ID: 1151652103

View in Genome Browser
Species Human (GRCh38)
Location 17:75476398-75476420
Sequence AAGAGGAAAGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6569
Summary {0: 1, 1: 7, 2: 98, 3: 842, 4: 5621}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151652103_1151652111 3 Left 1151652103 17:75476398-75476420 CCTCCCTCCTTCTCTTTCCTCTT 0: 1
1: 7
2: 98
3: 842
4: 5621
Right 1151652111 17:75476424-75476446 CCCTCCCTCCCGCCCTTCCAGGG 0: 1
1: 1
2: 17
3: 112
4: 671
1151652103_1151652109 2 Left 1151652103 17:75476398-75476420 CCTCCCTCCTTCTCTTTCCTCTT 0: 1
1: 7
2: 98
3: 842
4: 5621
Right 1151652109 17:75476423-75476445 CCCCTCCCTCCCGCCCTTCCAGG 0: 1
1: 1
2: 9
3: 160
4: 950

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151652103 Original CRISPR AAGAGGAAAGAGAAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr