ID: 1151638357

View in Genome Browser
Species Human (GRCh38)
Location 17:75369237-75369259
Sequence GGGTAAGTTGATGCAAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151638357_1151638359 -3 Left 1151638357 17:75369237-75369259 CCTCATTTTGCATCAACTTACCC 0: 1
1: 0
2: 0
3: 16
4: 194
Right 1151638359 17:75369257-75369279 CCCCTAGACATTCCTAACCTAGG 0: 1
1: 0
2: 1
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151638357 Original CRISPR GGGTAAGTTGATGCAAAATG AGG (reversed) Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
903551804 1:24162285-24162307 TGGTAACGTGATGAAAAATGTGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906742908 1:48199677-48199699 GGGAGATTTGAGGCAAAATGAGG + Intergenic
907343962 1:53758930-53758952 GGTCACGTTGATGCAAAAGGTGG + Intergenic
907789267 1:57645964-57645986 GGGTAAGTAGATGGAATCTGAGG + Intronic
908130167 1:61067514-61067536 GCGTAAGGTGACTCAAAATGGGG - Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
910375064 1:86559395-86559417 GGCTTAGTTGATGCAAACTGAGG - Intronic
912096465 1:106150343-106150365 GATTATGTTGATGCAAAAGGTGG - Intergenic
912327755 1:108784937-108784959 GGTCATGTTGATGCAAAAGGTGG + Intronic
914973855 1:152339093-152339115 GGAATAGTTCATGCAAAATGTGG - Intergenic
923179113 1:231499045-231499067 GGTTATGCTGATGCAAAAGGTGG + Intergenic
1062770426 10:96084-96106 GGGCATGCTGATGCAAAAGGTGG + Intergenic
1063481437 10:6380139-6380161 GGTCATGTTGATGCAAAAGGTGG + Intergenic
1063771826 10:9212455-9212477 TGGACAGTTGATGCAAAATATGG + Intergenic
1070997741 10:80800776-80800798 GAATAAGTTGATGGAAAATCTGG + Intergenic
1071208836 10:83314525-83314547 GGGAAAGTTGATGAGAAATTGGG + Intergenic
1071929289 10:90448794-90448816 TGGCAATTTTATGCAAAATGAGG - Intergenic
1077718701 11:4605903-4605925 GGGTAAGTTCACATAAAATGTGG + Intronic
1080292017 11:30681486-30681508 GGGGAAGTGGATCCAAAAGGAGG + Intergenic
1081249631 11:40813909-40813931 GGGCATGTTGATGCAAGAGGTGG + Intronic
1081306855 11:41523012-41523034 GTGTTAGGTTATGCAAAATGAGG + Intergenic
1081785892 11:45747042-45747064 TACTAAGTTGATGAAAAATGAGG - Intergenic
1082172122 11:49017688-49017710 AGGTAATATGATACAAAATGGGG + Intergenic
1083426437 11:62589898-62589920 GAGGAAGTTGATGCACAGTGAGG - Intronic
1083731092 11:64653181-64653203 GGGTGAGTTTCTGCCAAATGGGG - Intronic
1083780041 11:64913055-64913077 GGTGAAGTTGAAGCAAAATGAGG - Exonic
1088381100 11:109193318-109193340 GGGTGAGTTGAAGCAGGATGGGG - Intergenic
1090595300 11:128314771-128314793 GGGTATGCTGATGCAAGAGGTGG + Intergenic
1092141014 12:6183353-6183375 GGGTAAGCTCATGCAAAAGCTGG + Intergenic
1092665378 12:10791370-10791392 GGTTATGCTGATGCAAAAGGTGG + Intergenic
1093677306 12:21958442-21958464 TGGTGAGCTGAAGCAAAATGAGG - Intergenic
1097002102 12:55885633-55885655 TGGTAAGATCATGGAAAATGAGG - Intergenic
1098944334 12:76573475-76573497 GGGCATGCTGATGCAAAAGGTGG + Intergenic
1099428316 12:82551181-82551203 GGGTGAGCTGAAGCAAAGTGGGG - Intergenic
1100060208 12:90566074-90566096 GGGCATGCTGATGCAAAATGTGG + Intergenic
1101819608 12:108173618-108173640 GGGTAAGGGGATGCTGAATGAGG + Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104295691 12:127510526-127510548 GGGTAAGATGATGTAAGAGGAGG - Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106046833 13:26150201-26150223 GGTTAAGTTGGGGCAAAATCCGG - Intronic
1106992698 13:35441160-35441182 GTGTGAGATGATGGAAAATGGGG - Intronic
1109411856 13:61980824-61980846 AGGAAATTTAATGCAAAATGAGG - Intergenic
1109574863 13:64242066-64242088 GGGAAAGGTCATGGAAAATGAGG + Intergenic
1110081089 13:71313604-71313626 GGGGAATTTCATGGAAAATGAGG + Intergenic
1110457565 13:75707316-75707338 GGGAAAGTTTATGAAAAATTGGG - Intronic
1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1114259465 14:21026218-21026240 GAGTTAGTTGATTAAAAATGTGG + Intronic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1116669962 14:47828668-47828690 GGGCATGCTGATGCAAGATGTGG + Intergenic
1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG + Intergenic
1127136714 15:55931906-55931928 GGGAAGGTTGAGGGAAAATGGGG - Intronic
1129276848 15:74451201-74451223 GGGTATGAGGATGCCAAATGAGG - Intronic
1133475235 16:6114968-6114990 GGACAAGTTAATGCAAACTGAGG + Intronic
1135008810 16:18854700-18854722 GGTCAAGTGGATGAAAAATGGGG - Exonic
1136285866 16:29241244-29241266 GGGAAAGTCGATACAAACTGGGG + Intergenic
1136771308 16:32844023-32844045 GGGAAAGGTAATGCAAAATGTGG - Intergenic
1137557442 16:49480307-49480329 GGGTAAATTGATATAAAGTGAGG + Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1142091205 16:88211430-88211452 GGGAAAGTCGATACAAACTGGGG + Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1203073733 16_KI270728v1_random:1106133-1106155 GGGAAAGGTAATGCAAAATGTGG - Intergenic
1143448110 17:7020426-7020448 GGGGAAGTTGGAGAAAAATGGGG - Intergenic
1144351696 17:14403044-14403066 GGATAAGTTGATGCAAAGGATGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1150164743 17:62931073-62931095 GGGTAAGATGATGGAACATTAGG - Intergenic
1151638357 17:75369237-75369259 GGGTAAGTTGATGCAAAATGAGG - Intronic
1154178579 18:12108907-12108929 GGGCACACTGATGCAAAATGTGG + Intronic
1154260688 18:12829570-12829592 GGGTAATTTGATCAAAAATAAGG + Intronic
1156212581 18:34961609-34961631 AGGTAATGTGATGAAAAATGAGG + Intergenic
1157936766 18:51882233-51882255 GAGAAAGTTGATGCAAAATTGGG - Intergenic
1158711253 18:59840032-59840054 TGGTAAGTTGAAGAACAATGAGG + Intergenic
1159102058 18:63968731-63968753 GGAGAAATTGATGCACAATGGGG + Intronic
1159204625 18:65233468-65233490 GGTTATGTTGATGCAAAATATGG - Intergenic
1160466734 18:79083702-79083724 GGGCAAGCTGAAGCAAAGTGGGG - Intronic
926134320 2:10325910-10325932 GGGAAAGTTGTTGGGAAATGAGG + Intronic
926877444 2:17497254-17497276 TGGTAAGCCGATGCAGAATGGGG - Intergenic
928448848 2:31359922-31359944 GGGGATGGTGAGGCAAAATGAGG + Intronic
929090195 2:38208765-38208787 GAGAAAGTAGATGCAAAAAGAGG + Intergenic
