ID: 1151654387

View in Genome Browser
Species Human (GRCh38)
Location 17:75488992-75489014
Sequence TCATCTCGAGGTTCTCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151654371_1151654387 30 Left 1151654371 17:75488939-75488961 CCCTGGTGTCTTCTGTGAAGAGG 0: 1
1: 0
2: 0
3: 22
4: 254
Right 1151654387 17:75488992-75489014 TCATCTCGAGGTTCTCTTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1151654373_1151654387 29 Left 1151654373 17:75488940-75488962 CCTGGTGTCTTCTGTGAAGAGGG 0: 1
1: 0
2: 2
3: 27
4: 214
Right 1151654387 17:75488992-75489014 TCATCTCGAGGTTCTCTTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151654387 Original CRISPR TCATCTCGAGGTTCTCTTGA GGG Intronic