ID: 1151659547

View in Genome Browser
Species Human (GRCh38)
Location 17:75511691-75511713
Sequence CTGAGCCTACAGCCTGCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 170}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151659537_1151659547 19 Left 1151659537 17:75511649-75511671 CCAGGGCCTCATAAGGAATCCCA 0: 1
1: 0
2: 0
3: 5
4: 191
Right 1151659547 17:75511691-75511713 CTGAGCCTACAGCCTGCGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 170
1151659543_1151659547 -7 Left 1151659543 17:75511675-75511697 CCCAGTCATGCTGTGCCTGAGCC 0: 1
1: 0
2: 1
3: 24
4: 230
Right 1151659547 17:75511691-75511713 CTGAGCCTACAGCCTGCGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 170
1151659540_1151659547 0 Left 1151659540 17:75511668-75511690 CCCAGGCCCCAGTCATGCTGTGC 0: 1
1: 0
2: 4
3: 34
4: 271
Right 1151659547 17:75511691-75511713 CTGAGCCTACAGCCTGCGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 170
1151659542_1151659547 -6 Left 1151659542 17:75511674-75511696 CCCCAGTCATGCTGTGCCTGAGC 0: 1
1: 0
2: 1
3: 21
4: 187
Right 1151659547 17:75511691-75511713 CTGAGCCTACAGCCTGCGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 170
1151659541_1151659547 -1 Left 1151659541 17:75511669-75511691 CCAGGCCCCAGTCATGCTGTGCC 0: 1
1: 1
2: 0
3: 26
4: 334
Right 1151659547 17:75511691-75511713 CTGAGCCTACAGCCTGCGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 170
1151659539_1151659547 13 Left 1151659539 17:75511655-75511677 CCTCATAAGGAATCCCAGGCCCC 0: 1
1: 0
2: 3
3: 24
4: 187
Right 1151659547 17:75511691-75511713 CTGAGCCTACAGCCTGCGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 170
1151659544_1151659547 -8 Left 1151659544 17:75511676-75511698 CCAGTCATGCTGTGCCTGAGCCT 0: 1
1: 0
2: 1
3: 21
4: 250
Right 1151659547 17:75511691-75511713 CTGAGCCTACAGCCTGCGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151659547 Original CRISPR CTGAGCCTACAGCCTGCGCA GGG Intronic
900334767 1:2157001-2157023 CTGGGCCTCCAGCCTGCAGATGG - Intronic
900555673 1:3279214-3279236 CTGAGCCGAGGGCCTGCGCCTGG - Intronic
900579204 1:3400148-3400170 GTGGGCCTGCAGCCTGCCCATGG - Intronic
902332841 1:15739059-15739081 CTGACCCCACAGCCTTCCCATGG + Intronic
902480108 1:16707299-16707321 CTGCACCCACTGCCTGCGCACGG - Intergenic
902560858 1:17276728-17276750 CTGAGCCTCCTGCCTTGGCATGG - Intronic
902862642 1:19257227-19257249 CTGAGCCTCCGGCCTGCCAATGG - Intronic
903885755 1:26540111-26540133 CTGTCCCTTCAGCCTGCCCAGGG + Intronic
904457016 1:30653945-30653967 CTGAGCATACAGGCTGGGGAGGG - Intergenic
904594110 1:31632300-31632322 CTGAGCCAAGAGCCAGGGCAAGG - Intronic
905481406 1:38264508-38264530 CTGAAGCAACAGCCTGGGCATGG + Intergenic
905667444 1:39771378-39771400 CCTAGCCTAGAGCCTGCGCCTGG - Intronic
906000909 1:42424040-42424062 CTGAGCACACTGCCTGCCCAGGG + Intergenic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
912195638 1:107394106-107394128 CTGGGCATCCAGCCTGGGCAGGG - Intronic
912254356 1:108044125-108044147 CCTGGCCTACAGCCTGCCCATGG + Intergenic
912775616 1:112504728-112504750 CTGAGCCTGCTGCTTGCACAAGG - Intronic
913045861 1:115073063-115073085 CTGTGCCTAGAGCCTGCTCTCGG - Intronic
913057489 1:115175840-115175862 CTGAGCAAAGAGCCTGCTCATGG - Intergenic
915280304 1:154817967-154817989 GTGAGCCTGCAGCCTGGGGAGGG + Intronic
919019666 1:192088028-192088050 CTAAGCCTAAACCCTGCACAAGG - Intergenic
921831626 1:219733654-219733676 CTGAGGCCACAGCCAGCTCAAGG + Intronic
923616904 1:235545715-235545737 CTGGGCCTACATCCTGGGGACGG + Intergenic
1065553077 10:26888526-26888548 CTGAGCCTTCAGCATGTGCTGGG - Intergenic
1067185261 10:44021753-44021775 CTGAGGCTCCAGCCTGGTCAAGG - Intergenic
1069916637 10:71790692-71790714 CTGAGCCTCTGGCCTGCGCATGG - Intronic
1070757909 10:79004972-79004994 CTGGGCTTCCAGCCTGGGCAGGG + Intergenic
1071475321 10:86020453-86020475 CTGAGCCCACAGGCTGTGCTGGG - Intronic
1072436935 10:95422544-95422566 CTGAGCCCACAGCAGGCTCAAGG - Intronic
1072615804 10:97048308-97048330 CTGAGCCTACATCCTGGTCAAGG - Intronic
1075226702 10:120635942-120635964 CTCAACCTACTGCCTGCCCAGGG + Intergenic
1075782033 10:125023328-125023350 CCAAGCCTGCAGCCTGCACAGGG - Intronic
1077159139 11:1104723-1104745 CTGGGCAAACAGGCTGCGCAGGG - Intergenic
1077162528 11:1120246-1120268 CTGGGGCTGCAGCCTGGGCATGG + Intergenic
1077196612 11:1284129-1284151 CTGAGCCTGGAGCCTGGCCAGGG - Intronic
1078777940 11:14410881-14410903 CTAAGCCTGCAACCTGCCCATGG + Intergenic
1080653151 11:34238671-34238693 CTGAGCTCACAGCCTGAGCTGGG + Intronic
1082997211 11:59263748-59263770 CTCTGCCCACAGCCTGCGCCTGG + Intergenic
1083369819 11:62169603-62169625 CTGGGCCTCCAGCCTGGACATGG - Intergenic
1084461263 11:69297913-69297935 CTGAGCCCAGAGCTTGGGCAGGG - Intronic
1084490762 11:69476923-69476945 CCGAGCCTTCAGCCTGGGAATGG - Intergenic
1090379126 11:126312961-126312983 CTGACCCTCCAGGCTGGGCAGGG + Intronic
1091651993 12:2317760-2317782 CAGAGCCTCTGGCCTGCGCAGGG - Intronic
1093415695 12:18917982-18918004 CTGAGCCTCCAGCTTGCAAAAGG + Intergenic
1096519831 12:52178686-52178708 CTGATACCACAGCCTGGGCAAGG - Intronic
1097239407 12:57564767-57564789 CTGAGCCTTCAGCTCGTGCAGGG + Intronic
1101396427 12:104352362-104352384 CTGGGCCTCCAGCCTGCAGATGG + Intergenic
1103956209 12:124578213-124578235 CTGTGCCTGTAGCCTGGGCAGGG + Intergenic
1106287362 13:28329363-28329385 CTTAGCCTAGAGCCTGTGGAAGG + Intronic
1113432944 13:110266076-110266098 CTGAGCCAGCAGCCCGCGCGGGG + Intronic
1113971547 13:114195117-114195139 CTGGGCCTGCAGCATGCCCAGGG - Intergenic
1113990306 14:16023188-16023210 GTGGGCCTATAGCCTGGGCAAGG + Intergenic
1118090418 14:62469777-62469799 CTGACCCTAAAGCCTTAGCAGGG - Intergenic
1118260064 14:64238226-64238248 CTGCCCCTACAGCCTGCAGAAGG - Intronic
1119851034 14:77866910-77866932 CTGTGCCTGCAGCCCCCGCAGGG + Intronic
1121465096 14:94110845-94110867 CTGAGCCCACAGCCCACCCAAGG - Intronic
1121999234 14:98632890-98632912 TTGAACATGCAGCCTGCGCATGG - Intergenic
1124247034 15:28079769-28079791 CTGACCCCACAGCCTGCGCAGGG - Intronic
1124345742 15:28920355-28920377 CTGGGCCTAGACCCTGCCCATGG - Intronic
1129236726 15:74228179-74228201 CTGCGCCTTCAGCCTCCACAAGG - Intergenic
1132668096 16:1090999-1091021 CTGGGCCCACAGCCTGCCCCAGG - Intronic
1132778440 16:1610192-1610214 CAGAGCCTTCGGCCTGCGCAGGG + Intronic
1132780823 16:1624279-1624301 CTGAGCCTCTAGCCTGCGTGTGG + Intronic
1132841428 16:1980100-1980122 CTGAGCCTCCAGACTGTGGATGG + Exonic
1133931910 16:10239599-10239621 CTGAGCCTCCAGCCTGCGGATGG - Intergenic
1135676464 16:24419028-24419050 ATTAGCCAACAGCCTGCCCAAGG + Intergenic
1136626045 16:31462755-31462777 CAGAGCCTGCAGCCGGCCCAGGG - Exonic
1137028584 16:35501573-35501595 CTGCTCCTGCAGCCTGCACAGGG - Intergenic
1137497213 16:48979764-48979786 CTGAGGCTACAGTATGCTCAAGG + Intergenic
1137591786 16:49698293-49698315 CTGAGTGTGCAGCCTGCTCACGG + Intronic
1137676981 16:50308618-50308640 CAGAGCCAACAGCCTGGGCAAGG - Intronic
1138347410 16:56328486-56328508 CTCAGCCCACAGCCTGCTCCAGG - Intronic
1139437366 16:66943903-66943925 CTGAACCTACAGCCTGCGGTGGG + Exonic
1139594902 16:67951772-67951794 TTGAGCCCACAGGCTGAGCAGGG - Intronic
1142127078 16:88415504-88415526 CTGAGCCCCCAGCCTGGGAATGG + Intergenic
1142283573 16:89161589-89161611 CTGAGCCTGCAGCCTGTGTTTGG - Intergenic
1143965603 17:10754699-10754721 CTGAGCCCAGAGCCAGCACATGG + Intergenic
1144017010 17:11205843-11205865 ATTAGCCAACAGCCTGCCCAAGG - Intergenic
1144177165 17:12718405-12718427 CTGAGGGAACAGCCTGCACAAGG + Intronic
1144759913 17:17701310-17701332 CTGAGCCTTCTGCCTAGGCAGGG + Intronic
1145915848 17:28573674-28573696 CAGAGGCTATAGCCTGGGCAGGG - Intronic
1147382806 17:40065640-40065662 CTGACCCCAGAGGCTGCGCAGGG - Intronic
1149517281 17:57290231-57290253 CTGAGCCTATAGCCTGGCCAGGG + Intronic
1151405364 17:73882570-73882592 CAGAGCCTCCAGCCTCAGCAGGG - Intergenic
1151659547 17:75511691-75511713 CTGAGCCTACAGCCTGCGCAGGG + Intronic
1151941798 17:77297139-77297161 CTGGGCCTCCAGCTTGCGGACGG - Intronic
1155114546 18:22751745-22751767 CTGAGACTGCATCCTGCCCAGGG + Intergenic
1157805463 18:50654692-50654714 CTCAGCCTTCAGCCTGGGCAGGG + Intronic
1161058691 19:2203418-2203440 TTGAGCCTACAGCTTGCTTATGG + Intronic
1162727027 19:12696029-12696051 CTTAGCCTCCAGCCTGAGCCAGG + Intronic
1163144485 19:15371370-15371392 ATGAGCCTCCAGCCTGTGCTTGG + Intronic
1167188368 19:47964468-47964490 CTGATCCTGCAGGCTGAGCAAGG + Intergenic
1168217847 19:54939554-54939576 CTGAGCCTCCTGGCCGCGCAGGG - Exonic
1168224271 19:54983046-54983068 CTGAGCCTCCTGGCCGCGCAGGG + Exonic
927457164 2:23262952-23262974 CTGAGCCTCCAGCTTGCAAAAGG + Intergenic
928211715 2:29328556-29328578 CTGTCCCTGCAGCCTGCCCATGG - Intronic
931638866 2:64363945-64363967 CTGAGGCTGCAGCCAGGGCAGGG - Intergenic
932451391 2:71812937-71812959 CTGGGCCCACAGCCTGCCAAAGG - Intergenic
932470238 2:71950399-71950421 CTGAGCCTGGAGCCTGAGGAGGG - Intergenic
938379634 2:130829282-130829304 CTGAGCCTGGAGGCTGAGCAGGG + Intergenic
940241650 2:151569752-151569774 CTGTGCCTACATCCTGTCCATGG + Intronic
