ID: 1151643033

View in Genome Browser
Species Human (GRCh38)
Location 17:75410387-75410409
Sequence CAGGCTGCAGACTCTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151643033_1151643040 11 Left 1151643033 17:75410387-75410409 CCCTCCACAGAGTCTGCAGCCTG No data
Right 1151643040 17:75410421-75410443 ATGTCTCTGAGAATTTGACCAGG No data
1151643033_1151643044 30 Left 1151643033 17:75410387-75410409 CCCTCCACAGAGTCTGCAGCCTG No data
Right 1151643044 17:75410440-75410462 CAGGATAGTGCTGGTGGCTTTGG No data
1151643033_1151643042 24 Left 1151643033 17:75410387-75410409 CCCTCCACAGAGTCTGCAGCCTG No data
Right 1151643042 17:75410434-75410456 TTTGACCAGGATAGTGCTGGTGG No data
1151643033_1151643041 21 Left 1151643033 17:75410387-75410409 CCCTCCACAGAGTCTGCAGCCTG No data
Right 1151643041 17:75410431-75410453 GAATTTGACCAGGATAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151643033 Original CRISPR CAGGCTGCAGACTCTGTGGA GGG (reversed) Intergenic
No off target data available for this crispr