ID: 1151656482

View in Genome Browser
Species Human (GRCh38)
Location 17:75498619-75498641
Sequence ATGGAAATGAAGACTGGGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 632}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151656482_1151656489 8 Left 1151656482 17:75498619-75498641 CCTTCCCCAGTCTTCATTTCCAT 0: 1
1: 0
2: 4
3: 39
4: 632
Right 1151656489 17:75498650-75498672 TGCATCGCACCAAGCCCCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151656482 Original CRISPR ATGGAAATGAAGACTGGGGA AGG (reversed) Exonic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901545978 1:9957317-9957339 ATGGTAAACAAGACTGGGCACGG - Intronic
902005918 1:13231982-13232004 ATGGAAATTAAGGCTGTTGAGGG - Intergenic
902025229 1:13378264-13378286 ATGGAAATTAAGGCTGTTGAGGG - Intergenic
902097541 1:13959015-13959037 ATGGAAAGCAAGACTGTGGGTGG - Intergenic
902110710 1:14075989-14076011 AGGGAAATGTAGACTGGGCGCGG + Intergenic
902507877 1:16949506-16949528 ATGGAAATGACTACAGGGAATGG - Intronic
902625185 1:17672207-17672229 ATGAAAATTAAGGGTGGGGAAGG - Intronic
902647092 1:17807201-17807223 AGGGGAATGAAGACTGCGGATGG - Intronic
902930626 1:19728769-19728791 ATGGAAAGGCAGAGTGGGGCAGG - Intronic
903259735 1:22124941-22124963 CTGGAAAGGCAGACTGGGCAGGG - Intronic
903805706 1:26004233-26004255 AGGGAAAGGAAGGGTGGGGAAGG - Intergenic
904337746 1:29809219-29809241 ATGGGAATGATGACTTCGGAGGG - Intergenic
904595341 1:31641058-31641080 AGGTAATTGAAGTCTGGGGATGG - Intronic
905363333 1:37435065-37435087 ATGGATATGAAGGCTGGTGGAGG - Intergenic
905411134 1:37769004-37769026 AAGGAAAAGAAGTCTGGGCACGG + Intergenic
905454996 1:38082528-38082550 AGGGAAATGCAGTGTGGGGACGG + Intergenic
906119127 1:43376022-43376044 AAGGAAATGAAAGCAGGGGATGG - Intergenic
906373483 1:45274447-45274469 AGTGCAATGAAGACTGGAGAGGG + Intronic
906485534 1:46231783-46231805 GTAGAAATGAAGACTAGGGCTGG - Intergenic
907257509 1:53190972-53190994 CTGGAAAGGAAGTCTGGGGCTGG + Intergenic
907277154 1:53323121-53323143 AGGGAAATGAAGGCCTGGGAAGG + Intronic
907414653 1:54305949-54305971 TTACAAATGAGGACTGGGGAAGG - Intronic
907868406 1:58420935-58420957 ATGGAAATGAGGCCTGGTGCAGG - Intronic
908094385 1:60721666-60721688 ATGGAAAGGAAATCTGGGGTTGG + Intergenic
908311409 1:62888269-62888291 ATGGAAATGTAAACTGGGTGTGG - Intergenic
908559216 1:65288171-65288193 ATGGCAATGTAGACAGGTGAAGG - Intronic
908562043 1:65316234-65316256 ATGGAGGTGCAGGCTGGGGAGGG - Intronic
908568202 1:65380866-65380888 ATGGAATTGAAGCTGGGGGAGGG + Intronic
908776105 1:67641586-67641608 ATAGAAATGAGGAGTGGGGGAGG + Intergenic
908894496 1:68883098-68883120 CTGGATATAAAGACTGGAGAAGG + Intergenic
909742852 1:79054210-79054232 AGGAAGAGGAAGACTGGGGAGGG + Intergenic
911020332 1:93380153-93380175 ATGGCTACAAAGACTGGGGAGGG + Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912169529 1:107081682-107081704 CTGGAAATGGAGATTTGGGAAGG - Intergenic
912631001 1:111246768-111246790 ATGGGTAGTAAGACTGGGGAAGG + Intergenic
912916597 1:113821705-113821727 CGGGAACTGAAAACTGGGGAGGG - Intronic
913143011 1:115960677-115960699 ATGCAAATGAAGACTGATAAAGG + Intergenic
913241333 1:116832602-116832624 ATGTAAAGGAAGAAAGGGGAGGG - Intergenic
913373328 1:118124954-118124976 TTGGCCATGGAGACTGGGGAGGG - Intronic
913609969 1:120501412-120501434 ATGGAAATGGAGGCTGAGGGAGG + Intergenic
914581219 1:149020829-149020851 ATGGAAATGGAGGCTGAGGGAGG - Intronic
914992578 1:152511642-152511664 ATGGGGCTGAACACTGGGGAGGG - Exonic
915444297 1:155966200-155966222 ATGGGGATGAGGGCTGGGGATGG - Intronic
915497968 1:156294672-156294694 GTGGAACTAAAGACTGGGGGTGG - Intronic
915565194 1:156709010-156709032 AGGGAAAGGTTGACTGGGGATGG + Intergenic
915955197 1:160215025-160215047 AGGGAAAGGGAGACTTGGGAAGG - Exonic
916476243 1:165171876-165171898 AGGAAACTGAAGCCTGGGGAGGG - Intergenic
919059901 1:192619239-192619261 ATGGAAATAAAGATTGAGAATGG - Intergenic
919087103 1:192933455-192933477 AAGTAAATGAAGAGTGGTGAGGG - Intergenic
919634857 1:199993649-199993671 ATAAAAATGAAGGCTGGGCACGG - Intergenic
920221856 1:204410216-204410238 ATGGAAAAGGAGCCTGGAGAGGG - Exonic
920253830 1:204640624-204640646 ATGGAAAGCAAGCATGGGGAAGG - Intronic
920362865 1:205431213-205431235 ATTGAACTGAAAACTGGGTACGG - Intronic
920863728 1:209733804-209733826 ATGGACATGAAAACTTGGAAGGG + Intronic
921094941 1:211878375-211878397 ATGGAAGTAGAGACTGGGCATGG + Intergenic
921221714 1:212978371-212978393 ATGGGGAGAAAGACTGGGGAAGG + Intronic
922582645 1:226710143-226710165 TTGGAAAAGAAGTCTGGGGTGGG + Intronic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
923238983 1:232062221-232062243 CTGGAAGTGGAGAGTGGGGAGGG + Intergenic
923334885 1:232959518-232959540 ATGGGAATGAAGAAAGGAGAAGG + Intronic
923350117 1:233096459-233096481 ATGGAGATGATGACTGTGTAGGG + Intronic
923739279 1:236640851-236640873 ATGGCAATGAAGGCTGAAGATGG + Intergenic
923963594 1:239110251-239110273 AAGGAGATGAACAATGGGGAGGG + Intergenic
924021199 1:239785543-239785565 ATGGAGAGGAAGACTGACGAGGG - Intronic
924327276 1:242908626-242908648 CTGGAAATGAATAGTGGTGATGG + Intergenic
924446935 1:244141714-244141736 ATGAAAATGAAGGCTGGGCGTGG + Intergenic
1063434661 10:6020211-6020233 ATGGAAACCAGGACTGGGGAGGG - Intronic
1063652626 10:7953576-7953598 ATGGAAATGTTGGCTGGGCAGGG - Intronic
1064053387 10:12077679-12077701 ATGTCAATGAAGAATGAGGAGGG + Intronic
1064286238 10:13993957-13993979 ATGAAAATCAAGCCTGGGGCAGG + Intronic
1064669715 10:17699324-17699346 ATGGAAAGGAAGACAGGAGGGGG - Intronic
1064777138 10:18791332-18791354 ATGGTAATTAAGTCTGGGGTTGG + Intergenic
1064952395 10:20867965-20867987 ATGAAAATGAAGACCAGTGAAGG - Intronic
1065339664 10:24693046-24693068 ATGGTGATGAAGTCTGGAGAGGG + Intronic
1065963405 10:30752416-30752438 ATGAAATTGTAGACTGAGGAAGG + Intergenic
1067166055 10:43867436-43867458 ATGCAAATGAACACTGTGGGAGG - Intergenic
1067267050 10:44755632-44755654 GAGGAAATGAAGACTTAGGAAGG + Intergenic
