ID: 1151653961

View in Genome Browser
Species Human (GRCh38)
Location 17:75486805-75486827
Sequence TACCCCACCCCAATTCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151653961_1151653973 23 Left 1151653961 17:75486805-75486827 CCTGCAGGAATTGGGGTGGGGTA 0: 1
1: 0
2: 0
3: 27
4: 172
Right 1151653973 17:75486851-75486873 CAGCCCAGCTCCAAAAGGGAGGG 0: 1
1: 0
2: 5
3: 24
4: 276
1151653961_1151653967 -2 Left 1151653961 17:75486805-75486827 CCTGCAGGAATTGGGGTGGGGTA 0: 1
1: 0
2: 0
3: 27
4: 172
Right 1151653967 17:75486826-75486848 TAGGGGCCGGGAGCCTGAGATGG 0: 1
1: 0
2: 5
3: 25
4: 214
1151653961_1151653977 29 Left 1151653961 17:75486805-75486827 CCTGCAGGAATTGGGGTGGGGTA 0: 1
1: 0
2: 0
3: 27
4: 172
Right 1151653977 17:75486857-75486879 AGCTCCAAAAGGGAGGGGAGTGG 0: 1
1: 0
2: 5
3: 53
4: 487
1151653961_1151653970 18 Left 1151653961 17:75486805-75486827 CCTGCAGGAATTGGGGTGGGGTA 0: 1
1: 0
2: 0
3: 27
4: 172
Right 1151653970 17:75486846-75486868 TGGAGCAGCCCAGCTCCAAAAGG 0: 1
1: 0
2: 0
3: 28
4: 262
1151653961_1151653974 24 Left 1151653961 17:75486805-75486827 CCTGCAGGAATTGGGGTGGGGTA 0: 1
1: 0
2: 0
3: 27
4: 172
Right 1151653974 17:75486852-75486874 AGCCCAGCTCCAAAAGGGAGGGG 0: 1
1: 0
2: 2
3: 23
4: 254
1151653961_1151653972 22 Left 1151653961 17:75486805-75486827 CCTGCAGGAATTGGGGTGGGGTA 0: 1
1: 0
2: 0
3: 27
4: 172
Right 1151653972 17:75486850-75486872 GCAGCCCAGCTCCAAAAGGGAGG 0: 1
1: 0
2: 2
3: 14
4: 191
1151653961_1151653971 19 Left 1151653961 17:75486805-75486827 CCTGCAGGAATTGGGGTGGGGTA 0: 1
1: 0
2: 0
3: 27
4: 172
Right 1151653971 17:75486847-75486869 GGAGCAGCCCAGCTCCAAAAGGG 0: 1
1: 0
2: 2
3: 21
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151653961 Original CRISPR TACCCCACCCCAATTCCTGC AGG (reversed) Intronic
900382768 1:2392973-2392995 TCCCCATCCCCAATTCCTCCGGG - Intronic
900401337 1:2474132-2474154 TGCCCCACCCCCATGCCGGCAGG - Intronic
901014040 1:6217632-6217654 AACCCACCCCCAAGTCCTGCTGG + Intronic
901570350 1:10155196-10155218 AACCCCCACCCAATTCCTTCTGG - Intronic
901724440 1:11229772-11229794 TACCCCACCCCCATTCACTCAGG + Intronic
901760695 1:11469308-11469330 TCCCCCACCCCACTGCCTGAGGG - Intergenic
903821148 1:26103461-26103483 CACCCCAGCCCCATTTCTGCAGG - Intergenic
904891435 1:33782542-33782564 TGCCCAACCCCAAATCCTACAGG + Intronic
905013695 1:34763056-34763078 TGCCCCACCCCATCTCATGCAGG + Exonic
906210145 1:44008322-44008344 CCCCCCACCCCAGGTCCTGCAGG + Intronic
910002279 1:82355085-82355107 CACGCCACCCCTAATCCTGCTGG - Intergenic
911299726 1:96157347-96157369 TACCCCACCCCAATGGCCACAGG - Intergenic
914755121 1:150558017-150558039 CACCCCCCCCAAATTCCTGCCGG - Exonic