940250554 2:151671047-151671069 CTGAGCCAACACCATGCCCATGG + Exonic
944383794 2:199141688-199141710 CTGAGCCTAGGGCCTCAGCAGGG - Intergenic
947102020 2:226631033-226631055 CTGAGCCCACACCCTGGGCATGG + Intergenic
948403540 2:237701534-237701556 CTGAGCCCCCAGCCTGAGCCGGG + Intronic
1169045349 20:2530535-2530557 CTGAGTGTGCAGCCTGCGCGTGG + Intergenic
1169501447 20:6164580-6164602 CTGAGCCTGCAGCCTGCAGCTGG + Intergenic
1172315236 20:33948858-33948880 ATGAGCCTGCAGTCTGGGCAGGG - Intergenic
1174518625 20:51112931-51112953 CTGAACCATCAGCCTGTGCAAGG + Intergenic
1175385757 20:58594038-58594060 CTGAGCCAGCAGCCTGGGCATGG - Intergenic
1175830445 20:61962443-61962465 CTGGTCCTACAGCCTGTGAATGG - Intronic
1176212748 20:63932970-63932992 CTGAGCCCTCAGCCAGCACAGGG - Exonic
1178915821 21:36705122-36705144 CTGAGCCTACCGCCCTTGCAGGG + Intronic
1180316966 22:11284338-11284360 GTGGGCCTATAGCCTGGGCAAGG - Intergenic
1180799444 22:18624946-18624968 CTGAGCCCTCAGCATGCACAGGG + Intergenic
1180864623 22:19109939-19109961 CTGAGCCTACAGCCCAGCCATGG + Intronic
1181222274 22:21370320-21370342 CTGAGCCCTCAGCATGCACAGGG - Intergenic
1181481695 22:23203988-23204010 CTGAACCCACTGCCTGCACAGGG - Intronic
1181553309 22:23653245-23653267 CAGAGCCTACAGCCGGGGCATGG - Intergenic
1181638033 22:24183313-24183335 CTGAGCCCTCAGCATGCACAGGG - Intronic
1182357197 22:29727565-29727587 CCGACCCTGCAGCCTGAGCATGG - Intronic
1183919459 22:41153137-41153159 CTGACCCTACTGCCTGGGCCAGG + Intronic
1184173555 22:42773102-42773124 CTGAGCCTAGACCCTGAGCCTGG + Intergenic
950446590 3:13042299-13042321 CTGTGCCTACAGCCCCTGCATGG - Intronic
952897036 3:38084687-38084709 CTGAGTCTACAGCCTGGGCCTGG + Intronic
953768904 3:45763911-45763933 CATAGCCTTCAGCCAGCGCATGG - Intronic
954464281 3:50645631-50645653 AGGAGCCTAAAGCCTGGGCAAGG - Intronic
961314367 3:126024480-126024502 CTCAGCCAACACCCTGAGCAGGG + Intronic
965728648 3:171746289-171746311 CTCAGCCTGCAGCCTGGGCACGG + Intronic
967564432 3:190957445-190957467 CTGTGCCTACAGCTTGAGAAAGG + Intergenic
968745435 4:2357439-2357461 CTGAGCTCGCAGCCTGCCCAAGG + Intronic
970576238 4:17430956-17430978 CTGGGATTACAGCCTGAGCAAGG + Intergenic
971254619 4:25002770-25002792 CTGGGCCTACAGCCTGTGCTGGG + Exonic
972311946 4:37890689-37890711 CTGTGCCCAGATCCTGCGCAGGG + Intergenic
973996463 4:56464117-56464139 CTGGGCCTTCAGCCTGCAGAAGG + Intergenic
976013682 4:80523744-80523766 CTGGGCCTACAGCTTGCAGATGG + Intronic
977300856 4:95265806-95265828 GGGAGCTTATAGCCTGCGCAAGG - Intronic
979473258 4:121125636-121125658 CAGAGCCTTCACCCTGGGCATGG - Intergenic
991999103 5:72417974-72417996 CTGCGCCTGCAGCCGGCGCGTGG - Intergenic
992406041 5:76458895-76458917 CAGAGCATGCAGCCTGTGCAGGG + Intronic
993824060 5:92659363-92659385 CTGAGCCTAAAACTTGCTCAAGG - Intergenic
998397722 5:141829774-141829796 CTGAGCTTCCAGTCTGCACAGGG - Intergenic
998726175 5:145017256-145017278 CTGAGCCTTCAGCCAGCCCCAGG + Intergenic
1000343928 5:160298526-160298548 CTGGGCCTACAGTCTGGGGAGGG + Intronic
1001023781 5:168206314-168206336 CTGAGGCTGCAGCCTCCTCAGGG - Intronic
1002107025 5:176884666-176884688 CTCAGCCTTCATCCTGCCCAGGG - Intronic
1002607091 5:180389908-180389930 GTGGGCCTGCAGCTTGCGCAAGG + Intergenic
1004114196 6:12750092-12750114 CCGCGCCCGCAGCCTGCGCATGG - Intronic
1007902034 6:45421998-45422020 CTGAGCGTGCAGCCCGCGCGGGG + Intronic
1009351002 6:62678521-62678543 CTGAGTCTGCAACCTGGGCATGG + Intergenic
1011945158 6:92891066-92891088 CAGAGGCTAGAGCCTGCCCAGGG + Intergenic
1016728360 6:147401087-147401109 CTGAAGCAACAGCCTGAGCAGGG + Intergenic
1017770231 6:157638912-157638934 CAGCGCCCACAGCCTGAGCAAGG + Intronic
1019286913 7:228258-228280 CTGAGCCAAGACCCTGCCCAGGG - Exonic
1019605243 7:1906940-1906962 CTGAACATACAGCCTTCCCATGG + Intronic
1020148204 7:5661350-5661372 CTAAGCCTACAAGCTGGGCATGG - Intronic
1023843934 7:44110817-44110839 CAGAGCCAAGAGCCTGGGCATGG - Intronic
1024676831 7:51644970-51644992 CTGGGACTGCAGCCTGCTCAAGG + Intergenic
1032279953 7:130492193-130492215 CGCAGCCCACAGCCCGCGCAGGG - Exonic
1033616671 7:143023139-143023161 CTGAGCCCACAGGCTTCACATGG - Intergenic
1034355959 7:150450951-150450973 CTGAGCCTGTGGCCTGCACAGGG + Exonic
1039465700 8:37783863-37783885 CTGAAACTAGAGCCTGAGCAAGG + Intergenic
1039547606 8:38421141-38421163 AGGAGCCTGCAGCCTGCTCAGGG - Intronic
1045111115 8:98940299-98940321 CGGAGCCCAGAGCCGGCGCAAGG - Intronic
1046100425 8:109608061-109608083 CTGAGCCTTCTGCATGTGCAGGG + Intronic
1049238622 8:141525333-141525355 CTGAGCCCACCGCCTGCCCCTGG - Intergenic
1049672000 8:143874034-143874056 CTGAGCCCACACCCTGCCCCGGG + Intronic
1050961402 9:11738029-11738051 CTGAGCCTCCAGCTTGCAGAAGG - Intergenic
1051135180 9:13912102-13912124 CTGGGCCTCCAGCCTGCTGACGG - Intergenic
1055408889 9:76005976-76005998 CTGAGACTACAGCCTCCCAAGGG + Intronic
1055717308 9:79132103-79132125 CTGTCCCTGCAGACTGCGCATGG - Intergenic
1060497697 9:124130352-124130374 CAGAGCCCAGAGCCTGCCCAGGG + Intergenic
1061232305 9:129321911-129321933 CAGAGGCCACAGCCTGGGCAAGG - Intergenic
1061820294 9:133223592-133223614 CAGAGCCTACACCCTCCCCAGGG - Intergenic
1062095711 9:134702086-134702108 CTGGGGCGACAGCCTGCACAGGG + Intronic
1062428742 9:136517618-136517640 CTGGGCCCACAGCCTGCACAGGG - Intronic
1062444223 9:136586988-136587010 CTGAGCCTCCAGCCATCGCCAGG + Intergenic
1186047057 X:5547990-5548012 CTGAGCCACCAGCCTTCTCAGGG + Intergenic
1195086297 X:101417541-101417563 CTGTGCCTGCAGCCTGTGAATGG + Intergenic
1195678029 X:107522387-107522409 CTGAGCATACAGGCTGGGCTAGG + Intergenic
1197810268 X:130435083-130435105 CTGAGCCTACAACCCACTCAAGG - Intergenic
1199868484 X:151875482-151875504 CTCAGCCCACAACCTGGGCAAGG + Intergenic
1199963800 X:152801270-152801292 CTGAAATTACAGGCTGCGCAGGG + Intergenic
1200684168 Y:6245200-6245222 CAGAGCCTCCAGCCTGAACACGG + Intergenic
1200831350 Y:7690572-7690594 CAGAGCCTCCAGCCTGAACATGG - Intergenic
1201048467 Y:9909186-9909208 CAGAGCCTCCAGCCTGAACACGG - Intergenic
1201063782 Y:10070192-10070214 CAGAGCCTCCAGCCTGAACATGG - Intergenic