1067946730 10:50694290-50694312 AGGGTAATGAAGGCTGGGCATGG + Intergenic
1068360664 10:55972707-55972729 ATGGGAACAGAGACTGGGGAGGG - Intergenic
1068966658 10:62918565-62918587 ATTGAAGTGAAGCCCGGGGAGGG - Intronic
1069234438 10:66052388-66052410 CTTGAAATGAAGGATGGGGAAGG + Intronic
1069898198 10:71691895-71691917 ATGGGTACGAAGACTGAGGAAGG + Intronic
1070094181 10:73320617-73320639 ATGGGAAAGAAGGCTGGGCATGG - Intronic
1070252403 10:74784491-74784513 ATGGGGATGAAGACTGTGAAAGG - Intergenic
1070571308 10:77640890-77640912 ATGAAAAAGAAGGCTGGGCATGG + Intergenic
1070882037 10:79859283-79859305 AGGGTAATGAAGGCTGGGCATGG + Intergenic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1071146449 10:82579412-82579434 AAGGAATTGAAGGCTGTGGAGGG - Intronic
1071343791 10:84672270-84672292 ATTGAATTGAAGAATGGGAAAGG - Intergenic
1071799370 10:89042288-89042310 ATGGCAGGGAAGAGTGGGGAGGG - Intergenic
1072900551 10:99403207-99403229 ATGGAGAGGAAGACTGGGTGGGG + Intronic
1073128200 10:101165838-101165860 AAGGAAATTATGACTGGGCATGG - Intergenic
1073547610 10:104364942-104364964 ATGGGAATAGAGACTGTGGAGGG - Intronic
1074521150 10:114225317-114225339 TTGGAAATGAAGATTGGCCAAGG - Intronic
1075382472 10:122030602-122030624 AGGAGAATGAAGACTGAGGAGGG - Intronic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1076516851 10:131050552-131050574 GTGGAAAGGATGACTGGGGTTGG - Intergenic
1076522266 10:131088779-131088801 ATGGAAATGATGGCGGGGAAGGG + Intergenic
1078396131 11:10983811-10983833 AAGGAAATCAAGACTTGGAAAGG - Intergenic
1079237307 11:18699672-18699694 ATGGAAATTAAGGCTGGTCAGGG - Intronic
1080269635 11:30437456-30437478 ATGGCAAAGAAGACTTGGAAGGG + Intronic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1080714785 11:34789872-34789894 GAGGGACTGAAGACTGGGGATGG - Intergenic
1081601959 11:44501460-44501482 ATGGACATGAAGGCTGGGGTAGG - Intergenic
1081914826 11:46724021-46724043 AAGGAAGTCAAGAGTGGGGAGGG - Intronic
1082299860 11:50492492-50492514 AGGGAAATGGGGAGTGGGGAAGG - Intergenic
1083288924 11:61679443-61679465 AAGGAATTTAAGCCTGGGGATGG - Intergenic
1085284335 11:75350347-75350369 ATGGAAACGAGGAGAGGGGAGGG + Intronic
1085739796 11:79069080-79069102 ATGGATTTGAATACTGGGGCAGG + Intronic
1085933649 11:81117835-81117857 TTGGAAATGAAATATGGGGAAGG - Intergenic
1086607614 11:88715008-88715030 ATGAAAATGAAAGATGGGGAAGG + Intronic
1087043061 11:93820401-93820423 ATGGAGTTGAGGACTGTGGATGG - Exonic
1087247699 11:95859109-95859131 ATGCAAATGAACCCTGGGAAGGG - Intronic
1087287223 11:96278014-96278036 ACAGAATTGGAGACTGGGGATGG - Intronic
1087770427 11:102203365-102203387 AGGGAAATGTAGACATGGGATGG + Intronic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088480590 11:110293266-110293288 ATGGAAAACAGGACTGGGAAAGG + Intronic
1088942456 11:114473946-114473968 ATGGAAGAGAAGGCTGGGGTGGG + Intergenic
1089341589 11:117761578-117761600 ATGGGAATGATGGCTGGGCACGG + Intronic
1089773732 11:120821437-120821459 ATGGAAAGAGAGGCTGGGGAAGG + Intronic
1090233592 11:125128778-125128800 GTGGAAAGTAAAACTGGGGAAGG + Intergenic
1090303451 11:125668845-125668867 AATAAAATGAAGGCTGGGGACGG - Intronic
1090499795 11:127250360-127250382 TTAGAAATGGAGAGTGGGGAAGG + Intergenic
1090654317 11:128831436-128831458 GTGGAAGTGAAGACAGGGGAGGG - Intergenic
1090988804 11:131797398-131797420 ATGGAAATGAAGACACTGGGTGG + Intronic
1092144148 12:6203037-6203059 ATGAAAAGGAAGACTGTGGTCGG + Intronic
1092487703 12:8916204-8916226 ATGAAACTAAAGACTGGGGGGGG + Intronic
1092618854 12:10240348-10240370 ATAGAAATGAGGGCTGGGCATGG - Intergenic
1092794117 12:12093494-12093516 AAGAAAATGAAGGCTGGGTACGG + Intronic
1093430729 12:19082091-19082113 ATGGAAATGGAGAATGGTAAAGG + Intergenic
1093575850 12:20729144-20729166 ATGAAAGAGAAGCCTGGGGAGGG + Intronic
1093657749 12:21716575-21716597 ATGGAAAAGATGTCTGGAGAAGG + Intronic
1094321716 12:29191007-29191029 AGGGAAATGAGGACAGGGGCAGG - Intronic
1094341686 12:29419146-29419168 TTAGAAATGTAGACTGGGCATGG - Intronic
1094797845 12:33997193-33997215 ATGGAAATGAAGGCCTGGGGTGG + Intergenic
1095296347 12:40531555-40531577 GTGGAAAGGAAAACTGGGTAAGG - Intronic
1096548526 12:52357202-52357224 ATGGGACTGTGGACTGGGGAAGG + Intergenic
1096810206 12:54164527-54164549 CTGAAAATGAAAGCTGGGGAGGG - Intergenic
1096968215 12:55645652-55645674 AAGGAAGAGAAGAATGGGGAAGG - Intergenic
1097027184 12:56065707-56065729 ATAAAAATGAAGCCTGGGCATGG + Intergenic
1097147808 12:56953709-56953731 CTGGTAAGGAAGACTGGGAAAGG - Intronic
1097227912 12:57489570-57489592 CTTGAGATGAGGACTGGGGAAGG + Intronic
1097846794 12:64374832-64374854 TTGAAAATAAAGACTGGGGATGG - Intronic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1097904433 12:64905470-64905492 ATGGAAAGTAGGAGTGGGGAAGG + Intergenic
1098558993 12:71851401-71851423 AAGGAAATGGAGATTTGGGAGGG - Intronic
1099248780 12:80226520-80226542 ATGGGAAGGAAAACTGAGGAAGG - Intronic
1099904428 12:88755479-88755501 AAGTAAAGGAAGACTGGGAAGGG + Intergenic
1099974221 12:89529509-89529531 ATGGAAAAGAACAATGGGAAGGG - Intergenic
1100476229 12:94938189-94938211 CTGGAAATGAACAGTGGTGATGG + Intronic
1100631003 12:96389489-96389511 ATGGAAATGATATCTGGAGAAGG + Intronic
1101897589 12:108768150-108768172 ATTGAAATGAAAACTGAGGCCGG - Intergenic
1102286768 12:111664027-111664049 ATCAAAAGGAATACTGGGGATGG + Intronic
1102535558 12:113577923-113577945 ATGGAGATGGAGATTGGGGGAGG - Intergenic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1103284533 12:119789289-119789311 ATGGAACTAAATGCTGGGGATGG - Intronic
1103656815 12:122477486-122477508 TTGAAAATGAAGACAGGGGCCGG + Intronic
1104404347 12:128505195-128505217 ATGGAAATGCAGTCAGGGAAAGG + Intronic
1106653202 13:31714614-31714636 TAGGAACTGAAGACTGTGGAAGG + Intergenic
1107082206 13:36387231-36387253 CTGGAAATGCATAGTGGGGATGG + Intergenic
1107412309 13:40169217-40169239 AAGGAAGTGAAGGGTGGGGAGGG - Intergenic
1107909452 13:45091830-45091852 ATAGAAATAAAGGCTGGGCATGG + Intergenic
