ID: 1151652103 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:75476398-75476420 |
| Sequence | AAGAGGAAAGAGAAGGAGGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 6569 | |||
| Summary | {0: 1, 1: 7, 2: 98, 3: 842, 4: 5621} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1151652103_1151652111 | 3 | Left | 1151652103 | 17:75476398-75476420 | CCTCCCTCCTTCTCTTTCCTCTT | 0: 1 1: 7 2: 98 3: 842 4: 5621 |
||
| Right | 1151652111 | 17:75476424-75476446 | CCCTCCCTCCCGCCCTTCCAGGG | 0: 1 1: 1 2: 17 3: 112 4: 671 |
||||
| 1151652103_1151652109 | 2 | Left | 1151652103 | 17:75476398-75476420 | CCTCCCTCCTTCTCTTTCCTCTT | 0: 1 1: 7 2: 98 3: 842 4: 5621 |
||
| Right | 1151652109 | 17:75476423-75476445 | CCCCTCCCTCCCGCCCTTCCAGG | 0: 1 1: 1 2: 9 3: 160 4: 950 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1151652103 | Original CRISPR | AAGAGGAAAGAGAAGGAGGG AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||