ID: 1151655266

View in Genome Browser
Species Human (GRCh38)
Location 17:75492875-75492897
Sequence TGCCCTGGCAATACCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151655266_1151655277 22 Left 1151655266 17:75492875-75492897 CCTGGCAGGGTATTGCCAGGGCA 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1151655277 17:75492920-75492942 GCCCTGCAGGCTTCACTCCTGGG 0: 1
1: 0
2: 1
3: 23
4: 362
1151655266_1151655271 9 Left 1151655266 17:75492875-75492897 CCTGGCAGGGTATTGCCAGGGCA 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1151655271 17:75492907-75492929 GTTCCTGTTCCCCGCCCTGCAGG 0: 1
1: 0
2: 3
3: 23
4: 207
1151655266_1151655276 21 Left 1151655266 17:75492875-75492897 CCTGGCAGGGTATTGCCAGGGCA 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1151655276 17:75492919-75492941 CGCCCTGCAGGCTTCACTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 280
1151655266_1151655281 29 Left 1151655266 17:75492875-75492897 CCTGGCAGGGTATTGCCAGGGCA 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1151655281 17:75492927-75492949 AGGCTTCACTCCTGGGGCCAAGG 0: 1
1: 0
2: 4
3: 129
4: 3412
1151655266_1151655279 23 Left 1151655266 17:75492875-75492897 CCTGGCAGGGTATTGCCAGGGCA 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1151655279 17:75492921-75492943 CCCTGCAGGCTTCACTCCTGGGG 0: 1
1: 0
2: 2
3: 37
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151655266 Original CRISPR TGCCCTGGCAATACCCTGCC AGG (reversed) Intronic
903849388 1:26297026-26297048 TGCCCCAGCAAGACACTGCCAGG + Intronic
903937550 1:26906945-26906967 TCTTCTGGCCATACCCTGCCAGG + Intronic
906705949 1:47895427-47895449 TGCCCTGGGACTGCCCAGCCTGG + Intronic
908045541 1:60163948-60163970 TGCCCTGGTTATTCCTTGCCAGG - Intergenic
918577013 1:186073607-186073629 TCCCCTGGCAAAACCCTAACTGG - Intronic
919298777 1:195734841-195734863 TGCCCTCAGAATACCCTCCCAGG + Intergenic
921252720 1:213312440-213312462 TGCCCTGAAAATCCCCTTCCAGG - Intergenic
922037779 1:221866238-221866260 TGCCATGGCAATACATTTCCAGG - Intergenic
922352702 1:224747354-224747376 TGTCCTGGCAATATCCTGTCGGG + Intergenic
1063123899 10:3123820-3123842 TGCCATGGCCAGAGCCTGCCAGG + Intronic
1064346836 10:14540414-14540436 TGGCCTGAGAAAACCCTGCCGGG - Intronic
1065735302 10:28745926-28745948 TGGCCTTGCAATGTCCTGCCTGG + Intergenic
1068465851 10:57390011-57390033 TGCTATGGTAATATCCTGCCTGG + Intergenic
1077177896 11:1198856-1198878 TGCCCTGGCTCTCCCCAGCCCGG + Intronic
1077248201 11:1549200-1549222 TGCCCTGGCATCGCCCTGCTTGG + Intergenic
1077473655 11:2776450-2776472 AGCCCTGGGAAGACACTGCCTGG + Intronic
1077536843 11:3128656-3128678 TGGCCTGGGGTTACCCTGCCAGG + Intronic
1079140642 11:17807278-17807300 TGCCCCGGCAGTGCCATGCCAGG + Intronic
1079906485 11:26254179-26254201 TGACCTGGTAATACCTTTCCAGG - Intergenic
1081646714 11:44795344-44795366 TGCCCTGGAGCTTCCCTGCCTGG + Intronic
1083301247 11:61740604-61740626 TTCCCTGGTGGTACCCTGCCGGG - Intronic
1083766424 11:64843613-64843635 TTCCCTGGTCACACCCTGCCGGG - Intronic
1086991160 11:93304715-93304737 TGCTCTGGGAATTCCCTCCCAGG - Intergenic
1091077533 11:132634168-132634190 TGGCCTGGCTATGCCCAGCCTGG + Intronic
1092261670 12:6956256-6956278 GGCCCTGGGAATTCCCTGTCTGG + Intronic
1094182132 12:27603392-27603414 TTCCTTGGCAATACCCTTCTGGG + Intronic
1096483368 12:51958497-51958519 TGCGCTGCCACTACCATGCCCGG - Intronic
1097133854 12:56835271-56835293 TGCCCTCAGAATACCCTCCCAGG - Intergenic
1097419573 12:59357961-59357983 TGCCCAGGCAAGACCCTGTGAGG - Intergenic
1099585179 12:84505779-84505801 TGCCCTGGGAATACTCCCCCAGG - Intergenic
1102457798 12:113081769-113081791 TGCACCTGCAATGCCCTGCCTGG - Intronic
1104365713 12:128174705-128174727 TGCCATGGCAACACCATGCCTGG + Intergenic
1110838204 13:80109580-80109602 TGCCCTGCTTGTACCCTGCCAGG - Intergenic
1111714056 13:91855613-91855635 TGCCCTGGCAGTAACCTGTTTGG - Intronic
1118464712 14:66020507-66020529 TGCCCTTCCAATTCCCTACCTGG - Intergenic
1122672389 14:103382726-103382748 TGCTCTGTCCAAACCCTGCCTGG + Intergenic
1124003323 15:25777398-25777420 CTCCCTGGCAATAGCCTCCCCGG + Intronic
1124244317 15:28056756-28056778 TGCCCCTGCAAGTCCCTGCCAGG + Intronic
1125062495 15:35440670-35440692 TGCCCAGGCAAGACCCTGTGCGG - Intronic
1128450862 15:67805218-67805240 TGCCCTGGGGACACCCTGCGTGG - Intronic
1128500971 15:68227582-68227604 CCCCCTGGGAATACCCTGGCTGG + Intronic
1128699612 15:69794745-69794767 TGCCCTGGCCACACACTTCCTGG + Intergenic
1131679414 15:94705911-94705933 GGCCCTGGCATTAGCCTTCCTGG - Intergenic
1134485677 16:14656506-14656528 GGCCCTGGCACTAGCCTGCCTGG + Intronic
1137829345 16:51528640-51528662 TGCCCTGGCCTTATCCTGGCAGG + Intergenic
1140218344 16:73025689-73025711 GGCCCTGACAATACTCTGGCTGG - Intronic
1141760750 16:86026932-86026954 TGCCCTGGGACCACCCTGCTGGG + Intergenic
1145016458 17:19401792-19401814 TGCCCTGCCAACTCACTGCCAGG + Intergenic
1146328813 17:31910463-31910485 TGCCCTGGCTATTCCCTGCCTGG + Intergenic
1146654936 17:34629537-34629559 TGCCCAAGTAATGCCCTGCCTGG - Intronic
1146927386 17:36754366-36754388 TGCCCTGCTCAAACCCTGCCTGG - Intergenic
1147542179 17:41369653-41369675 TGCCACGGCTACACCCTGCCCGG - Exonic
1147543715 17:41382149-41382171 TGCCACGGCTACACCCTGCCTGG - Exonic
1147999575 17:44379973-44379995 AGCCCTGCCAATCCCCTGCCTGG + Intronic
1149013919 17:51886477-51886499 TGCACTGGCAATAAGCTCCCAGG + Intronic
1149637020 17:58179156-58179178 GGCCCTGCCAACACCCAGCCAGG + Intergenic
1151655266 17:75492875-75492897 TGCCCTGGCAATACCCTGCCAGG - Intronic
1152415850 17:80161311-80161333 TGCCATGGCAATACCCTACATGG - Intergenic
1153349231 18:4059935-4059957 TGCCCTCAGAATACCCTCCCAGG + Intronic
1153514925 18:5894486-5894508 TGCCCTCGCAATTTACTGCCTGG + Intronic
1155438250 18:25834878-25834900 TCCCCTGACAATTGCCTGCCAGG + Intergenic
1160872492 19:1283571-1283593 TGCCCCGGCAAACCCCTGCCTGG - Intergenic