1108028026 13:46199174-46199196 ATGAAAATCAGGCCTGGGGATGG + Intronic
1108104753 13:46997270-46997292 ATGGAAATAGGGAGTGGGGATGG - Intergenic
1108344100 13:49527362-49527384 GTGGAAATGCAGAGTGTGGAGGG - Intronic
1108443209 13:50477527-50477549 ATGGAAATGAGGAAAGGGGAAGG + Intronic
1108681097 13:52781064-52781086 ATGCAGATGCAGGCTGGGGAAGG + Intergenic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1109209884 13:59523032-59523054 CTGGAAATGAAGACTCAGGCAGG - Intergenic
1110271371 13:73594935-73594957 ATGGAAATGAAGACTCAGTGAGG + Intergenic
1110413001 13:75223636-75223658 AAGGAAAGGAAGATTGGGAAGGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111549253 13:89785008-89785030 ATGGGAATAAAGACAAGGGAGGG - Intergenic
1111736933 13:92153426-92153448 AAGGAAATGAAGGCTGGGTATGG - Intronic
1113398407 13:109969820-109969842 ATGGAAATGATCACATGGGAAGG + Intergenic
1114052617 14:18933890-18933912 TTGGAAAAGAAGGCTGGGCAAGG - Intergenic
1114109941 14:19468035-19468057 TTGGAAAAGAAGGCTGGGCAAGG + Intergenic
1114942092 14:27624925-27624947 ATGGAATTGAATCATGGGGATGG - Intergenic
1116024463 14:39498116-39498138 AGGTAAATGAATAATGGGGATGG - Intergenic
1116299248 14:43156115-43156137 GTGAGAATGAAGACTAGGGAAGG - Intergenic
1116413641 14:44654190-44654212 ATGGAAATAAACATTGTGGAAGG + Intergenic
1117477016 14:56105905-56105927 ATGGAAGTAAAGAATGGTGAAGG - Intergenic
1118078560 14:62330016-62330038 ATGGTAATGGAGGCGGGGGAAGG - Intergenic
1118982791 14:70730092-70730114 AAGGCAAGGAAGACTGTGGAGGG + Exonic
1119514672 14:75238855-75238877 ATGGGAATGAGGACTTGGCATGG + Exonic
1120220331 14:81724596-81724618 ATGAAAATGAAGACAGTGAAAGG - Intergenic
1120716348 14:87845093-87845115 ATGGAACTTAAGACTGAGGCAGG - Intronic
1121027976 14:90630570-90630592 CTGGAAATGGAGGCTGGTGATGG - Intronic
1121037041 14:90714882-90714904 ATAGAGATGAAAATTGGGGAGGG - Intronic
1121086551 14:91150882-91150904 CTGGAAATGGAGAGTGGTGATGG - Intronic
1121576579 14:94993841-94993863 ATGGAAGTGAAGTGTGTGGATGG - Intergenic
1121654952 14:95588380-95588402 ATGAGGATGAAGACGGGGGAAGG + Intergenic
1121839624 14:97122355-97122377 AGGGAAAGCAAGACTGGAGATGG - Intergenic
1121918329 14:97856534-97856556 AAGGAAATGAAGGCTGGGCATGG + Intergenic
1122020829 14:98836534-98836556 AGGGGAATGAAGACTGCGGGTGG - Intergenic
1122176412 14:99923231-99923253 AAGAAAATGAAGGCTGGGCATGG - Intronic
1122676676 14:103420642-103420664 CTGGAAATGAATAGTGGTGATGG - Intronic
1122704189 14:103609751-103609773 CTGGAAATGAGGAGAGGGGAGGG + Intronic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1123184405 14:106502595-106502617 ATGTCCATGGAGACTGGGGATGG - Intergenic
1124400143 15:29340897-29340919 ATGGAAATTAAAACTGGGGTTGG - Intronic
1124480033 15:30070521-30070543 AAAGAAATGAAGAGTGGGGGAGG - Intergenic
1124486216 15:30119515-30119537 CTGGAAATGAATAGTGGTGATGG - Intergenic
1124541290 15:30588500-30588522 CTGGAAATGAATAGTGGTGATGG - Intergenic
1124547942 15:30650002-30650024 CTGGAAATGAATAGTGGTGATGG - Intronic
1124635389 15:31361578-31361600 GAGGAAATGAAGGCTGGGGGAGG + Intronic
1124757368 15:32419087-32419109 CTGGAAATGAATAGTGGTGATGG + Intergenic
1124789273 15:32712065-32712087 AAGGAAACAAAGACTGGGAAGGG + Intergenic
1124875273 15:33586158-33586180 ATGGTCATGAACATTGGGGAGGG - Intronic
1125529622 15:40404299-40404321 AGGGAAAGGAAGAGTGGTGAGGG - Intergenic
1126700852 15:51366366-51366388 CTTGAACTGAAGACTGGGCAAGG + Intronic
1127539079 15:59919587-59919609 ATGAAAATGAAGCCTTGGGAGGG + Intergenic
1130554427 15:84912941-84912963 AAGTAAATGAAGCCTGGGGTGGG + Intronic
1130657937 15:85805416-85805438 GTGTAAATGAAGACTTGGCATGG + Intergenic
1131654016 15:94435153-94435175 ATGAAAATGCAGGCTGGGTACGG - Intronic
1131723040 15:95192062-95192084 ATGGAAATAAAGACTGAGCCAGG + Intergenic
1132009817 15:98266274-98266296 AAGGAAATGCAGACGTGGGAGGG - Intergenic
1132133709 15:99310694-99310716 ATGAAAATGAAGAAAGGAGAGGG + Intronic
1132358065 15:101187992-101188014 TTGCTAATGAAGACTGTGGAAGG - Intronic
1133070900 16:3246300-3246322 ATGGAGCTGCAGACTGGGAAGGG - Intronic
1134052947 16:11149846-11149868 AGGCAAATGATGACTGAGGAAGG - Intronic
1134186415 16:12088453-12088475 ATATAAATGAGGGCTGGGGAGGG - Intronic
1134239925 16:12498052-12498074 AGGGAAAGAGAGACTGGGGAAGG + Intronic
1134348931 16:13418355-13418377 AGGGTAATGAAGGCTGGAGATGG + Intergenic
1134653068 16:15926013-15926035 TTGCAAATGAAGAGTGGGCAGGG - Intergenic
1135337633 16:21616975-21616997 GTGGAAAGGATGACAGGGGAAGG - Intronic
1135476313 16:22779003-22779025 AAGGAAATGAAAACTGAGTAAGG + Intergenic
1135708795 16:24697743-24697765 TTAGAAATGCAGACTGGGGCCGG + Intergenic
1135775378 16:25253395-25253417 GGGGAAAGGAAGGCTGGGGAAGG - Intronic
1136544478 16:30947838-30947860 AAGGAACTGAAGCCTGGGGAGGG - Exonic
1137750825 16:50859943-50859965 TTGGAAATGAGGTCTGGGGAAGG - Intergenic
1138000647 16:53275599-53275621 ATGGAGAAGAAAACTGGGAAAGG - Intronic
1138406901 16:56802970-56802992 AAAGAAAGGAAGTCTGGGGAGGG - Intronic
1139518678 16:67467013-67467035 AGGGAATTGGAGACTTGGGAGGG - Intronic
1139532968 16:67552483-67552505 ATGGAACAGAAGCCTGAGGAGGG + Intergenic
1139757550 16:69156756-69156778 ATGGAAATAAAGGCTGGGTGTGG - Intronic
1139909027 16:70385441-70385463 CTGGAAATGGAGAGTGGTGATGG + Intronic
1140615558 16:76658332-76658354 ATGGAATTCTAGAGTGGGGAGGG + Intergenic
1140859547 16:79006961-79006983 AGGGAAATGAAGATTGTGGGTGG - Intronic
1140934455 16:79657688-79657710 ATGGTAAAGAAGGCTGGGCATGG + Intergenic
1141199418 16:81885520-81885542 AAAGAAATGAAGAAAGGGGAAGG - Intronic
1141290759 16:82716287-82716309 ATGGAAAAGCAGGCTCGGGATGG - Intronic
1141460362 16:84175356-84175378 AAGGAAATGAAAACAGGAGAGGG + Intronic
1141761311 16:86030416-86030438 GTAGAAAGGAAGACAGGGGACGG + Intergenic
1141868822 16:86770271-86770293 ATGGTAATGCAGGCTGGGGCGGG + Intergenic
1142660154 17:1423342-1423364 ATGGTAATTAAGACTAGGAATGG + Exonic
1143864259 17:9912439-9912461 ATGGACAAGAAGGCTGGGGCTGG - Intronic
