ID: 1151647805

View in Genome Browser
Species Human (GRCh38)
Location 17:75445413-75445435
Sequence AGGAACTACACCCATGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151647805 Original CRISPR AGGAACTACACCCATGGGAT GGG (reversed) Intronic
901635912 1:10670069-10670091 AGGAACCAGACCCCTGGGTTGGG + Intronic
906380836 1:45331456-45331478 AGGAACTACAGCGTTGGGCTGGG - Exonic
912996651 1:114537817-114537839 AGGAACAACACGCATGGTGTTGG - Intergenic
915443706 1:155962522-155962544 AGGCACTACCCCCATGAGTTGGG + Intronic
921721085 1:218472143-218472165 AGGAACTTCATCCATAGGGTGGG + Intergenic
924422451 1:243922360-243922382 AGGAACTTCAGCCATAGGACTGG + Intergenic
1066071008 10:31812449-31812471 AGGAACTACATGGATGTGATGGG - Intronic
1070719178 10:78744678-78744700 GGGACCCACACCCATGGGAAAGG + Intergenic
1071343240 10:84667249-84667271 AGGAAGGACACATATGGGATGGG + Intergenic
1074160274 10:110831051-110831073 ACGAACTCCACCCCTGGGAAAGG - Exonic
1078096452 11:8300316-8300338 GGGACCTGCTCCCATGGGATTGG + Intergenic
1079125237 11:17714230-17714252 AGGATCTATACCCATGTGGTGGG + Intergenic
1083622874 11:64057604-64057626 AGGACCTACACCCAAGGGCCTGG + Intronic
1087036112 11:93758282-93758304 AGGGACTACAGCCATGGCTTGGG - Intronic
1088260824 11:107942337-107942359 AGTAACTACAGCCATTGGACTGG + Intronic
1091673483 12:2469420-2469442 AGGAAATACACTCATGTCATAGG + Intronic
1091722365 12:2822696-2822718 AGGAATTTCACCCGTGGGTTCGG - Intronic
1093265333 12:16996908-16996930 AGGAATTACCCCCATTGGAAAGG - Intergenic
1101398077 12:104365613-104365635 AGGACCCACACCTATGGTATTGG + Intergenic
1108019580 13:46113356-46113378 AAGAACTACTCCCATGGGAGAGG + Intergenic
1108109459 13:47052520-47052542 AAGAAATACACCCATCTGATGGG - Intergenic
1114696123 14:24629416-24629438 AGGAAAAACACCCATTTGATTGG - Intergenic
1119632185 14:76242698-76242720 AGAACCTACACACAAGGGATAGG - Intronic
1124358289 15:29015426-29015448 AGGAGCTGCCCCCTTGGGATGGG - Intronic
1125554332 15:40571791-40571813 AGGAGCTACACCCCTTGCATCGG + Exonic
1127461359 15:59202244-59202266 AGGAACTGCACCCCTGGGCCAGG - Intronic
1128982962 15:72199659-72199681 AGGAACAACACGCATGGTGTTGG + Exonic
1129065039 15:72895477-72895499 AAGAACTACTCCCATGGGAGAGG - Intergenic
1130656981 15:85798621-85798643 AGCAGCTGCACCCATGGGCTTGG - Intergenic
1133298684 16:4768460-4768482 AGGAAGTACAGAAATGGGATTGG + Intergenic
1133673563 16:8047763-8047785 AGGAGCTTCAGCCATGGGACTGG - Intergenic
1135868243 16:26124957-26124979 AGGAACTTGCCCCATGGCATAGG + Intronic
1138554871 16:57765208-57765230 AGGAACCACAGCCATGGGAGGGG + Intronic
1142857896 17:2742654-2742676 AGTATTTACAGCCATGGGATGGG - Intergenic
1143530821 17:7502345-7502367 AGGAACCACTCCCATGGGACAGG - Intronic
1144531027 17:16039506-16039528 AGGCACTACTCCCATAGGCTGGG + Exonic
1147381867 17:40061092-40061114 TGGAACTAGTCCCTTGGGATTGG - Intronic
1147873021 17:43601182-43601204 AGGAAGTACACCGATGAGAGTGG - Intergenic
1149400123 17:56287410-56287432 AGGAACTAAACGCATGAGGTAGG - Intronic
1149578179 17:57728620-57728642 AGGAACAGCACCCATGGAAGGGG - Intergenic
1150293363 17:63994216-63994238 AGGAACTGCACCCAAGGAAAGGG + Intergenic
1151647805 17:75445413-75445435 AGGAACTACACCCATGGGATGGG - Intronic
1154399326 18:14020329-14020351 CTGTACTACACCCAGGGGATCGG - Intergenic
1154439731 18:14378346-14378368 ACGAATTACACCCTTGGAATCGG - Intergenic
1160034987 18:75292092-75292114 ATGAACTCCACACATGGCATTGG + Intergenic
1162040967 19:7970951-7970973 GGGAGCTACAGCCCTGGGATGGG + Intronic
1167260722 19:48456209-48456231 AGGAACCACCCCCGTGGGCTGGG - Exonic
932252918 2:70259777-70259799 TGGAATTACAGCCATGGGGTGGG + Intronic
932428878 2:71661604-71661626 AGGAATTACTCCCATGCAATGGG - Intronic
932569377 2:72930328-72930350 AGGAACTACAGGCAGGTGATGGG + Intronic
936752308 2:115659982-115660004 AGGAAATAAATCCATGGCATAGG + Intronic
940398238 2:153218497-153218519 AGGAACCATAGCCTTGGGATGGG - Intergenic
943054487 2:182959140-182959162 AGTAACTAAAGCCATGGGATTGG + Intronic
946605122 2:221395877-221395899 AGCAACTACTCCCACGGGAAAGG - Intergenic
1169223868 20:3843853-3843875 ATGAATTACACCCATGAAATAGG + Intergenic
1173382673 20:42560250-42560272 AGGAGGTACAGGCATGGGATTGG + Intronic
1174463792 20:50701654-50701676 AAGAAAGACACACATGGGATGGG - Intergenic
1178111108 21:29371097-29371119 AGGAGCTACTGCGATGGGATGGG + Intronic
1180877630 22:19182167-19182189 AGGAAAGACACCCGAGGGATGGG + Intronic
1181747916 22:24968523-24968545 AGCATCCACACCCATGGAATGGG + Intronic
950454019 3:13082031-13082053 AGGAGCTGCACCCATGGAGTTGG - Intergenic
952614789 3:35257661-35257683 AGGAGCAACACCCTTGGGTTAGG - Intergenic
953211880 3:40883105-40883127 ATGAACCACACCCATAGAATAGG - Intergenic
953908734 3:46881671-46881693 AGGAACGACAGGCCTGGGATGGG + Intronic
956742237 3:72284336-72284358 AGTGACTACATCCATGGCATGGG - Intergenic
957501439 3:81063300-81063322 AGGAACTAGACAGATGGCATAGG - Intergenic
961736887 3:129007636-129007658 AGGAAATAGACCCTTGGGGTTGG + Intronic
963059597 3:141214512-141214534 AGGGACTTCAGCCATGGGGTGGG - Intergenic
979511140 4:121555242-121555264 CAGAACTCCACCTATGGGATAGG + Intergenic
980442947 4:132871188-132871210 AGGTACTACATCAATGGCATTGG + Intergenic
981416288 4:144497733-144497755 AGGAGCTCCTCCCATGGGAGGGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
997259083 5:132451774-132451796 AGGATCTATACCCAAGAGATAGG + Intronic
998991382 5:147821637-147821659 AGGAACAGCACCAAAGGGATGGG - Intergenic
1002833300 6:843728-843750 AGGCCCTAAGCCCATGGGATTGG - Intergenic
1016888199 6:148979214-148979236 GGAAACCACACCCATGGGAAAGG - Intronic
1019218389 6:170457901-170457923 AGGGACTCCTCCTATGGGATAGG - Intergenic
1019218395 6:170457921-170457943 AGGGACTCCTCCTATGGGATAGG - Intergenic
1023504829 7:40888673-40888695 AGGGACTACAGGCATGGGTTGGG + Intergenic
1027269781 7:76513073-76513095 AGGAACTTCACCCTGGGGATGGG - Intronic
1039276783 8:35941374-35941396 AGGCACTAAATCCATGGGAGAGG + Intergenic
1043050225 8:75376986-75377008 AGGAACAACACACATGGTGTTGG - Intergenic
1043371754 8:79602597-79602619 AGGAACTACATATATGGAATTGG - Intergenic
1045809224 8:106201877-106201899 GGGAACTTGACTCATGGGATGGG - Intergenic
1045826406 8:106403421-106403443 GGGAACTACACCCATTGATTTGG - Intronic
1046839295 8:118839747-118839769 ATGAACTACACCCAGAGAATTGG + Intergenic
1046928402 8:119818034-119818056 AGGAGATACACAAATGGGATTGG - Intronic
1047177183 8:122553088-122553110 AGGAATTAGTCCCATAGGATAGG + Intergenic
1048318655 8:133381303-133381325 AGTAAATACAACCAGGGGATGGG - Intergenic
1048848955 8:138626313-138626335 AGGAACTGCATTCATGGGTTGGG + Intronic
1049926674 9:415714-415736 AAGAACTACTCTGATGGGATAGG - Intronic
1049929969 9:446605-446627 AGGTAATGCACCCAAGGGATTGG + Exonic
1051914434 9:22191229-22191251 AGGAACAACACAACTGGGATTGG - Intergenic
1057311737 9:93947485-93947507 CGGCAGTACACCCATGGGAGTGG + Intergenic
1061264286 9:129496551-129496573 AGGTGCGACACCCAAGGGATGGG - Intergenic
1062633171 9:137476288-137476310 AGGAACTTCAATCATAGGATAGG + Intronic
1191627054 X:63280869-63280891 AGAAACATCACCCATGGGGTTGG - Intergenic
1200896373 Y:8380062-8380084 AGGTACTGCACCCAGGTGATTGG - Intergenic
1202254275 Y:22904733-22904755 GGGAACTTCATCCAGGGGATGGG - Intergenic
1202254958 Y:22911538-22911560 GGGTACTGCACCCATGTGATGGG + Intergenic
1202407266 Y:24538482-24538504 GGGAACTTCATCCAGGGGATGGG - Intergenic
1202407949 Y:24545287-24545309 GGGTACTGCACCCATGTGATGGG + Intergenic
1202462833 Y:25124794-25124816 GGGTACTGCACCCATGTGATGGG - Intergenic
1202463516 Y:25131599-25131621 GGGAACTTCATCCAGGGGATGGG + Intergenic