1161093756 19:2376934-2376956 TGCCCCGGCGCGACCCTGCCTGG - Intergenic
1163384550 19:16991483-16991505 TGCCCTGCCCATCCCCTACCAGG - Intronic
1165305611 19:35000796-35000818 AGGCCTGGCAACCCCCTGCCTGG + Intronic
1165797074 19:38525693-38525715 TGCCCTGGCAATATCTTGAACGG - Intronic
1166377398 19:42335251-42335273 TGCCCTGGCCATAGGCTGCCGGG - Intronic
1166663483 19:44662656-44662678 AGCCCTTGGAATATCCTGCCTGG - Exonic
1167136795 19:47621170-47621192 AGCCCAGGAAATACCCTGTCTGG - Intronic
1167353922 19:48992128-48992150 GGCCCTGGCGATACCCGGCTGGG + Intronic
925154488 2:1639175-1639197 TGCCCTGGGACGTCCCTGCCAGG + Intronic
928164381 2:28959103-28959125 TGGCCTGGCTGTACCCTCCCTGG + Intronic
934663384 2:96154733-96154755 TGCCCTGGCAAGCCTCTCCCAGG + Intergenic
937216502 2:120316683-120316705 TGCCCTTGCTGTACCATGCCAGG - Intergenic
937512541 2:122612112-122612134 TAGCCTGGCAATACTCTGCATGG + Intergenic
937870357 2:126781923-126781945 TGCCCTGGGAACACTCTTCCTGG + Intergenic
937961940 2:127466674-127466696 TGTCCAGGCAACACCCAGCCAGG - Intronic
943793471 2:191962803-191962825 TGACTCGGCAATGCCCTGCCTGG + Intronic
945813254 2:214573551-214573573 GGCCCTGGCAAGACCCTGTTTGG + Intronic
946862689 2:224015014-224015036 TGCCATGGCACCACCCTCCCTGG - Intronic
948677751 2:239608987-239609009 AGCCCTGACAATACCCAGACAGG - Intergenic
1170479709 20:16753839-16753861 TGCCCTGGTAATGCCTTGCAAGG - Intronic
1173447395 20:43131339-43131361 TGCCCTGGAATTACCCAGCAGGG - Intronic
1173961451 20:47075495-47075517 TGCACTGGCCATACACAGCCAGG + Intronic
1174256045 20:49255963-49255985 TGCTCAGACAGTACCCTGCCTGG - Intronic
1178851828 21:36218771-36218793 TGCCCTGCCCATCCCCTGCCTGG + Intronic
1179475591 21:41641473-41641495 AGCCCAGGCACTTCCCTGCCAGG - Intergenic
1180814467 22:18781006-18781028 TGGCATGCCAATACCCTGTCTGG - Intergenic
1181019297 22:20090413-20090435 TGTCCTTGCAAGAACCTGCCTGG + Intronic
1181200655 22:21215342-21215364 TGGCATGCCAATACCCTGTCTGG - Intronic
1182007088 22:26969983-26970005 TTCCCTGGCCATTCCCTGGCTGG - Intergenic
1182089839 22:27586691-27586713 TGCCCTAGCAATCCCCCTCCTGG + Intergenic
1182524001 22:30904155-30904177 TGCCCTGCCATCACCCTGCAAGG - Intronic
1182735699 22:32531066-32531088 GGCCCTGGCAAAACCCAGGCGGG - Intronic
1184717217 22:46289037-46289059 TGCCCTGCCCATTCCCTTCCGGG + Intronic
1203226262 22_KI270731v1_random:80093-80115 TGGCATGCCAATACCCTGTCTGG + Intergenic
1203264566 22_KI270734v1_random:6693-6715 TGGCATGCCAATACCCTGTCTGG - Intergenic
950101131 3:10357670-10357692 TGCCCTGGCCAGGCCCTGGCTGG - Intronic
953307024 3:41840898-41840920 TGCCCTGCCACCACCCTGTCTGG + Intronic
961765263 3:129205573-129205595 TGCCCTGCACATACTCTGCCTGG + Intergenic
968586501 4:1419163-1419185 TGACCTGGCCGAACCCTGCCAGG + Intergenic
968647362 4:1747440-1747462 GGCCCTGGCACTGGCCTGCCTGG + Intergenic
970877323 4:20886268-20886290 TGCCCTGGCTCGCCCCTGCCTGG + Intronic