1143900336 17:10169699-10169721 ATGGAGAAGAGGTCTGGGGATGG - Intronic
1144257849 17:13487225-13487247 CTGGAAATGAATATTGGTGATGG + Intergenic
1144424996 17:15133373-15133395 ATGCAAATGAAGACTGGTTGTGG + Intergenic
1144693690 17:17286711-17286733 ATAGAAATGGAGAATGTGGAAGG - Intergenic
1146316495 17:31811423-31811445 ATGGAGATGAACAGTGGTGACGG + Intergenic
1147484756 17:40801861-40801883 ATGGAAGTGAAGAAGGAGGATGG + Intergenic
1147749232 17:42718392-42718414 AAGGAAATGGTGGCTGGGGATGG + Intronic
1147978732 17:44262108-44262130 TTGGAAATGAGGGCTGGGGGTGG - Intronic
1149027898 17:52051075-52051097 GAGGAAATGAAGAGTGGGAAGGG + Intronic
1149251299 17:54772800-54772822 ATGAAAGTCAAGACTGGGGCTGG - Intergenic
1149306207 17:55349174-55349196 ATGGAAATAAAGATTTGGGGAGG - Intergenic
1149836730 17:59919804-59919826 AAGGAACTGAAGACTGTAGAAGG - Intronic
1151165331 17:72198480-72198502 GTGGTAATGGAGAGTGGGGAGGG - Intergenic
1151390605 17:73784471-73784493 AAGGAACTGGAGACAGGGGAAGG - Intergenic
1151656482 17:75498619-75498641 ATGGAAATGAAGACTGGGGAAGG - Exonic
1151796614 17:76350663-76350685 CTGGAAATGAATAGTGGTGATGG + Intronic
1153153900 18:2127450-2127472 TTGGAAAGGAAGACTGAGAAGGG - Intergenic
1154477877 18:14782883-14782905 AAGGGAATGAAGACTAAGGAAGG + Intronic
1155071793 18:22323469-22323491 CTGGAAATGAAGGGTGGTGATGG - Intergenic
1155755413 18:29489051-29489073 ACAGAAATGAGGACTGTGGAAGG - Intergenic
1155905492 18:31446115-31446137 CTGGAAATGAAGAGTGGTAATGG + Intergenic
1156865367 18:41883448-41883470 GTGGAAGTGTAGAGTGGGGATGG + Intergenic
1156913494 18:42438823-42438845 ATGGTGATGAGGGCTGGGGAGGG - Intergenic
1157211831 18:45749435-45749457 GTGGACATGAAGACTGGTCAGGG + Intronic
1158146473 18:54319725-54319747 ATGGAGATGATGACAGGGCAAGG + Intronic
1158482677 18:57835863-57835885 ATGGAAGTGACCACTGGGGATGG - Intergenic
1158525733 18:58211684-58211706 ATGGAAAAGAAAACCGGTGAGGG + Intronic
1158895146 18:61905892-61905914 CTGGAAATGAATAGTGGTGATGG - Intergenic
1159025685 18:63180531-63180553 ATGGAGATTAAGCCTGGGGTGGG - Intronic
1159108261 18:64027593-64027615 AAGAAAATGAAAACTTGGGAGGG - Intergenic
1159364051 18:67442891-67442913 ATGAGAATCTAGACTGGGGAAGG + Intergenic
1159502998 18:69298083-69298105 AGGGAAAGGAAGAATGGGGGAGG - Intergenic
1159779164 18:72641647-72641669 AAGGACATGAAGAATGGTGATGG - Intergenic
1159909771 18:74134713-74134735 CTAGAAATGCAGACTAGGGATGG + Intronic
1159936479 18:74372159-74372181 ATGGGAGTGAATACTGGGTAAGG + Intergenic
1160177808 18:76610424-76610446 TTGGAAATGGAGAGTGGTGACGG - Intergenic
1160294093 18:77622165-77622187 ATGCAAATGAAGACTTGGCCTGG + Intergenic
1160770908 19:830679-830701 AAGGAAATGGAGTCAGGGGAGGG - Intronic
1161179128 19:2867580-2867602 CAGGGAATGAAGACTGGGGCAGG - Intronic
1161500814 19:4614436-4614458 ATGGAGATGAGGACAGGGGGTGG + Intergenic
1161779938 19:6285246-6285268 ATCGAAAAGAATAATGGGGAAGG + Intergenic
1162091566 19:8283679-8283701 ATGTAGATGCAGACTGGGGGTGG - Intronic
1162093803 19:8298528-8298550 ATGTAGATGCAGACTGGGGGTGG - Intronic
1162557834 19:11398634-11398656 AAGGAAATGAAGGCTGGGCATGG - Intronic
1162619679 19:11831747-11831769 ATGGTAATGCACAGTGGGGATGG + Exonic
1162633655 19:11948661-11948683 ATGGTAATGCACAGTGGGGATGG + Exonic
1162637181 19:11978495-11978517 ATGGTAATGCACAGTGGGGATGG + Exonic
1162985885 19:14269421-14269443 ATGGACATGAAGCCTGGGTGAGG + Intergenic
1166419184 19:42622023-42622045 ATGAAAATGGAGTCTGGGCATGG + Intronic
1167102545 19:47413002-47413024 AGGAAAATGTAGACTGGTGATGG - Intronic
1167700294 19:51039654-51039676 ATGGAAAGTAATACTGGGTATGG + Intergenic
925222051 2:2149833-2149855 TTGGAAATGCAGACCTGGGATGG - Intronic
925842830 2:8008449-8008471 TTGGAAATGAAGACTTTGAAAGG - Intergenic
926652985 2:15366776-15366798 AAGAAAATGAAAACTGGGTAAGG + Intronic
927775902 2:25902937-25902959 ATAGAAATGTAGGCTGGGCACGG - Intergenic
927856081 2:26528774-26528796 ATGGGAAAGAAGACTGGGCAAGG + Intronic
927867213 2:26597805-26597827 GTGGAAATGAGGCCTGGGGAAGG + Intronic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
929357942 2:41049501-41049523 ATGGAAGGGAAGAGAGGGGAGGG - Intergenic
929992644 2:46802722-46802744 AGTGAAATGAAGATTGAGGATGG - Intergenic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930213547 2:48669107-48669129 CTGGAAATACAGAGTGGGGATGG - Intronic
931353572 2:61514300-61514322 ATGGAAATTAAGGCTGGGCGTGG + Intronic
931601649 2:64009604-64009626 ATGAAAATGTAGGCTGGGCATGG - Intronic
932001494 2:67889212-67889234 ATGTAAATCAAGACTGGGTGTGG + Intergenic
932296607 2:70629116-70629138 AATGAAATGAAGGCTGGGCATGG + Intronic
932323413 2:70838316-70838338 ATGGAAATGCAGGCTGAGGTAGG + Intergenic
932702912 2:74003110-74003132 GTGGAAATAAAGGCTGGTGAAGG + Exonic
933215825 2:79629070-79629092 ACGGAAGTGGAGAGTGGGGAAGG - Intronic
933771707 2:85748834-85748856 GTGGAAAGGGAGAGTGGGGAGGG - Intergenic
934540803 2:95173025-95173047 AAGGGAAATAAGACTGGGGAAGG - Intronic
934773155 2:96920874-96920896 GAGGAGCTGAAGACTGGGGAGGG + Intronic
935574213 2:104692207-104692229 ATGGAGATGAATAGTGGTGATGG - Intergenic
935982397 2:108640241-108640263 AAGGACATGGAGCCTGGGGAAGG - Intronic
937130619 2:119509741-119509763 ATGGAAATGGATACTGGGGATGG - Intronic
937501658 2:122485786-122485808 AGGGAAAAGAAGGCTGGGGGTGG + Intergenic
937698321 2:124834570-124834592 ATGGCAATGGAGACAGGGGCTGG + Intronic
937971436 2:127552325-127552347 ATGGAAATGAAGCCAGGAGGTGG + Intronic
939048557 2:137279639-137279661 AAGGAAATTTAGATTGGGGAAGG + Intronic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
939868094 2:147497491-147497513 AGGGAAATGAGCATTGGGGATGG - Intergenic
940020350 2:149149790-149149812 ATGGAGATAAAGAAAGGGGAAGG - Intronic
940394308 2:153169853-153169875 GTGGAAATGAAAATTTGGGAGGG + Intergenic
941452184 2:165672854-165672876 CTGGAAGAAAAGACTGGGGAAGG + Intronic
941573126 2:167196352-167196374 AAAAAAAGGAAGACTGGGGATGG + Intronic
941782615 2:169461059-169461081 ATAAAAATGGTGACTGGGGAGGG + Intergenic