929687543 2:44047544-44047566 GGCTAAGTTGGTGGAAATTGGGG - Intergenic
930547267 2:52783921-52783943 GAGTAAGATGAGGCAGAATGAGG - Intergenic
937730271 2:125222235-125222257 GGTAATGCTGATGCAAAATGTGG + Intergenic
941213377 2:162671320-162671342 GGATAATTGGATGAAAAATGTGG + Intronic
942063727 2:172251036-172251058 GGCAAAGTGGCTGCAAAATGAGG + Intergenic
943303332 2:186230240-186230262 GGGTATGCTGATTCAAAGTGTGG - Intergenic
943315733 2:186385693-186385715 GGGCATGCTGATGCAAGATGTGG + Intergenic
945562361 2:211354456-211354478 GGGTAAGTGGCTTAAAAATGGGG + Intergenic
946898900 2:224354045-224354067 GTGTAATAAGATGCAAAATGGGG + Intergenic
947054352 2:226084247-226084269 GGTCATGCTGATGCAAAATGTGG + Intergenic
947697679 2:232205892-232205914 GGGGAAGTTGATGCAGTATAAGG - Intronic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1173281903 20:41636013-41636035 TGGTAAGTTGGTCCAAATTGTGG + Intergenic
1174090829 20:48045756-48045778 GGCAAAGTTGATTCAAAATAGGG - Intergenic
1175203038 20:57291047-57291069 AGGAAGGTGGATGCAAAATGGGG - Intergenic
1175506409 20:59488439-59488461 GGGTAGGCTGAGGCACAATGAGG - Intergenic
1175506643 20:59490583-59490605 GGGTAGGCTGAGGCACAATGAGG + Intergenic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1178704020 21:34858146-34858168 GGGAAAGTTGATGCAGCTTGGGG + Intronic
1181167243 22:20990408-20990430 GGGGAAGTTGCAGCAAGATGGGG - Exonic
1181889499 22:26049471-26049493 CAGTAAGTTTATTCAAAATGAGG + Intergenic
1182153527 22:28048121-28048143 GGGTAAATCCATGCATAATGGGG + Intronic
1182330104 22:29545672-29545694 GGTCAAGCTGATGCAAAAGGTGG + Intronic
950172430 3:10848289-10848311 GAATAAGTTGATCCCAAATGGGG + Intronic
950779379 3:15378222-15378244 GGGCAAGCTGATGCAAATTGAGG + Intergenic
951294419 3:20916790-20916812 GGACAAGATAATGCAAAATGCGG + Intergenic
951315824 3:21189161-21189183 GGGTAAGTAAAGGCAAAAGGGGG + Intergenic
951681559 3:25300278-25300300 GAGTAAGATGCTGTAAAATGTGG + Intronic
951816109 3:26756877-26756899 GGGTATGTTGGTAGAAAATGTGG + Intergenic
953191371 3:40691038-40691060 GGGAAAGTAGATGAAAAAGGAGG + Intergenic
953922427 3:46961366-46961388 GGGTCAGTTGTTTCAAACTGGGG - Intronic
957510107 3:81176855-81176877 GTTTTAGTAGATGCAAAATGTGG - Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
959809064 3:110594068-110594090 GGTCAAGCTGATGCAAGATGTGG - Intergenic
964170874 3:153768308-153768330 GGGTATGCTGATGAAAACTGTGG + Intergenic
971840998 4:31851561-31851583 GGGCAAGCTGATGCAAGAGGTGG - Intergenic
972102032 4:35431923-35431945 GGGCATGCTGATGTAAAATGTGG - Intergenic
972385347 4:38560329-38560351 GGGTAAATAGAGGCAAAGTGAGG + Intergenic
973728777 4:53803284-53803306 TAGTAAGTTTATCCAAAATGTGG + Intronic
974455969 4:62129814-62129836 GGGTAAGTACATCCATAATGAGG + Intergenic
974876302 4:67707457-67707479 GGCTAAGATTATGCTAAATGGGG - Intergenic
974972317 4:68845314-68845336 GGTTAAGTTGATGCAAGAGGTGG - Intergenic