915037874 1:152943752-152943774 AACCCCACGCCAAGTCCTGTGGG - Intergenic
916123955 1:161552742-161552764 AACCCCACCCCAACTCCTTTAGG + Intergenic
918284346 1:183037229-183037251 TACCCTACCTCATTTCCTGAGGG + Intronic
919797426 1:201329673-201329695 CCCCCCACCCCAATCCCTGGTGG + Intronic
919815566 1:201436449-201436471 TATTCCACACCAATTCCAGCGGG + Intergenic
919975111 1:202605434-202605456 TCCCCCTCCCCGATTCCTGCAGG + Intronic
920757601 1:208749104-208749126 TTCCCCACCCCCATTGCCGCTGG - Intergenic
922504374 1:226118120-226118142 GACCCCACCCCACCTCCTACAGG - Intergenic
922769644 1:228175100-228175122 TTCCCCCCTCCAATCCCTGCAGG + Exonic
924449180 1:244162410-244162432 TACCCCACCCCTATTCAAGATGG + Intergenic
1065804280 10:29380668-29380690 GACCCGCCCCCAACTCCTGCTGG + Intergenic
1069721606 10:70553422-70553444 TACCCCATCCCACTCCCTGCTGG - Intronic
1071384935 10:85110232-85110254 TACCCCACCCTCATCCCTGGAGG - Intergenic
1073048276 10:100652796-100652818 TACCCCATCCCATTTTCTGCGGG + Intergenic
1073186851 10:101620172-101620194 CGCCCAACCCCAAGTCCTGCCGG + Intronic
1073295565 10:102436281-102436303 TAACCTACTCCAATTCCTGTTGG + Intergenic
1075880100 10:125843740-125843762 TACCACACCTCCAGTCCTGCTGG + Intronic
1076001289 10:126915050-126915072 TTTCCCACCCCACTTGCTGCAGG - Intronic
1076439106 10:130467406-130467428 CACCCAAGCCCAAATCCTGCAGG - Intergenic
1076934716 10:133559681-133559703 AACCCCACCCAAATTGCTGCAGG - Intronic
1077066276 11:642334-642356 TACCCCCACTCCATTCCTGCAGG + Intergenic
1077290252 11:1786175-1786197 TTCCCCACCCCCAACCCTGCCGG + Intergenic
1078057020 11:8017304-8017326 TACCCCATCCCAATCCATGCTGG - Intergenic
1078855309 11:15201784-15201806 GATCCCACCCCAAATCCTGCAGG - Intronic
1079003319 11:16775461-16775483 CACCCCACCCCCATCCCTTCAGG + Intergenic
1080385466 11:31808468-31808490 TACCCCACCCCAACAAATGCAGG + Intronic
1081253181 11:40860673-40860695 TCCCCTACCCCAACTCCTCCAGG + Intronic
1081671603 11:44945633-44945655 CATCCCTCCCCAAGTCCTGCTGG - Intronic
1081870358 11:46380344-46380366 TGCCCCACCCCACCTCCTCCGGG + Exonic
1083276192 11:61598324-61598346 TCCCAGACCCCTATTCCTGCCGG - Intergenic
1083793798 11:65002863-65002885 TCCCCAACCCCCAGTCCTGCTGG + Intergenic
1085345001 11:75762967-75762989 CCCCACCCCCCAATTCCTGCAGG + Intronic
1088658174 11:112021503-112021525 TACCCCACACCAATGCCACCAGG - Intronic
1090472853 11:126995846-126995868 TGCTCCACCCCATCTCCTGCTGG + Intronic
1090493891 11:127191104-127191126 CACCCCACTCCAACTCCTGGAGG - Intergenic
1094379389 12:29826748-29826770 TTACCCACCCCATTTTCTGCGGG + Intergenic
1096631091 12:52927258-52927280 CACCCCTCCCCAACTCCAGCAGG + Intronic
1096869413 12:54584018-54584040 TTGACCACCCCAATTCCTGGGGG + Intronic
1102580599 12:113884384-113884406 GTCCCCACCTCTATTCCTGCAGG + Intronic
1104052895 12:125208443-125208465 CTCCCCACCCCCATTCCTCCAGG + Intronic
1105403973 13:20118835-20118857 TCCCCCACCCCCTTCCCTGCGGG + Intergenic
1106571958 13:30935128-30935150 TACCCCACCCACATCCCTGCAGG + Intronic
1107048963 13:36027172-36027194 CACCCCACCCCCATTTCTGTGGG - Intronic
1107875906 13:44790145-44790167 GACCCCACCCCCATCCCTGCAGG - Intergenic
1110938734 13:81322716-81322738 TACCCAAGCCCAAGTCCTGAAGG - Intergenic
1115157334 14:30356231-30356253 CACCCCAGACCAATTCCTCCCGG + Intergenic
1115871589 14:37810258-37810280 CTCCCCAACCCCATTCCTGCCGG + Intronic
1120624025 14:86802522-86802544 TTCCCATCCCCAACTCCTGCAGG + Intergenic
1122172706 14:99889957-99889979 CACCCCACCCCATGTGCTGCAGG + Intronic
1122438548 14:101714774-101714796 TAGCCCATCCCAATTCATACTGG - Intergenic
1123028493 14:105439662-105439684 CACCCCACCCCACTCTCTGCTGG - Intronic
1124490770 15:30153784-30153806 TTCCCCTCCCCGATTCCTGCAGG + Intergenic
1124752762 15:32384545-32384567 TTCCCCTCCCCGATTCCTGCAGG - Intergenic
1125551130 15:40545649-40545671 TACCCCACACCACCTCCTACAGG - Intronic
1125728946 15:41882253-41882275 CACCCCTCCCCACTACCTGCAGG + Exonic
1125887345 15:43238626-43238648 ACCCCCACCCCACATCCTGCAGG - Intronic
1126300035 15:47184750-47184772 GCCCCCACCCCAAATCCTCCGGG + Intronic
1127221482 15:56885711-56885733 TCCCCCTCCCCAACTCCTACTGG + Intronic
1128112075 15:65082755-65082777 AGCCCCACCCCACTTCCTGCAGG + Intergenic
1129219793 15:74125148-74125170 AATCCCACCCCAATTCAGGCAGG - Intronic
1132328530 15:100993826-100993848 TACCCTTCCCTTATTCCTGCTGG + Intronic
1133321810 16:4918827-4918849 TGCCCCACCCACATTCCTGCTGG - Intronic
1134257753 16:12625844-12625866 CCCCCCACCCCAATTGCTGGGGG + Intergenic
1137238323 16:46633584-46633606 CACCCCACCCTCATCCCTGCAGG - Intergenic
1137673998 16:50294832-50294854 CTCCCCATCCCAATTCCAGCAGG - Intronic
1139511878 16:67432279-67432301 TCCCCCTCCCCACTTCCGGCGGG - Intronic
1141617091 16:85216032-85216054 TGCCCCTCCCCAACTCCTGTTGG - Intergenic
1142827891 17:2525582-2525604 TAACCCACCCCAAGCCCTGCAGG - Intergenic
1143525136 17:7467410-7467432 CACCCCTCCCCACTTCCTGGGGG - Intronic
1146134007 17:30302476-30302498 TACCCAGCCCCAATTCCGGATGG + Intergenic
1147261287 17:39210904-39210926 CACCCCACCCCATTTCCTGGTGG + Exonic
1147759267 17:42787259-42787281 TCCCCCACCCCAATTCCAGGTGG + Exonic
1148769826 17:50060349-50060371 TACCCCACCCCAGTGCCCCCAGG + Intronic
1151653961 17:75486805-75486827 TACCCCACCCCAATTCCTGCAGG - Intronic
1156098651 18:33566379-33566401 CACCCCACCCCAATGACTGCAGG - Intergenic
1156435095 18:37118425-37118447 TACAACAACCCAATTCCTGCAGG - Intronic
1158209711 18:55034576-55034598 TACCCCAGCCCCATTTCTCCAGG - Intergenic
1158597881 18:58832269-58832291 AACCCCTCCCCCTTTCCTGCTGG - Intergenic
1158632931 18:59132054-59132076 TCCCCCCCCCCAACCCCTGCAGG + Intergenic
1160918840 19:1510505-1510527 AACCCCACCCGCATTCCAGCGGG + Intronic
1162519734 19:11172764-11172786 GACCCCATCCCACATCCTGCTGG - Intronic
1164203034 19:23034067-23034089 CACCCCACCCCAATGGCTGCAGG - Intergenic
1165466247 19:35976784-35976806 AACCCCGCCCCTATTGCTGCTGG - Intergenic
1166321406 19:42021431-42021453 TAACCCACACCCATGCCTGCGGG - Exonic
1167235026 19:48309089-48309111 CTCCCCACCCCGATCCCTGCAGG + Intronic
1167324184 19:48813730-48813752 TTCCCCGCTCCATTTCCTGCAGG - Exonic
1167975005 19:53218796-53218818 TCCCCCACACCAATCCCTGATGG - Intergenic
1168093949 19:54103651-54103673 TCCCCCGCCCCCATCCCTGCAGG - Intronic
1168332358 19:55578073-55578095 GACCCCACCCCAGTCCCCGCCGG - Exonic
925446601 2:3931531-3931553 TTCCCCAACCCAATGCCTGGAGG + Intergenic
926980375 2:18561160-18561182 ACCCCCACCCCAAGTCCTCCAGG - Intronic
927158854 2:20239809-20239831 CACCCTACCCCAGTTCCTTCTGG - Intergenic
927208965 2:20627154-20627176 TTCCCCACCGCAGTGCCTGCTGG - Intronic
927783023 2:25954539-25954561 TAGCCCAGCCCAATTCGTGGTGG - Intronic
928415871 2:31091171-31091193 TACCCACCCCCCATTTCTGCAGG + Intronic
928906095 2:36369318-36369340 TACCACAGCCCAGTGCCTGCTGG + Intronic
932008008 2:67947001-67947023 TCCCCCACCCCAATTTCTGTAGG - Intergenic
932965296 2:76467321-76467343 TACCCCACCCCTATTCCCACTGG - Intergenic
933219323 2:79670043-79670065 TCCCCCAACCCTGTTCCTGCAGG - Intronic
934886886 2:98032756-98032778 CACCCCAGCTCAATCCCTGCTGG - Intergenic
934931588 2:98430065-98430087 GAGCCCACCCCAATGGCTGCAGG + Intergenic
936286367 2:111184470-111184492 TACCACCCTCCAAATCCTGCTGG + Intergenic
936500175 2:113060591-113060613 TGCCCCAACCCATCTCCTGCTGG - Intronic
937043371 2:118837582-118837604 CACCCCACCCCCATACCTGTGGG + Intergenic
937784961 2:125885881-125885903 TACAACAGCCCAATCCCTGCAGG - Intergenic
938604902 2:132882371-132882393 CACCCCACCCCAAGCCCTACAGG + Intronic
941432250 2:165426871-165426893 ACCCCCACCCCCACTCCTGCAGG + Intergenic
941901762 2:170685800-170685822 TAATCCACCCCACTGCCTGCAGG - Intergenic
945668946 2:212779046-212779068 TTCCTCACCCCACTTCCTTCAGG + Intergenic
948622856 2:239247356-239247378 TATTCCACCCCAAACCCTGCAGG - Intronic
949002545 2:241624704-241624726 TACCCCATTCCTCTTCCTGCAGG + Intronic
1173483949 20:43426718-43426740 CAACCCACCCCAACTCCTACTGG + Intergenic
1178418823 21:32426881-32426903 TACTGCACACCCATTCCTGCTGG - Intronic
1179313915 21:40223932-40223954 TACCCCACCCCACATGCTGTGGG + Intronic
1179826280 21:43968216-43968238 CACCCCACCCCCAGCCCTGCAGG - Intronic
1181533539 22:23530455-23530477 TCCCCCACCCCATCTTCTGCTGG + Intergenic
1182452119 22:30427888-30427910 CACCCCACCCTATTTCTTGCTGG + Intronic
1184111805 22:42399843-42399865 AACCCCAGCCCATTTACTGCGGG + Intronic
1184420443 22:44379719-44379741 TTCCCAACCCAAATTCCAGCAGG + Intergenic
1185079711 22:48702848-48702870 CACCCCAGCCCACTTCCTGCTGG - Intronic
951938459 3:28050683-28050705 GAACCCACCCCCATTCCTGGTGG - Intergenic
952805736 3:37349601-37349623 TACCCCCTCCCAATACCTACAGG - Intronic
953930441 3:47003244-47003266 CACCCCACCCGAGTTGCTGCAGG + Exonic
956172262 3:66442429-66442451 TCCCCCTCCTCACTTCCTGCAGG - Intronic
961522243 3:127473546-127473568 TTCCCCGCCCCAATCCCAGCGGG + Intergenic
961674372 3:128555730-128555752 TACCCGGCCGGAATTCCTGCAGG + Intergenic
961794801 3:129401794-129401816 AAACACACCCCAATTCCTTCTGG - Exonic
962314785 3:134352609-134352631 TGCCCCACTCCCACTCCTGCTGG + Intergenic
963900084 3:150725547-150725569 TACCCCAAGTCCATTCCTGCAGG - Intergenic
965480449 3:169212382-169212404 TACCATACTCCAATGCCTGCAGG + Intronic
965890542 3:173508538-173508560 TACCCCAACCCATTTTCTCCTGG - Intronic
966344612 3:178964748-178964770 GACCCCACTCCATTTCCTGGAGG - Intergenic
966491415 3:180531863-180531885 GACCCCCCCCCCATCCCTGCAGG + Intergenic
968711893 4:2125566-2125588 TACCCCACCCCAGGTGCTGGCGG - Intronic
968760780 4:2442023-2442045 AGCCCCACCCCAACTCCAGCAGG + Intronic
969450706 4:7271456-7271478 TACCCTTCCCCACTTCCTTCAGG + Intronic
974099901 4:57405173-57405195 TGTGCCACCCCAAGTCCTGCAGG - Intergenic
975430638 4:74286753-74286775 TATTCCACCTCAATCCCTGCAGG - Intronic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
981516934 4:145619508-145619530 TCCCCCACCCCAAATCCTCCAGG - Intronic
982478150 4:155877768-155877790 TACCCCACCCTGATGGCTGCAGG - Intronic
985826358 5:2194385-2194407 TACTCCATCCCCCTTCCTGCTGG - Intergenic
988040554 5:25883865-25883887 TACCCCACCCCACTTCAAGATGG + Intergenic
989691660 5:44152178-44152200 CACCCCACCCCAAAGGCTGCAGG + Intergenic
996221040 5:120933578-120933600 TACCCCTCCCTATTTCCTGAGGG + Intergenic
999171363 5:149597949-149597971 GACCCCACCCAAGTACCTGCTGG - Exonic
1003137316 6:3443735-3443757 TCCCTCACCCCAATCCATGCTGG + Intronic
1004516127 6:16323840-16323862 TACCCACCCCTAATTCATGCAGG + Intronic
1006134593 6:31887984-31888006 TCCCCCACCCCTATTGCTCCTGG - Intronic
1006184927 6:32176095-32176117 CACCCCTCCCCAACGCCTGCTGG + Intronic