942073336 2:172335079-172335101 ATGCAAATGGGGCCTGGGGAGGG - Intergenic
942542183 2:177025903-177025925 ATGGAACTGAAATCTGGGGATGG + Intergenic
942971539 2:181962831-181962853 ATCCACATGAAGACAGGGGAAGG + Intronic
943283240 2:185964428-185964450 CTGAAAGGGAAGACTGGGGAGGG - Intergenic
943805317 2:192117740-192117762 ATGCAAATGAAGACTTGGCCTGG - Intronic
944143271 2:196479776-196479798 ATGGAAAAGAAAATTGGGGCTGG - Intronic
946950251 2:224866552-224866574 ATGGAGATGAAGACTAGGGTGGG - Intronic
946961201 2:224987605-224987627 CTGGAAATGAAGACTGCAGTTGG + Intronic
947169219 2:227294467-227294489 CTGGAAATGAAGAGAGGGGAAGG - Intronic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
1168760853 20:348365-348387 AGGGAAAAGAAGAGCGGGGAAGG - Intronic
1169264198 20:4157731-4157753 ATGGACATGAAGCTGGGGGAGGG + Intronic
1169519827 20:6359041-6359063 ATTGGATTGAAAACTGGGGAGGG - Intergenic
1169631379 20:7636495-7636517 AGGGAAATGAAGAAAGTGGAGGG + Intergenic
1170007165 20:11681823-11681845 ATGGAAATAAAGTATGGGGGAGG - Intergenic
1170326494 20:15160053-15160075 ATGTAAATGGAGACAGGGCATGG + Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171316519 20:24200369-24200391 ATTGAAGGGAAGACTGAGGAGGG - Intergenic
1171840945 20:30210315-30210337 AAGTAAATGAAGACAGGGTAGGG + Intergenic
1171990058 20:31689228-31689250 AAGGAAAGGAAGAAAGGGGAAGG + Intronic
1172191962 20:33067480-33067502 ATGGAAATGAAAGCTGGGTTTGG + Intronic
1172254063 20:33501478-33501500 AGGGAAATGCAGAATGGTGAGGG + Intronic
1172325746 20:34033154-34033176 AGGGAAATGAAGACTGTCCAAGG - Intronic
1172483455 20:35285072-35285094 ATGGAAATGAAGCCGGAGGAAGG + Intergenic
1172692933 20:36803085-36803107 ATGGAGCTGAAGACAGGGAAGGG - Exonic
1172908906 20:38391246-38391268 ATGGAAATGAAGCATTGGTAAGG + Intergenic
1173670240 20:44793777-44793799 GTAGAAATGAAGGCTGGGCATGG + Intronic
1173678511 20:44859315-44859337 AAGGAAATGAGAACTGGGTAGGG + Intergenic
1173865489 20:46309743-46309765 ATGGAGATGGAAATTGGGGAAGG - Intergenic
1174737373 20:52977630-52977652 AAGGAAATCAAGACGGGGGTGGG - Intronic
1174752229 20:53122945-53122967 TTGGAAATAAAAACTGGGGGAGG + Intronic
1174818622 20:53708734-53708756 AAAGAAAAGAAGACAGGGGAGGG - Intergenic
1174938608 20:54898787-54898809 AGGGAAAGGAAGAGTGGGAAGGG + Intergenic
1175148939 20:56917858-56917880 ATGGGAATTGGGACTGGGGAGGG - Intergenic
1175556735 20:59867085-59867107 AAGGAAAGCAAGACTGGGGGCGG + Intronic
1176938356 21:14893598-14893620 TAGGAAATGAAGTCTGGGGAAGG - Intergenic
1177755172 21:25337800-25337822 ATAGATAAGAAGACTGGAGAAGG + Intergenic
1177872374 21:26589358-26589380 ATGGAAATGAAGATTGTGTGAGG + Intergenic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1178290201 21:31361034-31361056 ATGGACATGAGTGCTGGGGAAGG + Intronic
1178465541 21:32844126-32844148 AGGCAAAAGCAGACTGGGGATGG - Intergenic
1178598317 21:33974660-33974682 AAGGAAAGGAAGAAGGGGGATGG - Intergenic
1178773864 21:35530438-35530460 AAGCTAATGATGACTGGGGAAGG + Intronic
1179503514 21:41824607-41824629 GTGGACAGAAAGACTGGGGACGG + Intronic
1179839246 21:44060052-44060074 AGGGAGATGAAGTGTGGGGACGG + Intronic
1180142916 21:45903161-45903183 AGGCATATGGAGACTGGGGAAGG + Intronic
1180471091 22:15656265-15656287 TTGGAAAAGAAGGCTGGGCAAGG - Intergenic
1181826535 22:25520771-25520793 ATAGAAAGGCAGACTGGAGAAGG + Intergenic
1181960194 22:26617156-26617178 CTGAAAATGAGGACTGGGGCTGG + Intronic
1182008600 22:26981842-26981864 ATGCCAATGGACACTGGGGAGGG + Intergenic
1183932597 22:41244843-41244865 CTGGAAATGGAGAGTGGTGATGG - Intergenic
1184100071 22:42337323-42337345 AAGGTACTGAAGACTGGGGGAGG - Intronic
1184538970 22:45107218-45107240 AAGGAAGGGAAGACTGGGGTGGG + Intergenic
1185358974 22:50393681-50393703 ATGGGAATGGTTACTGGGGAGGG + Intronic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
949940212 3:9148923-9148945 ATGAAACTGGAGACTGGGTATGG + Intronic
949989459 3:9566672-9566694 TTGGAAATGAACAGTGGTGATGG - Intergenic
950132796 3:10558831-10558853 AAGGAAAGGAAGACAGGAGAGGG + Intronic
950210010 3:11116353-11116375 ATGGAAATGGTGACTGGGAGGGG - Intergenic
950894174 3:16433095-16433117 ATTAAAATGAAGTCTGGGAAAGG - Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
952247781 3:31614408-31614430 ATGGACAAGGAAACTGGGGAGGG - Intronic
952820803 3:37484110-37484132 ATGGGAAGGAAGATTGGGCAGGG - Intronic
952965419 3:38618110-38618132 ATCGACCTGAAGAGTGGGGAAGG - Intronic
953312559 3:41893202-41893224 TTGGAAATGAATAGTGGTGATGG + Intronic
953703069 3:45211455-45211477 ATGGAAATGGTTAGTGGGGAGGG + Intergenic
953942300 3:47110886-47110908 AGGGGAAAGGAGACTGGGGAAGG - Intronic
955016787 3:55077945-55077967 GGAGAAATGAAGACAGGGGAGGG - Intergenic
955932180 3:64068090-64068112 CTGGAAAAGAAGACTGGGAGAGG + Intergenic
956011412 3:64835454-64835476 CTGGAAATGAATAGTGGAGATGG - Intergenic
956047271 3:65209015-65209037 AAGAAAATGAAGGCTGGAGAAGG - Intergenic
956583186 3:70836466-70836488 ATGGATGTGAAGCCTGGAGATGG - Intergenic
959712117 3:109395771-109395793 TTGGAAATGAAGATTGGAAACGG - Intergenic
959807811 3:110578483-110578505 CTGGAACTTAAGACTGGGAAAGG - Intergenic
959882963 3:111467418-111467440 ATGGAAATTAAGACTTGCAAGGG + Intronic
960649653 3:119932817-119932839 ATGGAAATATAGGCTGGGTACGG + Intronic
961039843 3:123670293-123670315 ATGGACCTGAAGGCTAGGGAAGG + Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961165429 3:124760239-124760261 CTGGAAATGCAGACAGGGCATGG - Intergenic
961965802 3:130901450-130901472 ATGGGAATGAAGGGTAGGGATGG + Intronic
962546092 3:136437225-136437247 ATGGAATTGAACACTGTGCAAGG - Intronic
962646935 3:137449417-137449439 AAGGAAATGTAGCCAGGGGAAGG + Intergenic
962662496 3:137617461-137617483 TTGGGAAAGAACACTGGGGAGGG - Intergenic
962784852 3:138758307-138758329 CTGGAAATGGATACTGGTGATGG + Intronic
962896729 3:139722146-139722168 ATGTAAATGAGGACTGCGGTTGG - Intergenic
963493698 3:146033555-146033577 ATTGAGATGAAAACTGGGGGAGG + Intergenic
