ID: 1151656040

View in Genome Browser
Species Human (GRCh38)
Location 17:75496456-75496478
Sequence CACCCACCTGTTCGATAAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151656040_1151656051 28 Left 1151656040 17:75496456-75496478 CCGGCTTATCGAACAGGTGGGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1151656051 17:75496507-75496529 GGACAGGACCCGCCTGGGGTGGG 0: 1
1: 0
2: 3
3: 15
4: 207
1151656040_1151656050 27 Left 1151656040 17:75496456-75496478 CCGGCTTATCGAACAGGTGGGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1151656050 17:75496506-75496528 AGGACAGGACCCGCCTGGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 263
1151656040_1151656043 -7 Left 1151656040 17:75496456-75496478 CCGGCTTATCGAACAGGTGGGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1151656043 17:75496472-75496494 GTGGGTGCTTCGGCAGGCAAAGG 0: 1
1: 0
2: 0
3: 3
4: 134
1151656040_1151656045 7 Left 1151656040 17:75496456-75496478 CCGGCTTATCGAACAGGTGGGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1151656045 17:75496486-75496508 AGGCAAAGGAGGAGAGACGCAGG 0: 1
1: 0
2: 4
3: 54
4: 475
1151656040_1151656049 24 Left 1151656040 17:75496456-75496478 CCGGCTTATCGAACAGGTGGGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1151656049 17:75496503-75496525 CGCAGGACAGGACCCGCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 151
1151656040_1151656046 12 Left 1151656040 17:75496456-75496478 CCGGCTTATCGAACAGGTGGGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1151656046 17:75496491-75496513 AAGGAGGAGAGACGCAGGACAGG 0: 1
1: 1
2: 1
3: 42
4: 463
1151656040_1151656044 -4 Left 1151656040 17:75496456-75496478 CCGGCTTATCGAACAGGTGGGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1151656044 17:75496475-75496497 GGTGCTTCGGCAGGCAAAGGAGG 0: 1
1: 0
2: 0
3: 70
4: 1136
1151656040_1151656048 23 Left 1151656040 17:75496456-75496478 CCGGCTTATCGAACAGGTGGGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1151656048 17:75496502-75496524 ACGCAGGACAGGACCCGCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 85
1151656040_1151656047 22 Left 1151656040 17:75496456-75496478 CCGGCTTATCGAACAGGTGGGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1151656047 17:75496501-75496523 GACGCAGGACAGGACCCGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151656040 Original CRISPR CACCCACCTGTTCGATAAGC CGG (reversed) Exonic
901460989 1:9391750-9391772 CACCAGCCAGATCGATAAGCGGG + Intergenic
905303852 1:37004289-37004311 CACCCTCCTGTGAGATAGGCTGG - Intronic
909027119 1:70494885-70494907 CACCCACTTCTTTGATAAGTAGG + Intergenic
916217428 1:162409423-162409445 CACCCTCCTTTTCCAAAAGCTGG + Intronic
916416693 1:164598922-164598944 CACACACCTGTTGAATAACCTGG - Intronic
920304510 1:205009975-205009997 CACCCATCTGTTCTATAAATTGG + Intronic
1065742905 10:28813168-28813190 CACCCACCTGCTCCATGAGTGGG + Intergenic
1067071328 10:43134694-43134716 TACCCAGCTGTTTGATCAGCAGG + Intergenic
1075977069 10:126705291-126705313 CACTGACCTGTTGGAGAAGCTGG - Intergenic
1079296553 11:19240541-19240563 CACCCACCTGTTCGCAGATCAGG + Intronic
1080264004 11:30382097-30382119 CAGCCGCCTGATTGATAAGCTGG + Intergenic
1097586633 12:61523228-61523250 CATCCCCCTGTTCGGTCAGCAGG + Intergenic
1101185720 12:102276463-102276485 AACCCACATATTCGAAAAGCTGG - Intergenic
1103225807 12:119286672-119286694 CACTCACCTGGTGAATAAGCGGG - Intergenic
1107636005 13:42393226-42393248 CACCAACCTGTGTGAAAAGCAGG + Intergenic
1108010739 13:46006115-46006137 CACCAACCAGATCGATAAACTGG + Intronic
1113558705 13:111258983-111259005 CACTCCCCTTTTCCATAAGCAGG - Intronic
1127938585 15:63669531-63669553 CACGCACCTGTGCGGTTAGCTGG + Exonic
1131662181 15:94529282-94529304 CCCCCACCTCTGCTATAAGCAGG + Intergenic
1136383921 16:29911124-29911146 CATCGAGCTGTTCGACAAGCTGG - Exonic
1138475572 16:57269000-57269022 CACCCACCTGACAGATAAGGCGG + Intronic
1148438209 17:47698248-47698270 CACCCACCTGATCCATAAAATGG - Intronic
1151656040 17:75496456-75496478 CACCCACCTGTTCGATAAGCCGG - Exonic
1152260946 17:79266823-79266845 CACCCACGTGTTCGCCAAGCAGG - Intronic
1155587227 18:27380701-27380723 CATCCACCTGTGGGACAAGCAGG + Intergenic
937121413 2:119442123-119442145 CACCCACCTGTCCATTAAGCAGG - Intronic
941960303 2:171246627-171246649 CACCACCCAGTTCGATAAACTGG - Intergenic
1170549463 20:17464255-17464277 CAACAACCTGTGCGATAACCTGG + Intronic
1174542879 20:51303762-51303784 CAGCCAGCTGTTCCAAAAGCTGG + Intergenic
1182566202 22:31201858-31201880 CACACACCTGTTCCATAGGGTGG - Intronic
1184478492 22:44734438-44734460 CACCCAGCTGTGCGCTGAGCTGG - Intronic
961832768 3:129632649-129632671 CACCCAGCTGGATGATAAGCAGG - Intergenic
969661994 4:8535822-8535844 CAGCCTCCTGTTCAAAAAGCAGG - Intergenic
970848957 4:20578886-20578908 GACCCACTTTTTTGATAAGCAGG + Intronic
970848960 4:20578909-20578931 CTTCCACCTTTTTGATAAGCAGG + Intronic
973724801 4:53764424-53764446 CTCCCAGCTGTTGGATGAGCAGG + Intronic
981792049 4:148549197-148549219 CATCTACCTGTTGGATAATCTGG - Intergenic
982629872 4:157819153-157819175 CACCCACCACTTCTCTAAGCAGG - Intergenic
986467919 5:8045491-8045513 ATCCCACCTGTTGGATAAGCTGG + Intergenic
999479962 5:151938988-151939010 CACCCAATTGTTCAAGAAGCAGG - Intergenic
1012655691 6:101816882-101816904 CACACAGCTGTTGGAAAAGCAGG + Intronic
1034697267 7:153064765-153064787 CACCCACCTGTTCTAAGTGCTGG + Intergenic
1039721021 8:40164377-40164399 CACTCACCTGTCCGATTGGCAGG + Intergenic
1039787937 8:40849997-40850019 CACCCATCTGATCTATGAGCAGG + Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1051377495 9:16418360-16418382 CATCCAGCTGTTAGATATGCAGG - Exonic
1061879855 9:133563120-133563142 AACCCACCTTTGAGATAAGCAGG - Intronic
1194401301 X:93440340-93440362 CACCCACATGTGCCACAAGCAGG + Intergenic
1200076512 X:153553924-153553946 CACCCACCTGTGTCACAAGCAGG + Intronic