1011572618 6:88755503-88755525 TTCCCCAACCCAATCCCTACAGG - Intronic
1012031126 6:94065929-94065951 TACACCACCCGACTTCCAGCAGG - Intergenic
1017036293 6:150270139-150270161 TAGCCACCCCCACTTCCTGCAGG - Intergenic
1019318322 7:401768-401790 CTCCCCACCCCCATCCCTGCCGG - Intergenic
1022104467 7:27188350-27188372 TACCCGTCTCCTATTCCTGCTGG - Intergenic
1027004531 7:74681559-74681581 TACCCAAACCCAATTACTGTGGG - Intronic
1029061026 7:97798049-97798071 TTCCCCACCCTAATCCCTGAAGG + Intergenic
1033275218 7:139966867-139966889 TACCCCTCCCCCACCCCTGCTGG + Intronic
1034342383 7:150366303-150366325 GCCCCCTCCCCACTTCCTGCAGG + Intergenic
1034748070 7:153541701-153541723 TACACCACCCCAGTTACTACGGG - Intergenic
1036663104 8:10721076-10721098 TATCCCACCCCAATTCTGCCAGG + Intergenic
1036728646 8:11242608-11242630 TCCCCAGTCCCAATTCCTGCAGG + Intergenic
1037802887 8:22044654-22044676 TCCCCCACCCCAAATGCTCCAGG + Intronic
1040578148 8:48672544-48672566 TACCCCACCCCACATACTCCAGG + Intergenic
1040997238 8:53414078-53414100 CACCCCACCCCAAGGGCTGCAGG - Intergenic
1041129011 8:54676609-54676631 TACCCGTCCCTAATCCCTGCAGG + Intergenic
1042523494 8:69740241-69740263 TCTCCCACCCCAACTCCTGGAGG - Intronic
1043426934 8:80156942-80156964 TACCATTCCCCCATTCCTGCAGG - Intronic
1049421904 8:142520716-142520738 AGCCCCACCCCACTTCCTGCAGG - Intronic
1051476041 9:17510109-17510131 TACCACAACCCAATTCATTCAGG + Intergenic
1052342251 9:27375245-27375267 TACCCCACTCCAGTGCTTGCTGG - Intronic
1057531120 9:95847556-95847578 CTCCCCACCCCCATCCCTGCAGG + Intergenic
1059566257 9:115385676-115385698 TCCCCCACCCCCATCCTTGCAGG + Intronic
1059688020 9:116656641-116656663 TTCTCCTCCCAAATTCCTGCTGG + Intronic
1060730662 9:126034817-126034839 TCCCCCAGCTCTATTCCTGCTGG - Intergenic
1061454492 9:130687579-130687601 TTCCCCACCCCAACTCCTCAGGG + Intergenic
1061657595 9:132104762-132104784 CACCCCACCCCAAGTCATGTAGG + Intergenic
1062277593 9:135738064-135738086 TGCCCCATCCCTGTTCCTGCAGG + Intronic
1062556999 9:137117567-137117589 CTCCACACCCCGATTCCTGCTGG + Intergenic
1186566398 X:10667293-10667315 TACCCCACCCCCACTCATGTAGG - Intronic
1186636352 X:11409304-11409326 CCCCCCACCCCATTTCTTGCAGG - Intronic
1189566129 X:42242975-42242997 TATCCCACCTCAATACCTGCTGG - Intergenic
1189649838 X:43177421-43177443 ACCCCCACCCCAATGGCTGCAGG + Intergenic
1190444926 X:50514866-50514888 CACCCCACCCCCATTTCTGCAGG - Intergenic
1194810279 X:98380351-98380373 CACCCCACCCCAATGGCTGCAGG - Intergenic
1197815416 X:130493335-130493357 TCCCCCACCCCAATTCTGGTTGG - Intergenic
1199552863 X:149077152-149077174 CCCCCCACCCCCATTCCTGATGG + Intergenic