963524004 3:146393316-146393338 ATAGAAATGTAGGCTGGGCACGG - Intronic
964350225 3:155795663-155795685 ATGGTAATGAAGGCTGGGAGCGG + Intronic
964468337 3:157023429-157023451 ATGGAAATGCCTTCTGGGGAAGG + Intronic
964813731 3:160694339-160694361 AGGGAAATAGAGACTAGGGAAGG + Intergenic
965044475 3:163557946-163557968 GTATAAATCAAGACTGGGGATGG - Intergenic
965151930 3:164988752-164988774 ATGGAAATAAAGACTGTGACAGG + Intronic
965599645 3:170442220-170442242 TGGGAAATGTAGACTGAGGATGG + Intronic
965758386 3:172049022-172049044 CTGGAAATGAACAGTGGCGATGG + Intronic
966679550 3:182626861-182626883 AAGGAAATGAACAAGGGGGAGGG + Intergenic
967469517 3:189845684-189845706 CTGGAATTGCAGACTCGGGAGGG + Intronic
967615060 3:191554986-191555008 CTGGAGATGAAGTTTGGGGAGGG - Intergenic
967733026 3:192923578-192923600 AAGGAAATGAACTCTAGGGATGG + Intergenic
967935761 3:194726129-194726151 GTGTAAATGCAGACTTGGGACGG - Intergenic
968115355 3:196085184-196085206 ATGGGAATAAAGGCTGGGCACGG + Intergenic
968182566 3:196607183-196607205 TTCAAAATGAAGACTGGGGCTGG - Intergenic
968304478 3:197640356-197640378 ATGCAGATGAAGACTCGGGGAGG - Intergenic
969265323 4:6060759-6060781 AGGAAAATGAAGCCTGGAGAAGG + Intronic
970732299 4:19120491-19120513 CAGAAAATGAAGACTGGTGAAGG + Intergenic
972066283 4:34949667-34949689 ATTGAAATGAAGTCTGGGAGTGG + Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973274763 4:48294745-48294767 ATGGAAATGAAGTCTGTCCATGG + Intergenic
973744633 4:53951064-53951086 ATGGACGTGCAGGCTGGGGACGG + Intronic
974384804 4:61190397-61190419 ATGTAGATGATGACTGGGAAAGG - Intergenic
974984085 4:68997432-68997454 ATGGCATTAAAAACTGGGGATGG + Intergenic
975070274 4:70127666-70127688 ATGCAAATGAAGGCAGGGGTGGG + Intergenic
975363872 4:73505100-73505122 CAGGAAATGAAGACTGGTTATGG + Intergenic
975450546 4:74520209-74520231 ATGTATATGAGGATTGGGGATGG - Intergenic
976145695 4:82041115-82041137 ATGAAAAGAAAGACTGGGGCTGG + Intronic
976894037 4:90085635-90085657 CTGGAAATGGAGAGTGGTGATGG - Intergenic
976904642 4:90222088-90222110 ATGGAAATGATTTCTGGGGTGGG + Intronic
977789072 4:101076544-101076566 ATGGAAACGCAGACTGGAGTGGG + Intronic
978637146 4:110823258-110823280 TTGGAAATGAGGAATGGAGACGG + Intergenic
980310372 4:131121283-131121305 AGGGAAATGAAGACTGAGAAAGG + Intergenic
980375802 4:131946760-131946782 TTGGACATGAAGACTTGGAACGG + Intergenic
980394784 4:132197602-132197624 ATGGAAATGAGGAATGGGGCTGG + Intergenic
980843758 4:138299408-138299430 ATTGAAATCATGACTGTGGAAGG - Intergenic
981286362 4:143023773-143023795 CTGGAAATGAATAATGGTGATGG + Intergenic
981485304 4:145279707-145279729 CTGGAAATTAAGAATGGGAAGGG - Intergenic
981830095 4:148989499-148989521 CTGGAAATAGAGCCTGGGGAAGG + Intergenic
982472306 4:155807771-155807793 CAGGAAATAAAGACTGGGCATGG + Intergenic
982717030 4:158819776-158819798 AAATAAATGAAGACTGGGGGTGG - Intronic
982855964 4:160383500-160383522 ATGAAAAACAAGAATGGGGAGGG - Intergenic
982932744 4:161429128-161429150 ATGGGAGGGAAGACTGGGAAGGG + Intronic
982951111 4:161697191-161697213 ATGGGACTGAGGAATGGGGACGG + Intronic
983231736 4:165135619-165135641 ATGGACATGAAGGCTGGGTGTGG + Intronic
983694546 4:170511852-170511874 ATAGAAATCATGACTGGGCATGG - Intergenic
984629979 4:182051051-182051073 AAGCAAATGAAGTCTGGGCATGG + Intergenic
985074438 4:186199198-186199220 CTGGAAATGAACGGTGGGGATGG - Intronic
985485482 5:146171-146193 ATGGAAAGGAAGAGGAGGGAGGG - Intronic
985720633 5:1486835-1486857 CTGGAAATGGAGACGGGGAAAGG + Intronic
985813525 5:2109508-2109530 AGGGAATTGAAGACTGGGGTTGG - Intergenic
986609254 5:9550483-9550505 ATGGAGATGAAGCCTCTGGATGG + Intergenic
987181212 5:15370390-15370412 GTGGAAATGCAGTCAGGGGATGG - Intergenic
987546111 5:19312131-19312153 ATAGAAGTGAAGACTGTGGAAGG - Intergenic
987783668 5:22470706-22470728 ATAGAAAAGAAGACTGGGCAAGG - Intronic
988709500 5:33759238-33759260 TTGGAAATGAAGTCTGTTGAAGG - Intronic
989296608 5:39835184-39835206 GTGGAAATGAATACTGGTTAAGG - Intergenic
989411488 5:41124488-41124510 ATGAAAGTGCAGAGTGGGGATGG - Intergenic
990507059 5:56455503-56455525 ATGGACAGGAAGCCTGGAGATGG - Intergenic
991719738 5:69484301-69484323 ATAGAAATGTTGACTGGGCATGG - Intergenic
991941609 5:71858434-71858456 ACGGAAATGGTGACTGGGAAAGG + Intergenic
992025305 5:72663889-72663911 ATGGAAAGGTAGGCTGGGGCTGG - Intergenic
992740788 5:79771480-79771502 ATGCAAATGCCAACTGGGGACGG - Intronic
993487324 5:88502907-88502929 ATGGAAATTAAGACTTGCAATGG - Intergenic
993907382 5:93638520-93638542 ATAGAAATGCAGGCTGGGCACGG + Intronic
994094840 5:95839268-95839290 GGGGAAATGGAGACTGGGGTTGG + Intergenic
995715028 5:115073867-115073889 CTGAAAGGGAAGACTGGGGAGGG - Intergenic
996140067 5:119895979-119896001 AGGCAAAAGAAGTCTGGGGAAGG - Intergenic
997047584 5:130337410-130337432 TTGGAAAGGCAGACTGGGAAAGG + Intergenic
997817433 5:137032843-137032865 ATGGACTTGAAGGCTGAGGATGG + Intronic
998076370 5:139239936-139239958 AACGACATGAAGACAGGGGAAGG + Intronic
998472842 5:142396790-142396812 ATGCAAATGAAGACTTGGCCAGG + Intergenic
998620413 5:143788454-143788476 AAAGAAAAGAAGAATGGGGAAGG + Intergenic
998699384 5:144680355-144680377 AAGGAAATGAAGGATGGGGACGG + Intergenic
999177703 5:149642966-149642988 ATGGCAAGGAAAACTGGCGATGG - Intergenic
999983129 5:156976890-156976912 ATAGATATGAAGGCTGGGCATGG - Intergenic
1000294319 5:159899697-159899719 ATGGAAATGAAAACTGTGGCAGG + Intergenic
1000762463 5:165243186-165243208 AAAGAAATGAAGGCTGGGTAAGG - Intergenic
1000839020 5:166193129-166193151 ATGCAGATTAAGAATGGGGAAGG + Intergenic
1000861989 5:166466966-166466988 ATAGAAAAGAGGGCTGGGGACGG - Intergenic
1000931547 5:167257941-167257963 AATGAAATGAAGACTAGGAAAGG + Intergenic
1001021174 5:168183583-168183605 ATGGAAATGAAGAAGGTGCAGGG - Intronic
1001915088 5:175553631-175553653 TTAGAAATGAAGACTGAGGCTGG + Intergenic
1001995812 5:176156940-176156962 ATGGAAATGAAGAGGGCAGAGGG - Intergenic
1002307755 5:178293747-178293769 ATGGATCTGAAGGCTGGAGATGG + Intronic
