54929096-54929118 CCTAATACCAAAACTTGGAAAGG + Intergenic
1041321874 8:56621911-56621933 CCTAACTCCCAAAGTGCTATGGG - Intergenic
1042608265 8:70568962-70568984 CCTAATACCAAAACTAGTAAAGG + Intergenic
1045452016 8:102336395-102336417 CCAAAAACTCAAACTTCAAAAGG - Intronic
1056232425 9:84560025-84560047 CCAAACACACAAACTAGTAAAGG - Intergenic
1058800031 9:108536706-108536728 CCTAACAACCAAAATTGTACAGG + Intergenic
1203769493 EBV:41619-41641 CCTAATCCCCAACCTTTTAATGG - Intergenic
1203710047 Un_KI270742v1:89657-89679 CCTCCCACCAAAGCTTCTAAAGG + Intergenic
1185964814 X:4588589-4588611 CTGAACACTTAAACTTCTAATGG - Intergenic
1187409353 X:19035743-19035765 CCACACTCCCAAACTTCCAAAGG - Intronic
1188317971 X:28699357-28699379 TCTAACACCCAAATTTAAAACGG - Intronic
1188820340 X:34767360-34767382 CCTGACATTCAAACTTATAAAGG - Intergenic
1191725161 X:64271681-64271703 CCTAACATCCCAACTTCTCCAGG + Intronic
1194535312 X:95099156-95099178 CACAACACCCAAACATCGAAAGG + Intergenic
1194939384 X:99991361-99991383 CCTATCACCTAAAATTATAATGG - Intergenic
1195892320 X:109709344-109709366 CCAAATACTCAAACTTCAAAGGG + Intronic
1198214200 X:134542416-134542438 CCTAAGACCAGACCTTCTAAAGG - Intergenic
1199848052 X:151705952-151705974 GCTGACTCCCAAACTTCCAAGGG + Intergenic