979487467 4:121284959-121284981 GGGTAAGCTGAGGCAGAGTGGGG + Intergenic
980202833 4:129677648-129677670 GGTCATGCTGATGCAAAATGTGG - Intergenic
980273660 4:130620188-130620210 GGGTAACTTAATTAAAAATGAGG + Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985211089 4:187595465-187595487 GGATAAATTCATGCAAAAAGAGG + Intergenic
988112234 5:26836940-26836962 TGACAAGTTGATGCAAAATGTGG + Intergenic
988159599 5:27502681-27502703 GGGAATGTTGATGCAAGAAGTGG + Intergenic
988408328 5:30853301-30853323 GTGTAACTTGATGCAACATTTGG + Intergenic
988440965 5:31232377-31232399 GGGTTAGTGGAAGAAAAATGTGG - Intronic
991731832 5:69597159-69597181 GGGCCAGTTGATGCAGAGTGGGG + Intergenic
991732343 5:69601995-69602017 GTGTATGTTGATACAAAAAGAGG + Intergenic
991808264 5:70452297-70452319 GGGCCAGTTGATGCAGAGTGGGG + Intergenic
991808775 5:70457138-70457160 GTGTATGTTGATACAAAAAGAGG + Intergenic
991862609 5:71025858-71025880 GTGTATGTTGATACAAAAAGAGG - Intergenic
991863120 5:71030708-71030730 GGGCCAGTTGATGCAGAGTGGGG - Intergenic
993032626 5:82723013-82723035 GGGAAGGTGGATGTAAAATGCGG + Intergenic
993413140 5:87596266-87596288 GGGTATGCTGATGCAAGAGGTGG + Intergenic
993590558 5:89790329-89790351 GGTTATGTTGATGCAAGAGGTGG + Intergenic
993671953 5:90771382-90771404 GGGTTCTTTGTTGCAAAATGAGG + Intronic
994368454 5:98943323-98943345 GGGAAAGCAGATGCAAACTGGGG - Intergenic
994425260 5:99576920-99576942 GGGCAAACTGATGCAAGATGTGG - Intergenic
994436079 5:99735313-99735335 GGGCAAACTGATGCAAGATGTGG + Intergenic
996046696 5:118882259-118882281 GGGCAAGTTGATGCAACAGGAGG + Intronic
996617464 5:125458350-125458372 GGTCACGCTGATGCAAAATGTGG - Intergenic
998323082 5:141250943-141250965 AGGTGAGTTAATGCAAATTGAGG - Intergenic
1000099073 5:157997446-157997468 GGGGAAGTTGAGGCACAAAGGGG + Intergenic
1000362685 5:160462554-160462576 GGGTAATTTGAGGCAAACAGTGG - Intergenic
1002622488 5:180498165-180498187 GGGTTATTTGATCCAAGATGAGG + Intronic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1004742158 6:18472555-18472577 GAGTTAGTTCATGCAAGATGTGG - Intergenic
1008260943 6:49366190-49366212 GGGAATGCTGATGCAAAAGGTGG + Intergenic
1008469900 6:51872915-51872937 GGGTATGTTCAAACAAAATGAGG + Intronic
1010478072 6:76314038-76314060 GGGTAAGTTCAGGCAAAAGTGGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1011401817 6:86970865-86970887 GGGTACCCTGATGCAATATGTGG - Intronic
1011528025 6:88287714-88287736 GGGTAAGGTCAGGAAAAATGTGG + Intergenic
1011715954 6:90105170-90105192 GGGTCAGTGAATGCAACATGGGG - Intronic
1012664050 6:101943571-101943593 GGGTATGCTGATGCAAGAGGTGG - Intronic
1012700463 6:102451034-102451056 GGTCAAGCTGATGCAAAAGGTGG + Intergenic
1013029658 6:106320997-106321019 AGAGAAGTTGATGAAAAATGAGG + Intronic
1015458617 6:133461765-133461787 GGGGAACATGATGTAAAATGTGG + Intronic
1016437054 6:144048128-144048150 GGGTATGCTGATGCAAGAAGTGG + Intronic
1020407621 7:7855046-7855068 GGTTATGCTGATGCAAAAGGTGG + Intronic
1020693903 7:11391889-11391911 GGGCAAGCTGAAGCAAAGTGGGG - Intronic
1022512827 7:30952136-30952158 GGGAATGGTGATGCAAAAAGTGG + Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1031172442 7:118308808-118308830 GGTCATGCTGATGCAAAATGTGG + Intergenic
1034488037 7:151378457-151378479 GAGTAAATTAATGCAAAATTAGG - Intronic
1036596220 8:10214769-10214791 GGGTAATTTGAAGCAACTTGAGG + Intronic
1038194058 8:25350354-25350376 GGGTAAGTCGGAGCCAAATGAGG + Intronic
1039072016 8:33657455-33657477 GGGTAGGTATATGCAAAATAGGG - Intergenic
1042180995 8:66087766-66087788 GGGCATGTTGATGCAAGAGGTGG + Intronic
1042755350 8:72204515-72204537 GGACAATTTGATGTAAAATGTGG - Intergenic
1043359921 8:79460356-79460378 GGGATAGTTGATACATAATGGGG + Intergenic
1044275289 8:90292247-90292269 GAGGAATTTGCTGCAAAATGGGG - Intergenic
1044277881 8:90323190-90323212 TGATAAGTTGATGCCAACTGTGG - Intergenic
1046549261 8:115692577-115692599 TGGTAAGTTGCTGTAAAATCAGG + Intronic
1048263148 8:132962437-132962459 GTGTTAGCTGATGAAAAATGAGG + Intronic
1048727116 8:137398986-137399008 AGGTAAGTAGATACAAAATAGGG + Intergenic
1050162965 9:2736990-2737012 TGGAAACTTGATGCAAAAAGAGG - Intronic
1052688207 9:31780700-31780722 GGTCACATTGATGCAAAATGTGG + Intergenic
1053371404 9:37564572-37564594 GGTTATGCTGATGCAAAAGGTGG - Intronic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1055307623 9:74946156-74946178 GGATAAATTGAGGTAAAATGTGG - Intergenic
1055774317 9:79751696-79751718 GGGTGCGTTGATGCAAGATGTGG + Intergenic
1056041522 9:82672577-82672599 GGGAAAGTAGATCCCAAATGGGG + Intergenic
1060623252 9:125086824-125086846 GGGAAAGTTGAAGCACAAAGAGG - Intronic
1186680818 X:11871703-11871725 GGCTTAGAAGATGCAAAATGTGG + Intergenic
1187178928 X:16924539-16924561 GGGTAGGTTGAGGAAAAATGGGG - Intergenic
1187289918 X:17943127-17943149 GAGGAAGTTGATGCACAAAGAGG + Intergenic
1188436575 X:30167022-30167044 GGATAAGCTGTTGAAAAATGTGG - Intergenic
1189213430 X:39303537-39303559 GGGTACATTGATGCAAGAGGTGG - Intergenic
1189442597 X:41050529-41050551 AGGAAAGTTGATGCAACAAGTGG + Intergenic
1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG + Intergenic
1191705042 X:64085547-64085569 GGGTGAGTTGAAGCAGGATGGGG + Intergenic
1192024009 X:67428742-67428764 GGAGAAGTGGATGGAAAATGGGG - Intergenic
1192733768 X:73828595-73828617 GGGAAAGGTGATGCTAAAGGAGG - Intergenic
1193050714 X:77096508-77096530 GGGTATGTTGATGCAAGGAGTGG - Intergenic
1193677148 X:84468506-84468528 TGGTTTGATGATGCAAAATGAGG + Exonic
1194484573 X:94471599-94471621 GGTCATGCTGATGCAAAATGTGG - Intergenic
1194499236 X:94659182-94659204 GGTTATTTTGATGCAAAAGGTGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1197040703 X:121932298-121932320 GGGCATGTTGATGCAAGAAGTGG + Intergenic
1197074693 X:122340713-122340735 GGGCACGTTGATGCAAGAGGTGG + Intergenic
1198836035 X:140805765-140805787 GGGCATGTTGATGCAAGAGGTGG + Intergenic
1199072700 X:143497682-143497704 GGGCAAGCTGATGCAAGAGGTGG + Intergenic