1003192453 6:3886541-3886563 AAGGAAATGAAGACTCAAGAAGG - Intergenic
1003682007 6:8265933-8265955 CTGGAAATGAGGAATGGGAAAGG + Intergenic
1004320062 6:14625352-14625374 ATAAAAATGAGGAGTGGGGAAGG - Intergenic
1004526464 6:16413068-16413090 TTAGAAATGAAGAAAGGGGAAGG + Intronic
1004621122 6:17331283-17331305 ATGAAAATGTAGGCTGGGCATGG + Intergenic
1004685270 6:17937203-17937225 ATGGAAAGGAAGTCTGGAGTCGG + Intronic
1004819535 6:19352285-19352307 AAGGAAAAAAAGAGTGGGGAAGG - Intergenic
1004969224 6:20890042-20890064 ATGGAAATGTAGCCCGGGCACGG - Intronic
1005132029 6:22520463-22520485 AGGGAAAGGAGGACAGGGGAAGG + Intergenic
1005887607 6:30108675-30108697 ATGGAAATGAAGATGGGAGATGG + Intronic
1006392328 6:33765852-33765874 ATGGATGTGAAGACTCCGGAAGG - Intergenic
1006553117 6:34841363-34841385 ATAGAAATATAGACTGGGGCTGG - Intronic
1006663148 6:35666598-35666620 ATGTATATGAAGGCTGGGCACGG + Intronic
1006892171 6:37438087-37438109 ATGGAAATCCAGGCTGGGCATGG + Intronic
1007407040 6:41641111-41641133 AAAGAAATGAAGACTAGGGGTGG - Intronic
1007419030 6:41708229-41708251 GTGGAACTGGCGACTGGGGAAGG + Intronic
1008460381 6:51763201-51763223 ATGGATATGAAAACTGAGGCTGG - Intronic
1008851519 6:56028052-56028074 ATTGAAATGAGGGGTGGGGATGG + Intergenic
1010162624 6:72875894-72875916 ATAGAAATGTAAACTGAGGAAGG - Intronic
1010949977 6:82024116-82024138 ATGCAAATGGAGAGTGGTGATGG - Intergenic
1011727077 6:90220545-90220567 ATGGAAATGAGGACTGACAAGGG - Intronic
1011740255 6:90352583-90352605 CTGGAAATGAATAGTGGTGATGG - Intergenic
1012075906 6:94685607-94685629 ATGGAACAGAAAACTGAGGAAGG - Intergenic
1012271693 6:97220279-97220301 AGGTAAAAGAAGACTGTGGATGG + Intronic
1012476987 6:99624518-99624540 ATGGAGATGAACACAGAGGAAGG + Intergenic
1013144821 6:107378493-107378515 ATAGCACTGAAGACTGGGCATGG + Intronic
1013410950 6:109882883-109882905 ATGAAAATGCAGGCTGGGAATGG + Intergenic
1013490227 6:110639771-110639793 AGGGAAATGCTCACTGGGGATGG + Intronic
1014090898 6:117402451-117402473 TTGGAAATGAAGAGTGAAGAGGG - Intronic
1014498169 6:122153763-122153785 CTGGAAATGCAGACTAGGAAGGG - Intergenic
1015966874 6:138703069-138703091 AATGAAATGCAGACTGGGCATGG + Intergenic
1016520370 6:144940092-144940114 ATGGAACTACAGTCTGGGGATGG - Intergenic
1016706662 6:147116712-147116734 AAGGAAATTGAGGCTGGGGAGGG - Intergenic
1016781079 6:147959168-147959190 TTGGAAATGAAGAAAGGGTAGGG - Intergenic
1016991635 6:149933764-149933786 ATGGAGAGGAAGAGTGGGAAGGG + Intergenic
1017128732 6:151090286-151090308 AGGGAAAGGGAGACTGGGGGTGG - Intronic
1017131789 6:151114198-151114220 ATGGCAATGAAGGATGGGTATGG + Intergenic
1017360606 6:153564782-153564804 CTGGCACTGAAGACTGAGGAAGG + Intergenic
1017650684 6:156578752-156578774 ATAGAAGAGAAGACTGTGGATGG - Intergenic
1017755829 6:157528390-157528412 AAGTAGATGAAGACTGGGGATGG + Intronic
1017762815 6:157584186-157584208 ATGGGAGTGAACACTGGGGCAGG + Intronic
1018494479 6:164335912-164335934 AGGAAAATGAAGCGTGGGGAGGG - Intergenic
1018511381 6:164527828-164527850 ATGGCAATGGACACTGTGGATGG - Intergenic
1018589095 6:165397417-165397439 ATATAAATGAAGGCTGGGCAAGG + Intronic
1018641487 6:165908182-165908204 ATGGAAATGAAGCCACAGGAAGG + Intronic
1019335286 7:479909-479931 CTGGAAACCATGACTGGGGAGGG - Intergenic
1019344371 7:522231-522253 ATGGAAACGAAGGCCGGGGAGGG - Intergenic
1019416957 7:932256-932278 CTGGAGAGGAAGGCTGGGGAGGG - Intronic
1020438013 7:8186547-8186569 ATACAAATGGAGACAGGGGATGG + Intronic
1020571431 7:9868328-9868350 TTATAAATGAAGACAGGGGAAGG - Intergenic
1021172548 7:17415294-17415316 TTGGAAATAGAGACTAGGGAGGG - Intergenic
1021555642 7:21915238-21915260 ATGGAAATCAAGATGGGGAAAGG + Intronic
1021918844 7:25463261-25463283 ATAGCAAAGAAGACTGGAGATGG + Intergenic
1022706814 7:32809572-32809594 ATGGAATTCAATACTGGTGATGG + Intergenic
1022892137 7:34712307-34712329 ATGGAAAAGTAGAGTGGAGAAGG - Intronic
1024104344 7:46067032-46067054 AGAGAGATGAAGAATGGGGAGGG - Intergenic
1024204731 7:47147586-47147608 ATGCAAATGCAGACTGGGCTAGG + Intergenic
1025207150 7:57000456-57000478 AAGGACATGAAGAATGGGAAAGG - Intergenic
1025243165 7:57294856-57294878 ATGGAAATGTTGGCTGGGCATGG + Intergenic
1025664786 7:63576434-63576456 AAGGACATGAAGAATGGGAAAGG + Intergenic
1026168545 7:67932568-67932590 ATGGAAATGTTGGCTGGGCATGG + Intergenic
1026863481 7:73809043-73809065 AGGGAAATGGCAACTGGGGAGGG - Intronic
1026945012 7:74310232-74310254 ATAAAAATGAAGACTGGTCATGG + Intronic
1027198010 7:76044529-76044551 GTGGAGATGAGGACTTGGGAGGG + Intronic
1028396326 7:90372604-90372626 ATGGAAAATATGGCTGGGGAGGG - Intronic
1029486966 7:100849215-100849237 AGGGAAGTGAAGGCTGGGCACGG - Intronic
1030238706 7:107295230-107295252 AGGAAAATTAAGACTGGGTACGG - Intronic
1030526665 7:110662454-110662476 ATGGAACTGAAGAATTGAGAAGG + Intergenic
1031599197 7:123684938-123684960 CAGGAAAAGAAGATTGGGGAAGG - Intronic
1032142401 7:129344692-129344714 TTGGAAAAGAAGACTGTTGATGG + Intronic
1035068766 7:156125957-156125979 TTGGAAATTGAGACTGGAGAAGG - Intergenic
1036414629 8:8535578-8535600 ATGGAAAAAGAGACTGGGGTGGG + Intergenic
1037379480 8:18269251-18269273 ATGGAAATGATGCCTTGGAAAGG - Intergenic
1037738269 8:21583814-21583836 AGGGAAATGAAAAGGGGGGAAGG - Intergenic
1038487677 8:27948441-27948463 ATGGAAGAGAAGATAGGGGAAGG - Intronic
1038833587 8:31092746-31092768 ATGGAAGGACAGACTGGGGAGGG - Intronic
1039419166 8:37421251-37421273 AGAGAAATGAAGGGTGGGGAGGG - Intergenic
1039453239 8:37692460-37692482 ATTGAACTGGAGGCTGGGGAAGG + Intergenic
1039860524 8:41453301-41453323 AAGAGAATGAAGAATGGGGATGG + Intergenic
1041133821 8:54734446-54734468 AAGGACATGAAAACTGGGCAGGG - Intergenic
1041196107 8:55402828-55402850 ATGGATATGAAAACTAGGCAGGG + Intronic
1041849199 8:62369037-62369059 ATGGAAATGAAGAGTGCAAAGGG - Intronic
1041904929 8:63021962-63021984 ATGGATATGAGGTCTGGGCATGG - Intronic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1042386339 8:68179488-68179510 ATTGAAAACAACACTGGGGAAGG + Intronic
