ID: 1151654387

View in Genome Browser
Species Human (GRCh38)
Location 17:75488992-75489014
Sequence TCATCTCGAGGTTCTCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151654373_1151654387 29 Left 1151654373 17:75488940-75488962 CCTGGTGTCTTCTGTGAAGAGGG 0: 1
1: 0
2: 2
3: 27
4: 214
Right 1151654387 17:75488992-75489014 TCATCTCGAGGTTCTCTTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1151654371_1151654387 30 Left 1151654371 17:75488939-75488961 CCCTGGTGTCTTCTGTGAAGAGG 0: 1
1: 0
2: 0
3: 22
4: 254
Right 1151654387 17:75488992-75489014 TCATCTCGAGGTTCTCTTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151654387 Original CRISPR TCATCTCGAGGTTCTCTTGA GGG Intronic
908307031 1:62830302-62830324 TCATCTAGAGAATCTGTTGAGGG + Intronic
909258183 1:73451137-73451159 TCAACTCCAGGCTTTCTTGATGG + Intergenic
915073385 1:153290498-153290520 TCCTCACAAGGTTCTCGTGAAGG + Intergenic
915482604 1:156197308-156197330 TGTTCTAGGGGTTCTCTTGACGG + Intronic
920497437 1:206465335-206465357 ACATCTTGAGCTTCTCTTGCTGG + Intergenic
922684384 1:227627869-227627891 CCTTCTAGAGGTTCCCTTGACGG - Intronic
1068396621 10:56470214-56470236 TCATCTGTAGGTTCTCTGGTTGG + Intergenic
1069823031 10:71239321-71239343 TCATAACGAGGTTCTCCTGGGGG - Intronic
1069876333 10:71565459-71565481 GCATCTCCAGGCTCTCTTGCTGG - Intronic
1074136366 10:110630383-110630405 TCATCTCCAGGTTCTCTTTGTGG + Intergenic
1074296250 10:112192139-112192161 TTATGTCAAAGTTCTCTTGAAGG - Intronic
1077290818 11:1791282-1791304 TCATCTTGAGGTGCTACTGAAGG + Intergenic
1079657240 11:22999056-22999078 TCACGTCGAAGTCCTCTTGAGGG + Intergenic
1106948054 13:34850653-34850675 TCATCTTGTGGTTATCATGAAGG - Intergenic
1107408674 13:40138755-40138777 TCCTCTCAACGTTCACTTGAGGG - Intergenic
1109492078 13:63114699-63114721 TCATCTCACACTTCTCTTGAAGG + Intergenic
1111583279 13:90252480-90252502 TCTTCTCTGGGTTGTCTTGAAGG + Intergenic
1113148114 13:107231396-107231418 TCAGATCGTGGTTCTCTTCATGG + Intronic
1132301735 15:100780306-100780328 TCATCTCTGGTTTCTCTTGCTGG - Intergenic
1142287852 16:89178733-89178755 ACATCTCCAGCTGCTCTTGATGG + Intronic
1145782974 17:27575846-27575868 TCATCTCATGGTTCTCTAGGTGG + Intronic
1148427534 17:47612461-47612483 TCATCTCGATGCACTCCTGAGGG + Exonic
1151617760 17:75225443-75225465 TCACCTGGAGTCTCTCTTGAAGG + Exonic
1151654387 17:75488992-75489014 TCATCTCGAGGTTCTCTTGAGGG + Intronic
1151934271 17:77252492-77252514 TCATCTCAGGGTTCAGTTGACGG + Intergenic
1157339180 18:46764233-46764255 TGATCTCCAGGTTCACTTCAAGG - Intergenic
1159503301 18:69301502-69301524 TAAATTCCAGGTTCTCTTGAAGG - Intergenic
1161638928 19:5407404-5407426 TCATAATGAGGTTCTCTAGAGGG - Intergenic
1161660956 19:5545929-5545951 TTCTCTAGAGGTTCTCTAGAGGG - Intergenic
1166087157 19:40484453-40484475 TCATCTCGAGGTTATCTGGGAGG - Intronic
925915314 2:8600390-8600412 TCCTCTCGAGGGTCTCATGGTGG + Intergenic
934052710 2:88223745-88223767 TCATCCCAGGGTTCTCTGGAAGG + Intergenic
940567148 2:155380541-155380563 TTAACACAAGGTTCTCTTGAGGG + Intergenic
943683284 2:190790038-190790060 GCATCTAGAGGTCCTCTTTATGG + Intergenic
944296843 2:198075089-198075111 TTAATTCGATGTTCTCTTGATGG - Intronic
945289488 2:208113125-208113147 TCATAGAGAGGTTCTCTTAAAGG - Intergenic
1172664018 20:36586748-36586770 CCATATCCAGGTGCTCTTGAAGG - Intronic
1173513208 20:43646535-43646557 TCATCTCTGGGTTCCCTTCATGG - Intronic
1176137004 20:63528224-63528246 TCTTCTGGAGGTTCTATTTACGG - Exonic
1176303980 21:5113982-5114004 TGACCTCCAGGCTCTCTTGAAGG - Intergenic
1179853050 21:44147968-44147990 TGACCTCCAGGCTCTCTTGAAGG + Intergenic
1184329203 22:43815469-43815491 TCATCTCGGGGTTCTTTGGATGG + Intergenic
950395240 3:12728932-12728954 TCCTCTCGGACTTCTCTTGAAGG + Intergenic
952803718 3:37324163-37324185 TCAACTTGAGCTTCTCTTGAAGG + Exonic
971551628 4:27964875-27964897 TCTTCTAGCCGTTCTCTTGATGG + Intergenic
977663898 4:99622773-99622795 ACATCTCTGAGTTCTCTTGATGG - Exonic
985583455 5:712499-712521 TCATCTCTAAGTTTTCTGGAAGG - Intronic
985794594 5:1952754-1952776 TCATCTCAGGGTTCCCTGGAAGG + Intergenic
987942323 5:24555616-24555638 TAAGCTACAGGTTCTCTTGACGG - Intronic
991643389 5:68776482-68776504 TCTTCTCCAAGTTCTCTGGAGGG + Intergenic
993401463 5:87457763-87457785 TCATCTCAACTTTCTATTGAGGG - Intergenic
994098136 5:95865938-95865960 TGATCTCCAGGTTCTTTTGCTGG + Intergenic
1005417969 6:25621739-25621761 TTCTCTTGAAGTTCTCTTGAAGG - Intergenic
1012884299 6:104826973-104826995 TCTTCTTAAGGATCTCTTGAAGG - Intronic
1013253516 6:108359529-108359551 TCATCTCAAGGATGCCTTGAAGG + Intronic
1013324215 6:109028232-109028254 TCTTCTCAAGTTTCTCTTCAGGG + Intronic
1018618838 6:165711510-165711532 CCATTTGGAGGTTTTCTTGAGGG + Intronic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1023496125 7:40799158-40799180 TCAGCTCCAGGATCTCTTCATGG - Intronic
1027864395 7:83628277-83628299 TCTTCTCAAGGTTATCTTCATGG + Intronic
1030433571 7:109485255-109485277 TCATGTCTAGGTTCTGTTAAGGG - Intergenic
1035103878 7:156425355-156425377 TCATCTAAAGATTCACTTGAAGG + Intergenic
1038202961 8:25432689-25432711 TCATCTTGCAGTTCTGTTGAAGG - Intronic
1039021081 8:33207238-33207260 TTATCTCTAGGATCTCTTCATGG + Intergenic
1056501730 9:87216184-87216206 TGATCTGAAGGTTCTTTTGATGG - Intergenic
1058479223 9:105373800-105373822 TCTTCCATAGGTTCTCTTGAAGG - Intronic
1061746579 9:132744657-132744679 ACATATTGGGGTTCTCTTGATGG - Intronic
1185789045 X:2914658-2914680 TCCTCTCCAGGGTTTCTTGAAGG + Intronic
1188104987 X:26138831-26138853 ACCTCTCCTGGTTCTCTTGAGGG - Intronic
1196941670 X:120782813-120782835 TCATCTCAAGGTTCAACTGAGGG - Intergenic
1197149373 X:123203469-123203491 ATATCACGAGGTTCCCTTGAAGG + Intronic
1199727799 X:150602034-150602056 TCTTCCCCAGCTTCTCTTGAAGG + Intronic