975582828 4:75922066-75922088 TGCCCTGGCAATATCCAGGATGG - Intronic
985824907 5:2184974-2184996 TGCCCTGGCAGTTCCCTGGTGGG + Intergenic
992044976 5:72878645-72878667 TGCCCTCGAAATACACTGACTGG + Intronic
995709927 5:115025065-115025087 TTCCCAGCCAACACCCTGCCTGG + Intergenic
998387110 5:141763714-141763736 TGCCATGGCAACAGCCTCCCGGG - Intergenic
998788378 5:145737802-145737824 TTCTCTGGCAACACCCTGGCAGG - Intronic
1001095565 5:168773022-168773044 GGCCCTGGCAATCCACTGCAAGG + Intronic
1003119778 6:3309868-3309890 GGCCATGCTAATACCCTGCCTGG + Intronic
1007070015 6:39029586-39029608 TCCCCTGGCTCTACCATGCCTGG + Intronic
1008630550 6:53359576-53359598 TGCCCGGGAATTACCCGGCCCGG - Intergenic
1018865083 6:167740054-167740076 TGACCTGGCAATTCCCTTCTGGG - Intergenic
1019637602 7:2084421-2084443 TTCTCTGGCATCACCCTGCCCGG - Intronic
1019779866 7:2932987-2933009 TGCCCTGGCCACCCCCGGCCCGG + Intronic
1021525639 7:21584055-21584077 TGACCTGGCAATACCATTACTGG + Intronic
1026847385 7:73705647-73705669 TCCCCTGTCAACCCCCTGCCTGG - Intronic
1032012235 7:128354176-128354198 TGCCCTGGCCATGCCCTAGCTGG + Intronic
1032037457 7:128531149-128531171 TGCCCTGGTTAACCCCTGCCCGG + Intergenic
1035783043 8:2243963-2243985 TGCCCTGGGAAAAACCAGCCTGG - Intergenic
1037892178 8:22629217-22629239 GGCCCTGGCAAGGCACTGCCTGG + Intronic
1037998842 8:23373353-23373375 TGACACGGCAAGACCCTGCCAGG - Intronic
1038379284 8:27077234-27077256 TACCCCCGCAATGCCCTGCCAGG - Intergenic
1040516106 8:48136451-48136473 TCCCCTGGCTTTTCCCTGCCAGG + Intergenic
1044162711 8:88940067-88940089 TGCCCAGGCAATGCCATCCCTGG - Intergenic
1044712497 8:95071636-95071658 TGTCCTGGAAATACCCAGCCTGG + Intronic
1045254231 8:100506243-100506265 TGCCCTGGCAATGGTCTGCAAGG + Intergenic
1046758235 8:117993368-117993390 TGGCCTGGCTGTATCCTGCCGGG - Intronic
1048987055 8:139740360-139740382 TGCCCTGCCAAGCCCCTCCCTGG - Intronic
1049214961 8:141403279-141403301 TGCCGTGGCACTGCCCTCCCTGG + Intronic
1050264916 9:3879842-3879864 TGCCCTGCCAGTTCCCTGTCTGG + Intronic
1050570354 9:6931955-6931977 TGCCCTGGCTGTGCCCTGCAGGG + Intronic
1055426344 9:76200758-76200780 TGCCCTGCTCATCCCCTGCCTGG - Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057024599 9:91725467-91725489 TGCCCCGGACATACCCTGCCAGG + Intronic
1058077111 9:100662357-100662379 TGCTCTGGCAATACTGTGCCTGG + Intergenic
1059432614 9:114259137-114259159 TCCCCTGCCAGTCCCCTGCCAGG - Intronic
1060738303 9:126080554-126080576 TGCACTGGACTTACCCTGCCTGG + Intergenic
1062573682 9:137196871-137196893 TGCTCTGGCAGGGCCCTGCCCGG + Intronic
1192196812 X:69034097-69034119 TGCCATGGCAATGGCCTGCCAGG - Intergenic
1196479968 X:116136348-116136370 TGCCCTAGAACTACTCTGCCTGG + Intergenic
1197926538 X:131652680-131652702 GGCTCAGGCAATCCCCTGCCTGG + Intergenic
1200033006 X:153311511-153311533 TGCCCTGACAAGTCCCTGCCTGG + Intergenic
1200073659 X:153540942-153540964 TGACCTGGACATACCCTGCTGGG + Intronic