1042778803 8:72467224-72467246 ATTGAAAGGATGACTGAGGATGG - Intergenic
1042929900 8:74002862-74002884 ATGGAGCTGAAGGCTGGGCACGG - Intronic
1044113814 8:88309390-88309412 ATGGGAAGGAAGGCAGGGGAAGG + Intronic
1044552000 8:93522904-93522926 ATCCAAATGAATACTGGAGATGG + Intergenic
1044916206 8:97115003-97115025 CTGGAAATGAGGACTGTGGATGG - Intronic
1045016681 8:98006788-98006810 ATGGGAAAGAAGGCTGGGCATGG + Intronic
1045237057 8:100361391-100361413 GTGGAAATGAGGCCTGGGGCTGG + Intronic
1045601286 8:103720064-103720086 ATTGAAATGAAGGGTGTGGAAGG + Intronic
1047455359 8:125003938-125003960 TTGGAAAAAAAGACAGGGGAGGG - Intronic
1048176992 8:132161865-132161887 ATGGAAATGAGACCTGGAGATGG - Intronic
1048262850 8:132960387-132960409 AAGGAACTGAAGACTGAGCAGGG + Intronic
1048833554 8:138497744-138497766 AGGGAGAGGAAGATTGGGGAGGG + Intergenic
1048862340 8:138733131-138733153 GTGGAAATGCAGGCAGGGGAGGG - Intronic
1048888331 8:138926252-138926274 ATGGAAATGAAGGCTTGGGGTGG + Intergenic
1048986676 8:139738534-139738556 CTGGCTATGAAGACGGGGGAAGG + Intronic
1049966269 9:783040-783062 GTGAAAATAAGGACTGGGGAGGG + Intergenic
1050096554 9:2073326-2073348 CTGGAAATGAATCCTGGGTAAGG + Exonic
1050612246 9:7365207-7365229 ATGGAAATGATATCTGGAGAAGG - Intergenic
1050631753 9:7566768-7566790 ATTGACATGAAGATTGGGGGTGG - Intergenic
1051336818 9:16073130-16073152 TTGGAACTGAAGACTGGGTCTGG + Intergenic
1051809870 9:21036755-21036777 ATGGAAAGGAAGACTGTCAAGGG - Intergenic
1051895290 9:21980381-21980403 AAGGAAATGAAGAACTGGGATGG + Intronic
1052633087 9:31065882-31065904 TTGGAATTTAAGACTGGGGGTGG - Intergenic
1053232969 9:36427309-36427331 ATGGAAGTGTAGACTAGGAAAGG - Intronic
1053242993 9:36511717-36511739 ATAGAAATGCAGGCTGGGCATGG - Intergenic
1053391511 9:37739719-37739741 ATAGAACTGAGGTCTGGGGAGGG + Intronic
1055314511 9:75020554-75020576 ATGAAAATGAAGGCTGGGTGCGG - Intronic
1055409828 9:76017179-76017201 TGGGAAATGGAGCCTGGGGAGGG - Intronic
1056082977 9:83116082-83116104 CTGGAAATGAAGCCTTGGCAGGG - Intergenic
1056266485 9:84901760-84901782 ATGGAGAAGAAGCCAGGGGAGGG - Intronic
1056425473 9:86471262-86471284 ATGGAAAAGAAGACTGGCAACGG + Intergenic
1056688032 9:88782848-88782870 CTGGAAATGAAGAATGGGGAAGG + Intergenic
1056813448 9:89782211-89782233 ATGGAAATGCAAAATGGGGTTGG - Intergenic
1057132884 9:92666873-92666895 TAGGAAATGAGGCCTGGGGATGG - Intronic
1057306978 9:93918172-93918194 ATGAAAATCAAGACCTGGGAGGG + Intergenic
1058459614 9:105170800-105170822 GTGGAAATGGAAACAGGGGAAGG + Intergenic
1058701693 9:107606035-107606057 ATGAAAAAGAAGACTGGGCCGGG - Intergenic
1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG + Intergenic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1060167920 9:121434917-121434939 ATGGAAATGAGGACTGCAGCAGG + Intergenic
1060692510 9:125676675-125676697 ATGGAAATGGACAGTGGTGACGG + Intronic
1061107512 9:128543091-128543113 AATGGAATGAACACTGGGGACGG + Intergenic
1061236162 9:129343793-129343815 ATCGAAGTGAGGGCTGGGGAGGG + Intergenic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1061797028 9:133091699-133091721 ATGGAAATAGAGAGTGGTGATGG - Intergenic
1187466882 X:19535397-19535419 ATGCAAATGAAAACAAGGGAGGG - Exonic
1188024787 X:25196722-25196744 ATGGAAAGGTAGATGGGGGATGG + Intergenic
1188308687 X:28589650-28589672 ATTGAAATGATGACTGTGAACGG + Intronic
1188368482 X:29339445-29339467 AGGGAATTGAAAAGTGGGGAAGG + Intronic
1188385772 X:29555833-29555855 AAGGAAAAGAACACTGGGGAGGG + Intronic
1188913443 X:35879711-35879733 AGGGATCAGAAGACTGGGGATGG - Intergenic
1189820359 X:44864670-44864692 ATGAAAATGAGGGCTGGGCATGG - Intergenic
1189957908 X:46294986-46295008 ATGGCACTGAAGGCTGGGCATGG + Intergenic
1190071472 X:47283447-47283469 CTGGAAATTAAGTCTGGGCAAGG + Intergenic
1190132231 X:47759318-47759340 ATGCAAATGATGACTGGGCATGG + Intergenic
1190377281 X:49801306-49801328 ATGGAAAAGAAGGCTGGGCGCGG + Intergenic
1191779011 X:64847032-64847054 ATGGGAATGAAGAATGTGGTAGG - Intergenic
1192106820 X:68325845-68325867 ATGGATATGGAGACGGGAGATGG - Intronic
1192106824 X:68325864-68325886 ATGGACACGGAGACTGGAGATGG - Intronic
1192177946 X:68897609-68897631 GAGGAAATGAAAATTGGGGATGG + Intergenic
1192735357 X:73845206-73845228 AGGGAAAGGAAGATTGGGGGTGG + Intergenic
1192735452 X:73845796-73845818 AGGGAAAGGAAGACTGGGAGTGG + Intergenic
1192735509 X:73846088-73846110 AGGGAAAGGAAGATTGGGGGTGG + Intergenic
1192827376 X:74711813-74711835 GTGGATTTGAAGACTGGTGAGGG + Intergenic
1194905116 X:99566324-99566346 ATGGCAATAAACCCTGGGGAGGG + Intergenic
1194942340 X:100026430-100026452 ATGGAAATGAATCTTGGGAAGGG + Intergenic
1195112686 X:101663728-101663750 CTGGAAATGAAGATGAGGGAGGG - Intergenic
1195594366 X:106672220-106672242 TTGGAAATGAATAGTGGTGATGG - Intronic
1196338045 X:114562174-114562196 ATGGAGATGAATATTGGGGATGG + Intergenic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1196850084 X:119929184-119929206 TTGGAAAGGAAGGCTGGGCACGG - Intronic
1196940516 X:120771398-120771420 AGGGAAGTGAGGACTGAGGAAGG - Intergenic
1197763234 X:130042383-130042405 GTCTAAATGAAGACTGGGCATGG - Intronic
1198193799 X:134339147-134339169 CTGGAAATGGAGACTGGTGATGG + Intergenic
1198252698 X:134896263-134896285 AAGGAAATGAGGGCTGGAGAGGG + Intronic
1198425852 X:136519531-136519553 GTGGTAGGGAAGACTGGGGAAGG + Intergenic
1198514240 X:137388538-137388560 ATGCAAGTGAAGACTAAGGAAGG + Intergenic
1199034570 X:143034440-143034462 TTGTAAATAAAGACTGGGGGAGG + Intronic
1199479686 X:148284474-148284496 ATGGAAATGGTGGCTAGGGAAGG + Intergenic
1199547553 X:149022207-149022229 CTTGAAATGAGGACTTGGGATGG + Intergenic
1199767920 X:150954059-150954081 CTGGCAGTGAAGAATGGGGAAGG - Intergenic
1200076041 X:153551644-153551666 CTGGAATTGGAGACTGGTGATGG + Intronic
1201224698 Y:11807537-11807559 CTGGAAATGAATAGTGGTGATGG + Intergenic
1201481639 Y:14445882-14445904 AAGGAAATGAAGACCAGTGAAGG + Intergenic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic