ID: 1151660581

View in Genome Browser
Species Human (GRCh38)
Location 17:75516176-75516198
Sequence GGCTGGGCAAGGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1217
Summary {0: 1, 1: 0, 2: 5, 3: 127, 4: 1084}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151660581_1151660599 19 Left 1151660581 17:75516176-75516198 CCTTCTGCCCTCCTTGCCCAGCC 0: 1
1: 0
2: 5
3: 127
4: 1084
Right 1151660599 17:75516218-75516240 AGCGCGAGGCTGCAGAGGGGCGG 0: 1
1: 0
2: 0
3: 20
4: 293
1151660581_1151660596 14 Left 1151660581 17:75516176-75516198 CCTTCTGCCCTCCTTGCCCAGCC 0: 1
1: 0
2: 5
3: 127
4: 1084
Right 1151660596 17:75516213-75516235 TAAGCAGCGCGAGGCTGCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1151660581_1151660598 16 Left 1151660581 17:75516176-75516198 CCTTCTGCCCTCCTTGCCCAGCC 0: 1
1: 0
2: 5
3: 127
4: 1084
Right 1151660598 17:75516215-75516237 AGCAGCGCGAGGCTGCAGAGGGG 0: 1
1: 0
2: 4
3: 32
4: 337
1151660581_1151660597 15 Left 1151660581 17:75516176-75516198 CCTTCTGCCCTCCTTGCCCAGCC 0: 1
1: 0
2: 5
3: 127
4: 1084
Right 1151660597 17:75516214-75516236 AAGCAGCGCGAGGCTGCAGAGGG 0: 1
1: 0
2: 1
3: 14
4: 152
1151660581_1151660595 5 Left 1151660581 17:75516176-75516198 CCTTCTGCCCTCCTTGCCCAGCC 0: 1
1: 0
2: 5
3: 127
4: 1084
Right 1151660595 17:75516204-75516226 GGTGGGGACTAAGCAGCGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151660581 Original CRISPR GGCTGGGCAAGGAGGGCAGA AGG (reversed) Intronic
900145246 1:1156387-1156409 GGCTGGGCTGGGAGGCCATAGGG + Intergenic
900204726 1:1427083-1427105 GGCTGAGCAGGGCGGGAAGAGGG - Intronic
900490991 1:2949080-2949102 GGCTGGCCCTGGAGGGCAGCTGG - Intergenic
900585140 1:3429011-3429033 GGATGGCCAAGGAGGGCCAAGGG + Intronic
901202335 1:7473735-7473757 AGCTGGGCCAGGAGGGCTCACGG - Intronic
901279584 1:8023516-8023538 GGGAGGCCAAGGCGGGCAGATGG - Intronic
901480195 1:9519824-9519846 GGCTGGGGAAGGAGAGCGGCCGG + Intergenic
901498839 1:9639004-9639026 GGGAGGACAAGGTGGGCAGATGG - Intergenic
901538900 1:9901956-9901978 GGCTGGGTAGAGAGGGCAAAGGG - Intronic
901904002 1:12392250-12392272 GGGAGGCCAAGGCGGGCAGATGG + Intronic
902232391 1:15036286-15036308 AGCTGGGCGGGCAGGGCAGAGGG - Intronic
902275994 1:15339764-15339786 GGTTGGCCCAGGAGGCCAGAGGG - Intronic
902343646 1:15800392-15800414 GGCAGGGCAGGGAGAGGAGATGG - Intergenic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902564981 1:17305521-17305543 AGCTGGGCAGGGAAGGCTGAGGG - Intergenic
902641402 1:17768604-17768626 GGCTGGGCTCAGAGTGCAGAGGG + Intronic
902662233 1:17913263-17913285 GGGTGAGAAAGGAGGGCAGTAGG - Intergenic
902690471 1:18107689-18107711 GGGAGGGCAAGGAGGGCGGGGGG + Intergenic
902738565 1:18418079-18418101 GGCTGGGAAAGGATTGCAGGTGG - Intergenic
902914800 1:19630655-19630677 AGCTAGGCTAGGAGGGGAGAAGG + Intronic
903018898 1:20379891-20379913 GGGTGGGGAAAGAGGGCAGGTGG - Intergenic
903026172 1:20431070-20431092 GGCTGGGCAGGGAGGGAGAAGGG - Intergenic
903172996 1:21565149-21565171 GGCAGTGCATGGAGGGCTGAAGG - Intronic
903185260 1:21625184-21625206 GCCTAGGCTGGGAGGGCAGATGG - Intronic
903205619 1:21780385-21780407 GGCTGGGCGAGGGGGGAAAATGG + Intronic
903320355 1:22539293-22539315 GGGTGGGAAAGGCTGGCAGAGGG - Intergenic
903474115 1:23607629-23607651 AGATGGGGAAAGAGGGCAGAAGG - Intronic
903611048 1:24613043-24613065 GGCTGGGGAGAGAGGGCAGTGGG - Intergenic
903669950 1:25029460-25029482 GGCTGGGCAAGATGGGCACCAGG - Intergenic
903799074 1:25953232-25953254 GTCTGGGGAACGAGGGCTGATGG + Intergenic
903878898 1:26495254-26495276 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
904137887 1:28328212-28328234 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
904600773 1:31671504-31671526 GGCTGGGCAAGGCAGGAGGAGGG - Intronic
904699258 1:32348606-32348628 GGCTGGGCTGGGAGGGAAGATGG - Intergenic
904817541 1:33216841-33216863 GGCTGGGCAAGGGCTGCAAATGG + Intergenic
904826336 1:33276139-33276161 GGCTGGGCATGGTGGGAGGAGGG - Exonic
905170955 1:36109226-36109248 GGGTGAGCAAGCAGGGCAGCCGG - Intronic
905322327 1:37126938-37126960 GGCTGGGGAAGGAGGACATGAGG - Intergenic
905380340 1:37557275-37557297 GGATGGGGAAGGAGGTCACAGGG + Intronic
905584386 1:39105472-39105494 GGCCGGGCGAGGCGGGCGGACGG + Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905786895 1:40765595-40765617 GGCTGGGCAGCCAGGGCAGGTGG + Intronic
905864464 1:41369138-41369160 GCCTGGACAAGGTGGGCTGAGGG - Intronic
905878236 1:41447188-41447210 TTCTGGGGAAGGAGAGCAGAAGG - Intergenic
905936463 1:41827923-41827945 GGCAGGGAAGGGAGGGAAGAGGG + Intronic
906318057 1:44800663-44800685 TGTTGGGCAAGGTGGGCCGAGGG + Exonic
906650500 1:47509219-47509241 GGGAGGGCGGGGAGGGCAGAAGG - Intergenic
906684964 1:47757374-47757396 GGCTGGGCTTGGAGGGGAGGAGG - Intergenic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907326021 1:53638957-53638979 GGCAGGGAGTGGAGGGCAGAAGG + Intronic
907439488 1:54470264-54470286 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
907449558 1:54535478-54535500 GGGAGGCCAAGGAGGGCAGATGG + Intergenic
907459014 1:54594216-54594238 GGTGGGGAAAGGAGGGGAGAGGG - Intronic
907481008 1:54745508-54745530 GGCAGGGCCAGGAGGGCAAAGGG + Intergenic
907495732 1:54843097-54843119 CCCTGGGGAAGGAGGGCACAGGG - Intergenic
907872613 1:58456543-58456565 GGCTGAGTGAGGACGGCAGAAGG + Intronic
908089214 1:60668919-60668941 TGCTTGGCAGGGAAGGCAGATGG - Intergenic
908193638 1:61728001-61728023 GGAAGGCCAAGGAAGGCAGATGG + Intergenic
908300443 1:62756944-62756966 AGCTGCTCAAGGAAGGCAGAAGG - Intergenic
909893800 1:81039901-81039923 GGATGGAAAAGAAGGGCAGAAGG + Intergenic
910526708 1:88187140-88187162 GGCTGAAGAAGGAGGTCAGAAGG - Intergenic
911029534 1:93471450-93471472 GGGAGGCCAAGGTGGGCAGATGG + Intronic
911053956 1:93695139-93695161 GGGTGGGCAGGGAAGGAAGAAGG - Intronic
911129740 1:94376137-94376159 AGCTGCTCAAGGAAGGCAGAAGG + Intergenic
911298996 1:96150592-96150614 AGCTGCTCAAGGAAGGCAGAAGG - Intergenic
912320792 1:108711022-108711044 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
912369754 1:109164780-109164802 GGCTGGGCAGGGAGGATGGAGGG + Intronic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912866967 1:113266474-113266496 GGCTGGGCAAGGGGATCTGAGGG - Intergenic
913006373 1:114636424-114636446 GGGAGGCCAAGGAGGACAGATGG + Intronic
913206406 1:116543225-116543247 GGCTGAGTAGGGAGGGCAGCAGG + Intronic
913252075 1:116920017-116920039 GGCTGGGCCAAGAGGCCACATGG - Intronic
913275985 1:117138168-117138190 GGATGGGAAGGGAGGGCACATGG - Intergenic
913491179 1:119381369-119381391 GGCAGGGGAGGGAGGGCTGATGG + Intronic
913958770 1:143323765-143323787 GGCTGCGCTAGGAGGGCAGGCGG - Intergenic
913971818 1:143422398-143422420 GGCAGGGGAAGGACGGCAGTGGG - Intergenic
914053087 1:144149145-144149167 GGCTGCGCTAGGAGGGCAGGCGG - Intergenic
914066197 1:144248011-144248033 GGCAGGGGAAGGACGGCAGTGGG - Intergenic
914112956 1:144718343-144718365 GGCAGGGGAAGGACGGCAGTGGG + Intergenic
914126110 1:144817396-144817418 GGCTGCGCTAGGAGGGCAGGCGG + Intergenic
914716099 1:150256574-150256596 GCAGGAGCAAGGAGGGCAGAGGG + Intergenic
914758908 1:150583056-150583078 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
914938872 1:152004397-152004419 GGCAGTGAAAGGAGGCCAGAAGG + Intergenic
914941036 1:152023289-152023311 GGCAGGGAACGGAGGGCAGATGG - Intergenic
915213395 1:154325740-154325762 CGCGGGGCCAGGAGGGCAGAGGG + Intronic
915262070 1:154684160-154684182 GGATGAGGAAGGAGGGCAGAAGG + Intergenic
915304159 1:154968473-154968495 GGTTGGTGAAGGTGGGCAGACGG - Exonic
915490439 1:156247423-156247445 GGCTGGGCCAGCTGGGCAGGCGG + Intronic
915507203 1:156365458-156365480 GGCTGAGCAGGAAGGGCAAATGG - Intronic
915592486 1:156878673-156878695 GGCTGGACACTGAGGGCAGAGGG + Intronic
915731642 1:158058402-158058424 GGCAGGGCAGGGAGGGAGGAGGG - Intronic
915843884 1:159241497-159241519 GGCTGGGAAATGAGGGAAAAGGG - Intergenic
915948764 1:160173746-160173768 GGCTGGGGATGGAGGGAACATGG - Intronic
916080576 1:161229482-161229504 GGCTGGGAAAGTAGGGCTGAAGG + Exonic
916083703 1:161253095-161253117 AGCTGCTCAAGGAAGGCAGAAGG - Intergenic
916501194 1:165388632-165388654 CGATGGGGAAGGAGGGCAGGAGG + Intergenic
916764705 1:167849009-167849031 GGTTGGGCAGGGTTGGCAGAGGG - Intronic
917788994 1:178487465-178487487 GGCTGGGTGAGGACTGCAGATGG - Intergenic
918209370 1:182337466-182337488 GGGAGGCCAAGGGGGGCAGATGG + Intergenic
918276269 1:182956123-182956145 AGCAGGGCAGGGAGTGCAGAAGG + Intergenic
919423826 1:197405558-197405580 GACTGGGCAAGCCAGGCAGAGGG - Intronic
919944126 1:202307455-202307477 GGCTGGCCAATGGAGGCAGAAGG + Intronic
919990900 1:202708400-202708422 GGCAAGACAAGGAGGGGAGAAGG + Intronic
920065560 1:203266903-203266925 GGGAGGCCAAGGCGGGCAGATGG - Intronic
920073290 1:203318902-203318924 GGTAGGGCAGGGAGGGCAGGAGG - Intergenic
920259396 1:204678690-204678712 GTCGGGGCAAGCTGGGCAGAGGG - Intronic
920397966 1:205660273-205660295 GGCTGGGGGAGGTGGGAAGAGGG - Intronic
920434662 1:205940101-205940123 GGGTGAGCCAGGAGAGCAGAGGG + Intronic
920580631 1:207104228-207104250 GGCTGGTCAAGGACGGTTGATGG - Intergenic
920674443 1:208029497-208029519 GGCTGGGCGGGGAGCGCAGGTGG - Intronic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
920721234 1:208388896-208388918 AGCTGGGGAAGGAGAGAAGATGG + Intergenic
920724673 1:208422981-208423003 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
920735193 1:208527167-208527189 GGCCGGGGGAGGGGGGCAGAAGG - Intergenic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
921024771 1:211267830-211267852 GGGAGGCCAAGGAGGGCGGATGG - Intronic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921637454 1:217513048-217513070 GGGAGGCCAAGGTGGGCAGAAGG + Intronic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922880574 1:228977438-228977460 GGCTGGGGGAGGAGAGGAGAAGG + Intergenic
923042129 1:230326994-230327016 AGCGGGGCAAGGAGGGCTCATGG - Intronic
923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG + Intronic
924379225 1:243446503-243446525 GGGAGGCCAAGGTGGGCAGATGG - Intronic
924455517 1:244216096-244216118 GCCTAGGCAAGGTTGGCAGAAGG + Intergenic
1062973560 10:1666287-1666309 GGCGGGGCAGGCAGGGCAGGTGG - Intronic
1063122559 10:3115029-3115051 TGGAGGGCACGGAGGGCAGATGG + Intronic
1063415638 10:5870623-5870645 GGGAGGCCAAGGCGGGCAGATGG - Intronic
1063455957 10:6182823-6182845 GGCCAGGGCAGGAGGGCAGAGGG + Intronic
1065682077 10:28246602-28246624 GGCTGGGCAATCATAGCAGAAGG + Intronic
1065716064 10:28569662-28569684 GGCTGGGCAAGGAGGTTGGTGGG + Intronic
1065952201 10:30662526-30662548 GCCAGAGCAAGCAGGGCAGAGGG - Intergenic
1065993272 10:31032528-31032550 GCCAGGGCAAGAAGGGCAGGTGG - Intergenic
1066421933 10:35271755-35271777 GGGTTGCCAAGGGGGGCAGAGGG - Intronic
1066647830 10:37627844-37627866 GGTTGGGGAAGGAGAGCATAAGG + Intergenic
1066658215 10:37713842-37713864 GGCTGGGGAGGGAGGGAAGTGGG - Intergenic
1066962720 10:42235914-42235936 GGCCGCGCTAGGAGGGCAGGCGG - Intergenic
1067228541 10:44390931-44390953 GGCTAGGAAAGGGAGGCAGAAGG - Intergenic
1067278649 10:44855137-44855159 GGCTGGAAGAGGAGTGCAGAGGG + Intergenic
1067346075 10:45440057-45440079 AGCAGGGCAAGGAGGGAAGAGGG + Intronic
1068192316 10:53667698-53667720 GCCTGGGCATGGAGTGCTGAGGG - Intergenic
1069855838 10:71440598-71440620 GGCCAGGAAAGGAGGGCAGAGGG - Intronic
1069858219 10:71453440-71453462 GGGAGGCCAGGGAGGGCAGATGG + Intronic
1069961469 10:72081634-72081656 GGATAGGCACGGAGGGCTGAAGG + Intronic
1070144757 10:73765686-73765708 AGCTGGGGAAGTAGGGCACATGG + Intronic
1070365204 10:75730033-75730055 GGCTGAGCAAGGCGGGGAGGTGG - Intronic
1070565694 10:77602392-77602414 GGCTGGGGAAGGAGGGGTGTGGG + Intronic
1070587472 10:77777445-77777467 GGCTGGGGAAGGAGGGCTGGTGG - Intergenic
1070646571 10:78205971-78205993 AGCTGGGCAGGGAGAGGAGATGG - Intergenic
1070751017 10:78963980-78964002 GGCAGGGCAGGGTGGCCAGACGG - Intergenic
1070961879 10:80505233-80505255 GGCTGGGCAAGGAGGCCCAGAGG - Intronic
1071305987 10:84299139-84299161 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
1071921458 10:90355525-90355547 GGCTGGCAAAGAAGGGAAGATGG + Intergenic
1072214530 10:93276965-93276987 GGGGGGCCAAGGTGGGCAGATGG + Intergenic
1072231279 10:93416005-93416027 TGGTGGACTAGGAGGGCAGAGGG - Intronic
1072757592 10:98030942-98030964 GGCCTGGCGAGGAGGGGAGAGGG + Intergenic
1072939517 10:99747758-99747780 GGGAGGGCAAGGAAGGCAGATGG - Intronic
1073185334 10:101612307-101612329 TGCTGGGCAGGGAGGACAGGTGG - Intronic
1073328785 10:102657573-102657595 GCCTGGGCCAGGACGGCAGGTGG + Exonic
1073357791 10:102870719-102870741 GGCTGGGCAGGCAGTGCTGATGG - Intronic
1073364032 10:102922699-102922721 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1073463812 10:103682115-103682137 AGCTGTGCAAGCAGGGCTGAGGG + Intronic
1073585395 10:104704999-104705021 GGTTGGGAAATGAGGGAAGAGGG - Intronic
1074546472 10:114404998-114405020 GGAGGGGCGAGGAGGGCAGCGGG + Intergenic
1075392267 10:122100883-122100905 GGAGGGGCAAGGCAGGCAGAGGG - Intronic
1075502569 10:122989189-122989211 GGGTGGGCGGGGTGGGCAGAAGG + Intronic
1075629852 10:123994414-123994436 GGAAGGACTAGGAGGGCAGAAGG + Intergenic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1076165722 10:128281044-128281066 GGCAGAGAGAGGAGGGCAGATGG + Intergenic
1076460989 10:130647364-130647386 CCCTGGGCAGCGAGGGCAGAGGG - Intergenic
1076504142 10:130960786-130960808 GGCTGGGTATTGGGGGCAGATGG + Intergenic
1076546048 10:131246335-131246357 TGCTGAGCAAGGAGAGAAGAGGG + Intronic
1076619518 10:131778344-131778366 GGGTGGGCAGGGAGGAGAGATGG + Intergenic
1076637535 10:131892041-131892063 GGCTGGGCTTGGAGGGAAGCTGG + Intergenic
1076804805 10:132850013-132850035 GAGTAGGCAAGGAGGGCAGGCGG - Intronic
1076828308 10:132981518-132981540 GGCATGGCAAGGCGGGCAGTCGG + Intergenic
1076888877 10:133274473-133274495 GGCGGGGGGCGGAGGGCAGAGGG + Intronic
1076891858 10:133288615-133288637 CCCTGGGCAAGGAGGGGAGCTGG + Intronic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1076990832 11:272694-272716 GTCTGGGCAATGAGGGGAAAGGG - Intergenic
1077096286 11:800468-800490 GGCTGAGCAAGGAGGGCTCGGGG + Intronic
1077251924 11:1564555-1564577 GGGTGGGGGAGGAGGGCAGGAGG - Intronic
1077308866 11:1879744-1879766 GGCTGGGAGAGGGGGACAGAGGG + Intronic
1077372905 11:2192025-2192047 GTCTGGGGAAGGAGGGAAGGAGG + Intergenic
1077444884 11:2586306-2586328 GGCTGAGCCAGGAGTGCAGGAGG - Intronic
1077517294 11:3009681-3009703 GGCCTGGCAAGGAGGGCAATGGG - Intronic
1077905203 11:6527320-6527342 GGCTGGGGGAGGAGGGCAGGTGG + Intronic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1078186453 11:9055732-9055754 GGCTGGGCCTGGAGGGGAGCAGG - Intronic
1078233919 11:9466678-9466700 GGGAGGCCAAGGAGGGAAGACGG - Intronic
1078248776 11:9600274-9600296 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1078438616 11:11345650-11345672 TGCTGGGGAAGCAGGGCAGCTGG + Intronic
1078578492 11:12520708-12520730 GGGAGGCCAAGGTGGGCAGACGG + Intronic
1078638662 11:13075717-13075739 GGAGGGGAAATGAGGGCAGAGGG - Intergenic
1080600884 11:33819811-33819833 GGCTGAGGAAGGAGGGCACAAGG - Intergenic
1080608995 11:33887811-33887833 GGGAGGCCAAGGCGGGCAGATGG - Intronic
1080652596 11:34234494-34234516 GGCTGGGCAAGGGAGGCACCAGG + Intronic
1080741831 11:35072417-35072439 GGGAGGCCAAGGTGGGCAGAAGG + Intergenic
1080879011 11:36301664-36301686 TGCTGGGAGAGGAGAGCAGAGGG + Intronic
1081711976 11:45223074-45223096 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1081857055 11:46310603-46310625 GGCTGGGCAAGCAGGAGCGATGG - Intronic
1081937841 11:46917583-46917605 GGCTGGGGTAGGGGGGCAGGGGG - Intronic
1082740217 11:56902558-56902580 GGATGGGGAAGGAGAGGAGAGGG - Intergenic
1082948702 11:58788197-58788219 GCCTGGGCAAGGAGTGGAGAGGG - Intergenic
1083001851 11:59299507-59299529 GGCTTAGCTTGGAGGGCAGATGG - Intergenic
1083294710 11:61709039-61709061 GCCTGAGCCAGGAGGGCAAAAGG - Intronic
1083640386 11:64142133-64142155 GGCTGGGCTAGGCAGGAAGAGGG + Intronic
1083765108 11:64837981-64838003 GCCCTGGGAAGGAGGGCAGAAGG - Intronic
1083792475 11:64994775-64994797 GGGAGGGCAAGCAGGGAAGATGG + Intronic
1083856720 11:65396658-65396680 GGCTGGGTAAGGAGCCCACAAGG - Intronic
1083935954 11:65870249-65870271 GGCAGGAGAAGGAGGGCGGAGGG + Intronic
1084003747 11:66312775-66312797 GGCGGGGCCAAGAGGGCAGGGGG + Intergenic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1084091678 11:66882916-66882938 TTCTGGGCAGGGGGGGCAGAAGG + Intronic
1084215541 11:67645239-67645261 GGCGGGGCCAGGAGGGCTGGAGG - Intronic
1084238197 11:67801640-67801662 CACTTGGAAAGGAGGGCAGAGGG + Intergenic
1084557892 11:69885720-69885742 GGCTGAGGGGGGAGGGCAGAAGG + Intergenic
1084834213 11:71791194-71791216 CACTTGGAAAGGAGGGCAGAGGG - Intronic
1085045193 11:73348615-73348637 GGCTGGGAAAGGAGGGAATGGGG + Intronic
1085342746 11:75744036-75744058 GGATGGGCAAGTAGGGCCCAGGG - Intergenic
1085520918 11:77138423-77138445 GCCCGGGCCAGGAGGGGAGAAGG + Intronic
1085527049 11:77170368-77170390 GGCAGGGCAAGGAGGCTGGAGGG + Intronic
1086405749 11:86497777-86497799 GGGTGGGCAACCAGGGAAGAAGG + Intronic
1087138251 11:94741084-94741106 GGCTGGGGTTGGAGGGCGGAGGG + Intronic
1087634431 11:100687110-100687132 GGGTGGGGCAGGAGGGCAAAGGG + Intergenic
1087665819 11:101046390-101046412 GGGAGGGCAAGCTGGGCAGATGG - Intronic
1088311754 11:108467554-108467576 GGCGGGGCTAGGAGGGCAATGGG - Intergenic
1088605221 11:111523621-111523643 GGCTGGGGAGGTATGGCAGAAGG - Intronic
1088626142 11:111732038-111732060 GGGTGGGGAAGGAGAGCAGCAGG + Intronic
1088823100 11:113473513-113473535 GGCTGTGCAGGGAAGGTAGAAGG + Intronic
1089177730 11:116560504-116560526 GGCTGGGAAGGGGGTGCAGAGGG + Intergenic
1089720593 11:120416581-120416603 GGATGGGTAAGGAAGACAGAAGG - Intronic
1089964898 11:122647859-122647881 GGAAGGGCTAGGAGGGTAGAGGG - Intergenic
1090029582 11:123195408-123195430 GGCCGGGCAGGGAGGGCCGGGGG + Intergenic
1090238224 11:125164915-125164937 GACAGGGCAAGGAGGAGAGAGGG + Intronic
1090423739 11:126592957-126592979 GGCTGGGGTGGGAGGGCTGAGGG + Intronic
1090627294 11:128618159-128618181 GGCTGGGGGAGGCGGGGAGAGGG + Intergenic
1090632563 11:128662961-128662983 GGTTAGGGAGGGAGGGCAGAAGG - Intergenic
1090747665 11:129720307-129720329 GGCTGGGCCTGCAGGGCTGAGGG - Intergenic
1090817943 11:130314936-130314958 GGCTGGGGAAGGGGAGGAGAAGG + Intergenic
1090873234 11:130766443-130766465 TGCTGGGCCAGGAGGACACAGGG + Intergenic
1091445334 12:541804-541826 GGCAGGGAGAGGAGGGCCGAGGG - Intronic
1091804193 12:3344089-3344111 GGCTGGGCAGGGTGGGCCGGCGG + Intergenic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1091840629 12:3617908-3617930 GGCTGGGTGAAAAGGGCAGAGGG - Intronic
1091980136 12:4858056-4858078 GGCTTGGCAGGGAGGGGGGATGG + Intergenic
1092016234 12:5161169-5161191 GGCTGGGGAAGGACTCCAGATGG - Intergenic
1092193222 12:6534718-6534740 GGCTGGGCATGGAGGCCTGGTGG + Intronic
1092203565 12:6602180-6602202 AGCAGGGCAAGGGGGGAAGAGGG + Intronic
1093488152 12:19675276-19675298 GGCTGGGAAGGGAAGGGAGAAGG - Intronic
1093652138 12:21657832-21657854 GGCTCTGCAAGGAGGGAGGAGGG + Intronic
1093980381 12:25469312-25469334 GCCTGGTCTTGGAGGGCAGAGGG + Intronic
1095422116 12:42035246-42035268 GGCTGGGCAAAGTGGGAATAAGG + Intergenic
1095945620 12:47751689-47751711 GGCTGGGCAAGGAGGCAGCAGGG + Intronic
1095948643 12:47768398-47768420 GGCTGGACTAGGGTGGCAGAGGG + Intronic
1096305082 12:50467540-50467562 GGGAGGCCAAGGTGGGCAGATGG - Intronic
1096836528 12:54354819-54354841 GGAAGGGCAGGGTGGGCAGAAGG - Intergenic
1097168571 12:57099216-57099238 GGCAGGGAGAGGAGGGCAGCGGG + Intronic
1097172914 12:57127751-57127773 GGCTGGGCGAGCAGGGCGGGCGG + Intronic
1097194287 12:57235266-57235288 GGCCCGGGTAGGAGGGCAGAGGG + Exonic
1098255518 12:68611394-68611416 GGCGGGGAAAGGAGGGCGGCGGG - Intronic
1098984216 12:76993119-76993141 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1099272425 12:80527744-80527766 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1099272442 12:80527852-80527874 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1099389301 12:82059412-82059434 GGCTGGAGGAGGAGGGAAGAAGG + Intergenic
1099722040 12:86376144-86376166 GGGAGGCCAAGGAGGGCAGATGG + Intronic
1099933347 12:89098755-89098777 GGCTGGGCAAGAAAGGCTGCAGG + Intergenic
1100691771 12:97046064-97046086 AGCAGAGAAAGGAGGGCAGAAGG - Intergenic
1101040173 12:100747512-100747534 GGCCGGAGAAGGAGGGCACAAGG - Intronic
1101985570 12:109443925-109443947 CGCTAGGGGAGGAGGGCAGATGG - Intronic
1102349719 12:112183619-112183641 GGCTCTGCAAGGAGGGTTGAAGG - Intronic
1102567064 12:113803652-113803674 GGCTGGGGTTGGAGGGCAGCTGG + Intergenic
1102625246 12:114229815-114229837 GGATAGGGAAGGAGGACAGAAGG + Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103322844 12:120101870-120101892 GGCTGGGCAGAGCGGGAAGAAGG - Intronic
1103560487 12:121790837-121790859 GGCTGGGCAGGGATGGTAGGAGG + Intronic
1103595900 12:122024029-122024051 TGCTCTGCAGGGAGGGCAGATGG + Intronic
1103622926 12:122200020-122200042 GGCAGGGCAAGGGGACCAGAAGG - Intronic
1103713499 12:122929816-122929838 GCCTGGGCTCGGAGGGCAGCTGG + Exonic
1103723054 12:122984835-122984857 TGCTGGGGAGAGAGGGCAGACGG + Exonic
1103872924 12:124103809-124103831 GGGAGGCCGAGGAGGGCAGATGG - Intronic
1103912638 12:124360746-124360768 GGGTGGGCATTGCGGGCAGAGGG - Intronic
1103931330 12:124452644-124452666 GGGAGGGCGAGGTGGGCAGAGGG + Intronic
1103971193 12:124673961-124673983 GGGTGGGGAGGGAGGGCATAGGG - Intergenic
1103982610 12:124746297-124746319 GGCTGGGGAACGAGGCCAGGAGG - Intergenic
1104400113 12:128468241-128468263 GGGTGTGCAGGGAGGGCAGGGGG + Intronic
1105005979 12:132720847-132720869 GCCTGTGCAGGGAGGACAGAGGG - Exonic
1105284424 13:18993001-18993023 GGGTTGGCAAGAAGGCCAGAAGG + Intergenic
1106014595 13:25856747-25856769 GGCTGGGGAGGAAGGGGAGAAGG - Intronic
1106471617 13:30060968-30060990 GGCTGGGGACAGAGGACAGAGGG + Intergenic
1107070763 13:36266243-36266265 GGCTTGGCAAGCAGGGGAGGAGG + Intronic
1107628972 13:42323743-42323765 GGCTGGGCAAAGAGGGTATACGG - Intergenic
1107910162 13:45098338-45098360 GGGAGGGCAAGGCAGGCAGACGG + Intergenic
1107985066 13:45768517-45768539 GGCTGGGAGAGAGGGGCAGAGGG - Intergenic
1108000911 13:45904913-45904935 GGCTGGTCTGGGAGGGAAGAAGG - Intergenic
1108462126 13:50677206-50677228 GGCTGGGACAGGAGGGAAGGAGG - Intronic
1109438879 13:62343450-62343472 GCCTGGGCAATGATGGCAGGAGG + Intergenic
1109995927 13:70125903-70125925 GGTTGTGGGAGGAGGGCAGAGGG + Intergenic
1110638233 13:77790998-77791020 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
1112378069 13:98862447-98862469 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1112761364 13:102696920-102696942 GGCAGGGCAGGGAGGGAACAGGG + Intergenic
1113296873 13:108968866-108968888 GCCTGGACAAGGAGGGCTCAGGG - Intronic
1113409273 13:110070208-110070230 GGTGGGGAAGGGAGGGCAGAGGG - Intergenic
1113414371 13:110116886-110116908 GGCTGGGCAGAAAGGGCAGCAGG + Intergenic
1113571689 13:111362444-111362466 GGCTGGGGCTGAAGGGCAGAGGG + Intergenic
1113675404 13:112203290-112203312 GACTGGACAAGGAGGCCAGCAGG - Intergenic
1114267631 14:21082049-21082071 GGCCGGGCTAGGGGGCCAGACGG + Exonic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114513495 14:23281722-23281744 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1114550722 14:23531431-23531453 AGCTGGGCAGGGAGGGCAGCAGG - Intronic
1114597169 14:23923301-23923323 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
1115556809 14:34550583-34550605 GCAAGGGCCAGGAGGGCAGAAGG + Intergenic
1116833491 14:49746047-49746069 GGCTGGAGAAGGAAGGGAGATGG + Intronic
1117623275 14:57609822-57609844 GGAGGGGCAAGGATGGCAAAAGG - Intronic
1117689329 14:58289977-58289999 GGAAGGCCAAGGTGGGCAGATGG - Intronic
1118444830 14:65841360-65841382 GGCTGGGGAATGAGGGTAGCAGG + Intergenic
1118766080 14:68910055-68910077 GGATGGGCAGCGAGGTCAGAGGG + Intronic
1118809453 14:69262209-69262231 GGCTGGGCAGGGAGGAGAGGAGG + Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1119335470 14:73829862-73829884 GGCTGGGCCAGAGAGGCAGAGGG - Intergenic
1119444789 14:74654145-74654167 GGCTTGGCATGGTGGGAAGAAGG - Intronic
1119459694 14:74789861-74789883 GGAAGGCCAAGGTGGGCAGATGG - Intronic
1119738694 14:77000106-77000128 GGGGGAGCAAGGTGGGCAGAAGG - Intergenic
1119776552 14:77252774-77252796 GGCTGGGCGGAGAGGGCAGTGGG - Intronic
1119779048 14:77266102-77266124 GACTGGGCAGGCAGGACAGAAGG + Exonic
1119895909 14:78219918-78219940 GGATGGGGATGGAGGGTAGAAGG + Intergenic
1120121038 14:80680406-80680428 TCCTGGGCATGGAGCGCAGAGGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121014355 14:90539319-90539341 GGCTGGGCCACCAAGGCAGATGG - Exonic
1121100936 14:91249821-91249843 GGGAGGCCAAGGTGGGCAGATGG - Intronic
1121200602 14:92114055-92114077 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1121347154 14:93144539-93144561 TGATGGGCAAGGGGAGCAGAGGG + Intergenic
1121566294 14:94912479-94912501 GTCTTGGCAAGGAGGGGAGCTGG - Intergenic
1121613869 14:95299775-95299797 GGTTGGGCAGGGAAGGGAGAGGG - Intronic
1121751752 14:96363420-96363442 GGCCGCGGAAGGCGGGCAGAAGG + Exonic
1121798742 14:96756073-96756095 GGGTGGGCAAGAAGGGAAGGCGG + Intergenic
1122129938 14:99598993-99599015 GGCTGGGGAAGGAGGGGGAAAGG + Intronic
1122384979 14:101338495-101338517 GGCAGGGGAAGGATGGAAGACGG + Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122449919 14:101797473-101797495 GGGTGGAGAAAGAGGGCAGAGGG - Intronic
1122882171 14:104695101-104695123 TGCTGGGCAATGAGGGCAGGTGG - Intronic
1122971763 14:105155083-105155105 AGCTGGGCAAGGTGGGTGGAAGG - Intronic
1123014617 14:105367835-105367857 GGAGGGGCAGGGAGGGCAAAGGG - Intronic
1123041712 14:105492915-105492937 GGCTGGGCAGGGAGCCCAGTGGG + Intronic
1123123108 14:105927175-105927197 GGCTGGGCAGTGAGGGCACTGGG - Intronic
1202929636 14_KI270725v1_random:26425-26447 GGCCGCGCTAGGAGGGCAGGCGG + Intergenic
1123904319 15:24906949-24906971 GGCTGGCAGGGGAGGGCAGAGGG + Intronic
1124630143 15:31331527-31331549 GCCTGGGAAAGCAGAGCAGAGGG + Intronic
1124632784 15:31346911-31346933 GGGTGGGCCAGCAGGGGAGAGGG + Intronic
1125397770 15:39269123-39269145 GGCTGGGCTGGGAGAGCACATGG + Intergenic
1125716451 15:41822462-41822484 AGGTAGGCAAGGAGGGGAGAAGG - Intronic
1125985510 15:44047327-44047349 GGAGGGGAAAGGAGGGGAGAGGG + Intronic
1126599997 15:50418717-50418739 GCCTGGGCAAGGACGACAGCTGG - Intergenic
1127440619 15:59003342-59003364 GGGAGGTCAAGGTGGGCAGATGG - Intronic
1127655431 15:61051154-61051176 GGGTGTGGAAGGATGGCAGAAGG + Intronic
1128098118 15:64974225-64974247 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1128237491 15:66078041-66078063 GGTTGGGGAGGGAAGGCAGAGGG + Intronic
1128240009 15:66095494-66095516 GCCTGGGCTAGGGGAGCAGATGG + Intronic
1128313772 15:66647456-66647478 GGCTGGGCAGGGCTTGCAGACGG - Intronic
1128343197 15:66836973-66836995 GCCTGGACAAGATGGGCAGAAGG + Intergenic
1128347039 15:66860870-66860892 GCCTGGGGAAGGAGGGCAAAGGG + Intergenic
1128382076 15:67120554-67120576 GGGTGGTCTAGAAGGGCAGATGG + Intronic
1128544042 15:68555485-68555507 GGCTGGGCAGGGGGGAGAGAAGG + Intergenic
1128724804 15:69980473-69980495 AGCTGTGCAACCAGGGCAGAGGG - Intergenic
1129161078 15:73748281-73748303 GGCTGGGGAAGGGGAGCAGCAGG + Intronic
1129715936 15:77850862-77850884 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
1129790527 15:78338015-78338037 GGATGGACAAAGAGGGAAGAGGG - Intergenic
1130694250 15:86114310-86114332 GCCTTGGCAAGGAGTCCAGAAGG + Intergenic
1131058779 15:89391813-89391835 GGAGGGGCAGGGAGGGCAGTGGG - Intergenic
1131117090 15:89802300-89802322 GGCAGGGCAAGGAAGGTAGTGGG + Intronic
1131255763 15:90860933-90860955 GGCTGGGCAAGGAAGGTATGTGG - Intergenic
1131357292 15:91757101-91757123 GGTTGGGGGAGGAGGGAAGAGGG - Intergenic
1131508689 15:93037019-93037041 GGCTGGGCGAGCTGGGCAGTGGG + Intronic
1131546389 15:93319359-93319381 GGCTGGGCAATCGGGGCAGGAGG - Intergenic
1131957166 15:97748756-97748778 GGCTGTGCAGGGAGGGGAGGTGG - Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132499420 16:278745-278767 GGCTGGGCAGGGTGGGCGGTTGG + Intronic
1132549728 16:549386-549408 GGCTGTGCAAGGACGGCACGTGG + Exonic
1132571866 16:647762-647784 GGCTGTGGGAGGAGGGCAGTCGG - Exonic
1132583045 16:694086-694108 GGCGGGGCTGGGAGGGCGGAGGG + Exonic
1132666114 16:1082073-1082095 GGCTGGACAAGGTGGGGAGCAGG - Intergenic
1132691808 16:1185028-1185050 GGCTGGGCAGCGAGGGCTGATGG - Intronic
1132859834 16:2064715-2064737 GGCTGGGCAGGGAGGACGGCAGG - Intronic
1132883361 16:2171955-2171977 GGTGGGGCCAAGAGGGCAGAGGG - Intronic
1133248024 16:4462012-4462034 GGCGGGGCAGGGAGGCCGGATGG + Intronic
1133303210 16:4795541-4795563 GGCTGGGCAAGGAGAGAAGCTGG + Intronic
1133349843 16:5094087-5094109 CACTTGGAAAGGAGGGCAGAGGG + Intronic
1133440087 16:5814201-5814223 GGCTGGGAAAGGAGGGCATACGG - Intergenic
1133732700 16:8590216-8590238 GGCTGGGCGTGGAGGGCCGAGGG - Intergenic
1134095677 16:11416870-11416892 GGCTGGGAGATGAGGTCAGATGG + Intronic
1134231131 16:12431229-12431251 GTCTGGGCAAAGGGGGAAGAGGG + Intronic
1134260559 16:12647855-12647877 GGCTGGGCTTGGAGGGTACAAGG - Intergenic
1134349703 16:13425252-13425274 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
1134371506 16:13630211-13630233 GGGAGGCTAAGGAGGGCAGATGG - Intergenic
1134440721 16:14298377-14298399 GCCTGGGGAAGGAGGACAGGAGG - Intergenic
1134747642 16:16600484-16600506 AGCAGGGGAGGGAGGGCAGAGGG - Intergenic
1134815776 16:17204544-17204566 GGATGGGGATGGGGGGCAGAGGG + Intronic
1134853333 16:17499803-17499825 GGCTGGCCCAGGATGTCAGAAGG - Intergenic
1134997825 16:18753175-18753197 AGCAGGGGAGGGAGGGCAGAGGG + Intergenic
1135117045 16:19732700-19732722 GGGAGGCCAAGGAGGGCAGATGG - Intronic
1135339629 16:21634791-21634813 AGCTGCTCAAGGAAGGCAGAAGG + Intronic
1135745762 16:25015152-25015174 GGCTGGGGGCGGAGGGCGGAGGG - Intronic
1135873431 16:26173794-26173816 GGGAGGCTAAGGAGGGCAGATGG + Intergenic
1135875132 16:26191790-26191812 GGGAGGGCAAGGTGGACAGATGG + Intergenic
1136234577 16:28905803-28905825 GGCTGGGCTAGGTGGGGAAAGGG - Intronic
1136234703 16:28906225-28906247 GGCTGGGGCAGGAGGGCAGGAGG + Intronic
1136512633 16:30748600-30748622 GGCAGGGCAGGGAGGGGAGTGGG - Intronic
1136718869 16:32303999-32304021 GGCCGCGCTAGGAGGGCAGGCGG - Intergenic
1136723892 16:32342355-32342377 GGCCGCGCTAGGAGGGCAGGCGG - Intergenic
1136773045 16:32857959-32857981 GGCTGTGCTAGGAGGGCAGGCGG + Intergenic
1136837242 16:33510263-33510285 GGCCGCGCTAGGAGGGCAGGCGG - Intergenic
1136842220 16:33548399-33548421 GGCCGCGCTAGGAGGGCAGGCGG - Intergenic
1136897570 16:34003560-34003582 GGCTGTGCTAGGAGGGCAGGCGG - Intergenic
1137255936 16:46775547-46775569 GGCTGGGGAAGGAGGGAATGAGG + Intronic
1137613391 16:49833841-49833863 GGGAGGGCAGGGAGGGCAGGTGG + Intronic
1137821170 16:51447508-51447530 GGGAGGCCAAGGAGGACAGATGG + Intergenic
1137961402 16:52885385-52885407 GGATGGGAAAGGAGGGAAGCAGG - Intergenic
1138090454 16:54169600-54169622 GGCTGGGGCAGGAGGGGAGAGGG - Intergenic
1138506366 16:57480262-57480284 GGGTGGGGCAGGAGGGTAGAGGG - Intronic
1138628926 16:58277914-58277936 GGCTGGGAGAGGAGGGAAGGAGG + Intronic
1138965800 16:62082640-62082662 GGAAGGACAAAGAGGGCAGAAGG + Intergenic
1139215838 16:65123332-65123354 GGCTGGGAAAGGAGAAGAGATGG + Intronic
1139342642 16:66278463-66278485 GCCTTGGCATGGAGGGGAGAAGG - Intergenic
1139484553 16:67248494-67248516 GGCTTGGCAACGTGGGCGGAGGG + Intronic
1139756830 16:69150792-69150814 GCCTGGGAAAGCAGGGGAGAAGG - Exonic
1140122896 16:72098842-72098864 GCCTCGGCAGGGAGAGCAGATGG + Intronic
1140387996 16:74559462-74559484 GGCTGGGGGAGGAGGGGCGATGG + Intronic
1140800994 16:78488162-78488184 GGCTGGGGATGGAGGGAACATGG + Intronic
1141193623 16:81842873-81842895 GGGTAGGCAGGGAGGGCTGAGGG + Intronic
1141210307 16:81973517-81973539 GCCTGGGCATGGAGCGGAGAGGG - Intergenic
1141610587 16:85178876-85178898 GGGTGGGCAGGGAGGGATGAGGG + Intronic
1141657185 16:85422479-85422501 GGCTGAGCAAGGAAGGGAGGAGG + Intergenic
1141675687 16:85516037-85516059 GGCTGGGAAAGGAGGCCTGGGGG + Intergenic
1141687665 16:85579524-85579546 GGCCGGGCAGGCAGGTCAGAGGG + Intergenic
1141693285 16:85608235-85608257 GGCTGGGGGCTGAGGGCAGATGG + Intergenic
1141766695 16:86063786-86063808 GCCTGAGCAGGGAGGGTAGAGGG + Intergenic
1142008262 16:87700646-87700668 GGCAGAGGGAGGAGGGCAGAGGG + Intronic
1142122358 16:88393228-88393250 GGCCGGGCACGGAGGGCCGCTGG - Intergenic
1142252597 16:88999607-88999629 GGCGGAGGGAGGAGGGCAGAGGG + Intergenic
1142321629 16:89386947-89386969 GGCTTGGCAGTGAGGGCAGGAGG + Intronic
1142425318 16:89999466-89999488 GGGTGGGAAAGCAGGGCAGTGGG + Intergenic
1203002539 16_KI270728v1_random:175410-175432 GGCCGCGCTAGGAGGGCAGGCGG + Intergenic
1203007562 16_KI270728v1_random:213772-213794 GGCCGCGCTAGGAGGGCAGGCGG + Intergenic
1203075470 16_KI270728v1_random:1120069-1120091 GGCTGTGCTAGGAGGGCAGGCGG + Intergenic
1203123580 16_KI270728v1_random:1558726-1558748 GGCCGCGCTAGGAGGGCAGGCGG + Intergenic
1203134144 16_KI270728v1_random:1711816-1711838 GGCCGCGCTAGGAGGGCAGGCGG + Intergenic
1203152385 16_KI270728v1_random:1848696-1848718 GGCCGCGCTAGGAGGGCAGGCGG - Intergenic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1142805148 17:2367542-2367564 GGCAGATCAGGGAGGGCAGAAGG + Intronic
1142837643 17:2600332-2600354 GGGAGGCCAAGGCGGGCAGAAGG + Intronic
1142958256 17:3535483-3535505 GGAAGGGGAAGGAGGGAAGAAGG - Intronic
1142967910 17:3592443-3592465 CCCTTGGCAAGGAGGGCAGGTGG - Intronic
1143084543 17:4405947-4405969 CGCTGGGCAGGGAGTACAGAAGG - Intergenic
1143154505 17:4827644-4827666 GGCTGGGCCAGGGGTGCCGAGGG + Intergenic
1143610421 17:8014783-8014805 GGGTGGGCTGGGAGGGCAGCTGG + Intronic
1143733644 17:8895471-8895493 AGCAGGGTCAGGAGGGCAGAGGG - Intronic
1143874172 17:9979384-9979406 GGCTGAGAAAGGTGGGGAGATGG - Intronic
1143916198 17:10295187-10295209 AGCTGGGCTAGAAGAGCAGAGGG - Intergenic
1144675175 17:17157397-17157419 GGCTTGGAGAGGAAGGCAGAAGG - Intronic
1144691875 17:17272040-17272062 GGAAGGCCAAGGTGGGCAGATGG + Intronic
1144710135 17:17396114-17396136 TGCTGGGCCAGGAGGGCTGGGGG - Intergenic
1144872068 17:18377828-18377850 GGCTGGTGAAGGAGGGCAGGAGG - Exonic
1145361987 17:22219824-22219846 GGCTGGGAAAGGAGGGAATGGGG + Intergenic
1145983105 17:29025926-29025948 GGCTGGGCAGGGGAGGAAGAGGG - Intronic
1146095482 17:29926297-29926319 GGGAGGCCAAGGTGGGCAGACGG + Intronic
1146125839 17:30230711-30230733 GGTGGGGCATGGAGGGGAGAAGG + Intronic
1146186339 17:30726943-30726965 GGCTGGGCGACGAGGGGAGTGGG + Intergenic
1146623479 17:34418585-34418607 GGCAGGGCAAAGTGGGGAGATGG - Intergenic
1146647138 17:34582929-34582951 GGATCGGGAAGGTGGGCAGAGGG - Intronic
1146719376 17:35113073-35113095 GGCAGGGCATGGAGGGTAGGTGG - Intronic
1147133020 17:38419905-38419927 GACTGGGAAAGGAGGGGAGCCGG - Intergenic
1147318333 17:39631699-39631721 GGCTGGGAAGGGAGGAGAGAAGG + Intronic
1147382797 17:40065629-40065651 GGCTGCGCAGGGGGGGCAGAGGG - Intronic
1147387037 17:40088958-40088980 GGCAATGCAAGGAGGACAGAGGG - Intronic
1147546577 17:41406575-41406597 GGCTGGACTAGGAGTGCTGAAGG + Intergenic
1147567614 17:41547413-41547435 GGCTGGGCAAGGAGAGGTGGGGG - Intergenic
1147644875 17:42027568-42027590 GACTGGGTCAGGAGGGGAGAGGG - Intronic
1147704024 17:42413719-42413741 GGCTGGGGAAGGATTGGAGATGG - Intronic
1148026697 17:44593688-44593710 GGCTGGGATGGGAGGGCAGGGGG - Intergenic
1148737044 17:49870824-49870846 GGCTGAGCAGGAAGGGGAGAGGG - Intergenic
1148805375 17:50261201-50261223 GGAAGAGCATGGAGGGCAGAGGG + Intergenic
1148860046 17:50600011-50600033 GGCTTGGCAAGGCGGGCAGAGGG - Intronic
1149036188 17:52136677-52136699 GGCTCAGAAAGGGGGGCAGAGGG - Intronic
1149427630 17:56570285-56570307 GGCTGTGAGAGGAGGGGAGATGG - Intergenic
1149443096 17:56691418-56691440 GGCTAGGGAAGGAGAGCAAAGGG + Intergenic
1149526655 17:57361359-57361381 GGAAGGCCAAGGCGGGCAGATGG + Intronic
1149657077 17:58315869-58315891 GGCTGAGCACGCTGGGCAGAGGG + Intronic
1149979353 17:61297284-61297306 GGCTGGGGATGGAGGAGAGAAGG + Intronic
1150647182 17:66986242-66986264 GGCTGGGCCAGGAGGGCCAGAGG - Intronic
1150820130 17:68428135-68428157 GGGAGGCCAAGGAGGGCGGATGG - Intronic
1150832697 17:68538340-68538362 GGCAGGGAAGGGAGGCCAGAGGG + Intronic
1151301691 17:73231937-73231959 GGCCGGGGGAGGAGGGGAGAGGG - Intronic
1151629514 17:75301023-75301045 AGCGGGGCAAGGAGAGCAGAGGG - Intergenic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151671028 17:75571789-75571811 TGCTGGGCAGGGAGAGCAGAGGG + Intronic
1152300835 17:79494687-79494709 GCCCAGGCAAGGAGGCCAGAGGG + Intronic
1152504116 17:80735930-80735952 GGAAGGCCAAGGTGGGCAGATGG + Intronic
1152570135 17:81118053-81118075 GGCCAGGCAGGCAGGGCAGAGGG + Exonic
1152755101 17:82083929-82083951 GGCGGGGCCAGGAGGGCAGCGGG + Intronic
1152768900 17:82155712-82155734 TGCTGGGAAAGGAGCCCAGACGG - Intronic
1152789805 17:82273039-82273061 GGTTGGGGAAGGAGGGGATAGGG - Intronic
1152796329 17:82309356-82309378 GGGTTGTCAAGGCGGGCAGAGGG - Intergenic
1152975955 18:218474-218496 GAGTGGGCAACGAGGGCAAAGGG + Intronic
1153027209 18:682627-682649 GGGAGGCCAAGGCGGGCAGATGG + Intronic
1153031180 18:713531-713553 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
1153971856 18:10234368-10234390 GGCTGGGACAGGTGGGCTGAGGG + Intergenic
1154254620 18:12771656-12771678 GGCTGGGCACAGAGTGCTGAGGG + Intergenic
1154306310 18:13233348-13233370 GGGTTGGCAAGGTTGGCAGAGGG + Intronic
1154963192 18:21330131-21330153 GGCTGGGCAGGCAGGTCAGCTGG + Intronic
1155083041 18:22429488-22429510 GGTTTGGCCAGCAGGGCAGAAGG - Intergenic
1155584150 18:27345565-27345587 GGCTAGGCAAGGTGGGGAGAGGG - Intergenic
1156222315 18:35065053-35065075 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1156426554 18:37019788-37019810 GCCTGGGCATGGAGTGTAGAGGG + Intronic
1156786473 18:40921398-40921420 GGCTGGGGTAGGAGGGGAAAGGG - Intergenic
1157102469 18:44743173-44743195 GGCTGAGCAAATAGGCCAGATGG + Intronic
1157262080 18:46184480-46184502 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1157331594 18:46708130-46708152 GGCGGGACAAAGAGGACAGAGGG - Intronic
1157520791 18:48343872-48343894 GGCGGGGGAGGGAGTGCAGAGGG - Intronic
1157603044 18:48906403-48906425 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
1157940345 18:51921706-51921728 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
1158316046 18:56212344-56212366 GCATGAGCAAGGAGGGCAGCAGG - Intergenic
1158543073 18:58374450-58374472 GGCCGGGAAAGGGGGGCAGTGGG - Intronic
1158774233 18:60556616-60556638 TGCTGGGCCAAGTGGGCAGAAGG + Intergenic
1158944471 18:62436700-62436722 GGCTTGGCTAGGAGGTCAGATGG + Intergenic
1160251868 18:77210186-77210208 GGCTTGCCAGGGAGGGCACAGGG + Intergenic
1160378314 18:78430156-78430178 GGCTGGGCTGGGAGGGCTGCTGG - Intergenic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1160517894 18:79488576-79488598 GGGTGGACAAGGAGGACAGCAGG - Intronic
1160525467 18:79533073-79533095 GGCATGGCAAGGAGGGGAAATGG - Intergenic
1160603825 18:80034216-80034238 GGCGGGGCAACGACGGCGGAGGG - Intergenic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1160684236 19:426215-426237 TGCTGGGTGACGAGGGCAGAGGG + Intronic
1160720928 19:596643-596665 GGTTGGACAAGGAGGGCACAGGG + Intronic
1160790141 19:919304-919326 GACTGGGAGAGGAGGGCAGGAGG - Intronic
1160860891 19:1236906-1236928 GGCTGGGCACGGCGGGGAGGCGG - Intronic
1160862703 19:1244473-1244495 GGCTGGGCAGGGATGCCAGGTGG + Exonic
1160944165 19:1633463-1633485 GGATGAGCAGGGAGGGCAGGGGG - Intronic
1161014924 19:1978771-1978793 GGCGGGGCTCGGAGGGAAGAGGG + Intronic
1161019240 19:2000229-2000251 GACGCGGCCAGGAGGGCAGACGG - Intronic
1161253760 19:3295142-3295164 GGCAGGGCAAGGGGAGAAGAGGG - Intronic
1161302965 19:3551798-3551820 GGCAGGGCACGGAGGGGACAGGG - Intronic
1161426982 19:4209017-4209039 GGCTGGGGTGGGAGGGCAGTGGG + Intronic
1161447863 19:4328234-4328256 AGCTGGGCAGGGAGGGCTGGGGG - Intronic
1161849650 19:6731790-6731812 GGCTGGGCAGAGAGGCCAGGAGG + Intronic
1161852800 19:6746292-6746314 GGTTGGGCAACCAGGGAAGAGGG - Intronic
1161984487 19:7646221-7646243 GGCAGGGCAGGGAGGGCAGCAGG - Intronic
1162444313 19:10712894-10712916 GGCAGGGCATGGAGGGGACAGGG + Intronic
1162480562 19:10924652-10924674 AGCTTGGCAGTGAGGGCAGAGGG - Intronic
1162806647 19:13140724-13140746 GGCAGGGCAAGGGGGGTACAGGG - Exonic
1162925827 19:13930132-13930154 GCCTGGGCAACGATGGCAGCAGG + Exonic
1162986245 19:14272027-14272049 GGATTGGCAAGGAGATCAGAGGG - Intergenic
1163058375 19:14739859-14739881 GGGAGGCCAAGGCGGGCAGATGG + Intronic
1163146075 19:15379996-15380018 GGCGGGGCGGGGTGGGCAGAGGG - Intergenic
1163190482 19:15673415-15673437 GGCAGGGCAGGGAGGGCTCAGGG - Intronic
1163204304 19:15790995-15791017 GGCTGGGAAGGGTAGGCAGAAGG + Intergenic
1163318075 19:16555115-16555137 GGCTGGGCAGGGAAGGAAGCCGG - Intronic
1163376395 19:16934972-16934994 GGCTGGGGGAGGAGGGAATAGGG - Intronic
1164583147 19:29447580-29447602 GGCTGGGAAAGGCAGCCAGAGGG - Intergenic
1164727158 19:30473769-30473791 GGATGGGCCAGAAGGGCAGGGGG - Intronic
1164768707 19:30791642-30791664 TGCTAGAGAAGGAGGGCAGAAGG - Intergenic
1164870741 19:31640701-31640723 GGCTCTGGAAGGAGGGAAGATGG + Intergenic
1164883179 19:31753423-31753445 GGCTGGGGAAGGTGGGAATAGGG + Intergenic
1165025428 19:32957568-32957590 GGGAGGTCAAGGTGGGCAGATGG + Intronic
1165198211 19:34123251-34123273 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
1165487717 19:36105414-36105436 TGCTGGGCAAGGTAGGCACATGG - Intergenic
1165574050 19:36798990-36799012 AGCTCGGCAGGGAGGTCAGAGGG - Intergenic
1166226574 19:41399401-41399423 GGCTGGGCAAGTGGGGCAGGAGG + Intronic
1166326518 19:42054218-42054240 GGAAGAGCAGGGAGGGCAGAGGG + Intronic
1166981387 19:46634286-46634308 GGCGGGGCAAGGTGGGAGGAGGG - Intronic
1167135592 19:47613401-47613423 GCCTGGGCTTGGAAGGCAGAGGG + Intronic
1167243435 19:48359251-48359273 GGGTGGGATATGAGGGCAGAGGG - Intronic
1167299687 19:48671585-48671607 GGCTGGGATAGGTGGGCAGGTGG + Intronic
1167340479 19:48912964-48912986 GGCTGGGCAGAGGGGGCAGAGGG + Intronic
1167436520 19:49481563-49481585 AGGTGGGCCAGGAGGGAAGAAGG + Intronic
1167539919 19:50079269-50079291 GGCTGGGAAGGGAAGGCAGTGGG - Intergenic
1167587410 19:50382829-50382851 AGCTGGGGAGGGAGGGCAGCCGG - Exonic
1167629783 19:50618499-50618521 GGCTGGGAAGGGAAGGCAGTGGG + Intergenic
1167793306 19:51693557-51693579 GCCAGGGCCAGCAGGGCAGACGG - Intergenic
1168184752 19:54692570-54692592 GGCTGGGAAGGGTGGGAAGAGGG + Intronic
1168187516 19:54709479-54709501 TGCAGGGCCAGGAGGGGAGAAGG + Intergenic
1168297283 19:55383689-55383711 GGCGGGGCAGGGCGGGGAGACGG - Intronic
1168417101 19:56176069-56176091 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417117 19:56176119-56176141 GCCTAGGCCAGGAGGGCACAGGG + Intronic
1168417130 19:56176169-56176191 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417144 19:56176219-56176241 GCCTAGGCCAGGAGGGCACAGGG + Intronic
1168417158 19:56176269-56176291 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417174 19:56176319-56176341 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417190 19:56176369-56176391 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417206 19:56176419-56176441 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417220 19:56176469-56176491 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417236 19:56176519-56176541 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417250 19:56176569-56176591 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417265 19:56176619-56176641 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417279 19:56176669-56176691 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168426478 19:56243209-56243231 GGCTGGGGTGGGTGGGCAGAGGG + Intronic
1168703174 19:58453509-58453531 GCCTGGACCAGGAGGGCAGAGGG + Intronic
1168705628 19:58468769-58468791 GTCTGGTCAGGGAGGGCAGAGGG + Intronic
1202692482 1_KI270712v1_random:101568-101590 GGCTGCGCTAGGAGGGCAGGCGG - Intergenic
925055800 2:856496-856518 GGCTGGGCAGGGAGGAGAGCAGG - Intergenic
925768447 2:7259712-7259734 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
925862214 2:8190249-8190271 GCTTGGGCAAGGAGAGAAGATGG - Intergenic
925949868 2:8900044-8900066 AGCTGTTCAAGGAAGGCAGAAGG + Intronic
925959495 2:9002826-9002848 GGCTGGGCAAGGAGGTAAAGTGG + Intronic
926138993 2:10357281-10357303 GGCTGGGCCAGGAGTTGAGAAGG - Intronic
926736538 2:16077770-16077792 GGCTTGGCATGGAGGCCAGATGG - Intergenic
927086383 2:19677440-19677462 GGCTGAGCAAGCAGTGCTGAGGG + Intergenic
927095662 2:19746036-19746058 AGCTGGGAGAGGAGGACAGAGGG + Intergenic
927148560 2:20182680-20182702 GGCTGGGCCAAGAGTGGAGAGGG + Intergenic
927209148 2:20628008-20628030 GGAGGGGCAGGGAGGGAAGAGGG + Intronic
927422420 2:22947493-22947515 GGCTGGGAGAGGAGGGAACAGGG + Intergenic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
927690816 2:25206934-25206956 TGGTGGGCCAGGATGGCAGAAGG + Intergenic
927696463 2:25242728-25242750 GGCTGGGGGGGCAGGGCAGAGGG + Intronic
927720519 2:25379110-25379132 AACAGGGCAAGGAGGGCACATGG + Intronic
927742377 2:25583019-25583041 GGGAGGCCAAGGCGGGCAGATGG + Intronic
927964719 2:27262050-27262072 GGGTGGGCAGGGAGGTCGGACGG + Intronic
927977275 2:27348289-27348311 AGCTGGGCATGGTGGGCAGCAGG + Intronic
928087781 2:28356518-28356540 GGCTGGGGACTGGGGGCAGAGGG + Intergenic
928129247 2:28637761-28637783 GAGTGGGCAAGGAGGTGAGAAGG - Intronic
928137924 2:28702544-28702566 GGCTGGGCCAGGCATGCAGAAGG + Intergenic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
929015200 2:37486888-37486910 GGAAGGGCAAGGAGGTCATATGG - Intergenic
929139523 2:38654808-38654830 GGAAAGGCAAGGAGGGGAGATGG - Intergenic
929967808 2:46548632-46548654 GGCTGAGCAAGGATGGAACACGG - Intronic
930053644 2:47235915-47235937 GGCTGGGCAGGGAGTGAAGGAGG + Intergenic
930210811 2:48635098-48635120 GCCTGGGCATGGAGTGGAGAGGG + Intronic
930712212 2:54559634-54559656 GGCTGGGCAGGGACAGCTGAGGG - Intronic
930807592 2:55506800-55506822 GGCTGAGGCAGGAGGGCAGGAGG - Intergenic
931226808 2:60338892-60338914 GGCCAGGGAAGGAGGGCAAAGGG - Intergenic
931344319 2:61432232-61432254 GAGTGGCCAAGGTGGGCAGATGG + Intronic
931798149 2:65731736-65731758 GGCTGGCCAAGAAGGGAAGATGG + Intergenic
932335112 2:70926362-70926384 GGCTGACAAAGGTGGGCAGAGGG - Intronic
933083394 2:78023529-78023551 GGCTGGGGCAGGTGAGCAGAAGG - Intergenic
933336745 2:80968119-80968141 GCCTGGGCATGGAGTGGAGATGG - Intergenic
933684570 2:85133343-85133365 GGCTGGGCAGGGGGGCCGGAGGG - Intergenic
933728269 2:85438400-85438422 GGCTGGGCCAGTGGGGCTGAAGG - Intergenic
933953918 2:87352403-87352425 GGCTGCGCTAGGAGGGCAGGCGG + Intergenic
934176508 2:89583330-89583352 GGCAGGGGAAGGACGGCAGTGGG - Intergenic
934238118 2:90248646-90248668 GGCTGCGCTAGGAGGGCAGGCGG + Intergenic
934275080 2:91568087-91568109 GGCTGCACTAGGAGGGCAGGCGG - Intergenic
934460532 2:94211985-94212007 GGCCGTGCTAGGAGGGCAGGCGG + Intergenic
934504641 2:94880686-94880708 GGGTGGGCAGGGAGAGCAGAGGG - Intergenic
934521329 2:95021971-95021993 GGATGGGGATGGAGGGTAGAGGG - Intergenic
934577284 2:95410979-95411001 GGCAGGGCCCAGAGGGCAGAAGG - Exonic
934639581 2:96019653-96019675 GGCAGGGCCCAGAGGGCAGAAGG - Intergenic
934794069 2:97085724-97085746 GGCAGGGCCCAGAGGGCAGAAGG + Exonic
934897664 2:98132692-98132714 TGTAGGGCAAGGAGGGGAGATGG - Intronic
935432417 2:102990357-102990379 TGATGGGCAAGGAGGGAAGGAGG + Intergenic
935880463 2:107559745-107559767 GGCTGGCAAAGAAGGGAAGATGG - Intergenic
935946098 2:108288093-108288115 GCTTTGGCAAGAAGGGCAGATGG + Intergenic
936020080 2:108988221-108988243 GGCTGGGCAGGGAGGTCAGCAGG - Intronic
936525975 2:113241980-113242002 TGCTGGGACAGGAGGGCAGCGGG - Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936662738 2:114560220-114560242 GGGAGGAGAAGGAGGGCAGAGGG + Intronic
936986806 2:118319300-118319322 GGCAGGAAAGGGAGGGCAGAGGG - Intergenic
937042983 2:118835580-118835602 GGCTGGGCGACGAGGAGAGAGGG + Intergenic
937044332 2:118843287-118843309 GGGTGGGGACCGAGGGCAGAAGG + Intronic
937066112 2:119019249-119019271 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
937150508 2:119682821-119682843 GGGTCAGCAAGGAGAGCAGAGGG + Intronic
938132868 2:128732289-128732311 GGCTTGGAAAGGAGGTGAGAGGG + Intergenic
938228193 2:129635868-129635890 GGGTGGCCATGGAGGGCGGATGG - Intergenic
938306898 2:130262738-130262760 TGCAGGGAAAGGAGGGCAGAGGG - Intergenic
938716810 2:134028608-134028630 GGCTGGGCAAGGAGGCGACTGGG - Intergenic
938800324 2:134757087-134757109 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
939529289 2:143337057-143337079 ATCTGGTCAAGGAGGACAGAGGG + Intronic
939623253 2:144446420-144446442 GGCTGAGAAAGGGGAGCAGAGGG - Intronic
939851887 2:147314044-147314066 AGCTGCTCAAGGAAGGCAGAAGG - Intergenic
940408453 2:153332703-153332725 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
940665548 2:156604521-156604543 GGGAGGCCAAGGCGGGCAGATGG - Intronic
941129899 2:161634859-161634881 GGCTGGGGAAGGTAGGGAGAAGG - Intronic
941604496 2:167580555-167580577 GGCTGGGTAGGGAGGACACAGGG - Intergenic
941633295 2:167908006-167908028 GGATGGGGAAGGAGGGAAGGAGG + Intergenic
941880962 2:170480198-170480220 GCCCGTGAAAGGAGGGCAGAAGG - Intronic
941975258 2:171397276-171397298 GGGAGGTCAAGGTGGGCAGATGG + Intronic
942210887 2:173668719-173668741 GGTTGGGAGGGGAGGGCAGAGGG + Intergenic
942437925 2:176001771-176001793 GGTGGGGCAAAGAGGTCAGAAGG - Intronic
942634073 2:177982834-177982856 GGGAGGCCAAGGTGGGCAGATGG + Intronic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
946865679 2:224039360-224039382 GGCGGGGCAAGGCGGGCCGGGGG - Intergenic
947217504 2:227762926-227762948 GGGAGGCCAAGGAGGGTAGATGG - Intergenic
947403096 2:229748424-229748446 GGGAGGCCAAAGAGGGCAGATGG + Intergenic
947406242 2:229780545-229780567 GACTGAGCAGGGTGGGCAGAGGG - Intronic
947588251 2:231370230-231370252 GGCCAGGCCAGAAGGGCAGAAGG + Intronic
947792476 2:232876133-232876155 GGCGGGGGAGGGAGGGGAGAGGG + Intronic
947960277 2:234230436-234230458 GGCTGGGAAAGGAGGTCTGTCGG + Intergenic
948156632 2:235788571-235788593 GGCCGGGCAAGGAGAGGAGTGGG + Intronic
948341543 2:237256650-237256672 GTCTGGGAAAGGAGGGCAGTTGG - Intergenic
948485548 2:238278733-238278755 TGCCGGGTAAAGAGGGCAGAGGG + Intronic
948500400 2:238388871-238388893 GGAAGGCCAAGGCGGGCAGATGG - Intronic
948636830 2:239343673-239343695 GGCAGGGCAGGCAGGGCAGCAGG - Intronic
948655005 2:239471088-239471110 AGCTGGCCCAGGAGGGCAGGAGG - Intergenic
948762315 2:240199649-240199671 GACTGGCCACGGCGGGCAGAAGG - Intergenic
948869617 2:240791610-240791632 GGCTGGGCAAGGGTGGGACAGGG - Intronic
948880618 2:240855531-240855553 GGCAGGGCAGGGGCGGCAGATGG + Intergenic
948906487 2:240982067-240982089 GGCTGTGCACAGAGGGCAGCAGG + Intronic
949009798 2:241671972-241671994 GGCAGGGTGAGGAGGGCAGGGGG - Intronic
949019743 2:241734525-241734547 GGCTGGGCCTGGAGGGCAGGCGG + Intergenic
1168827160 20:821740-821762 GGCTGGGGTAGGAGGGAAGCTGG - Intergenic
1169092144 20:2867497-2867519 GGCTAGACAGGGAGAGCAGAGGG - Intronic
1169092155 20:2867543-2867565 GGCTAGACAGGGAGAGCAGAGGG - Intronic
1170506878 20:17035589-17035611 GGCTGGCAAAGAAGGGAAGATGG + Intergenic
1171295434 20:24012767-24012789 GCCTGGGCAAGGGGGGATGAGGG - Intergenic
1171309389 20:24134437-24134459 GGCTTGCCAAGGGGTGCAGATGG + Intergenic
1171376223 20:24695941-24695963 GGCTGAGCATGGAGGGCTGGTGG - Intergenic
1171899516 20:30844351-30844373 GGAAGGGCAAGGAGGGAACAAGG + Intergenic
1172080492 20:32336972-32336994 AGCTGGGCAAGGAGGAGGGAAGG + Intergenic
1172085409 20:32378257-32378279 GGGAGGTCAAGGTGGGCAGATGG - Intronic
1172121994 20:32603968-32603990 GGAAGGCCAAGGTGGGCAGATGG - Intronic
1172204638 20:33154262-33154284 GGCTGGACAAGGAAGAGAGATGG + Intergenic
1172292963 20:33789390-33789412 GGCTGGGCAAGGAGGTAGGGTGG - Intronic
1172356083 20:34280988-34281010 GCCTGGGCAAGGACAGCAGCTGG + Exonic
1172649787 20:36494732-36494754 GGGAGGGCAAGGAGGGAAGTAGG - Intronic
1172788491 20:37486247-37486269 GGCTGAGAAAGGAGGGAGGAGGG + Intergenic
1173225105 20:41157966-41157988 GACTGGGGAAGGATGGCTGATGG + Intronic
1173460992 20:43243281-43243303 CACTGGGCAGCGAGGGCAGATGG + Intergenic
1173503124 20:43567651-43567673 GGCTGGGCACTGGGGGAAGAGGG - Exonic
1173521655 20:43704451-43704473 GGCTGGAGAAGGAAGGCAGCGGG + Intronic
1173563691 20:44023924-44023946 GGCTGAGGAAGGAGGGAAGGGGG - Intronic
1173578854 20:44132429-44132451 GGTGGGGCAAGGGGGGGAGATGG - Intronic
1173595938 20:44258394-44258416 GGCTGGGCAGGGAAGCCAGAGGG - Intronic
1173662561 20:44744741-44744763 GGCTGGGCAATGTGGCCAGCTGG + Intergenic
1173724219 20:45286077-45286099 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1174037224 20:47675727-47675749 GGCAGGGCAGGGAGGGGAGTGGG - Intronic
1174095941 20:48089510-48089532 GGCTGGGGTAGGAGGCCAAAGGG - Intergenic
1174112924 20:48208485-48208507 AGCTGGGCTAGGAGGGCTGTGGG + Intergenic
1174145213 20:48448521-48448543 GGCTGGGCTTTGAGGGCAGGTGG - Intergenic
1174413197 20:50349343-50349365 GGCTGGGCCTGAATGGCAGAGGG - Intergenic
1174488333 20:50874965-50874987 GCATGGTCAAGGAGGACAGAGGG - Intronic
1175182275 20:57157080-57157102 GGCTGGGCAAGGCTGGGAGGAGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175316973 20:58055226-58055248 GGCTGAGGAAGGAGGGGACATGG + Intergenic
1176102168 20:63369595-63369617 GGGTGGGCAGGGTGAGCAGAGGG - Intronic
1176158718 20:63637480-63637502 GGCAAGGCACTGAGGGCAGATGG - Intergenic
1176184155 20:63769084-63769106 GGGTGGGAGAGGAGGGCACATGG + Intronic
1176210379 20:63917794-63917816 GGGAGGCCAAGGTGGGCAGATGG - Intronic
1176591659 21:8655024-8655046 GGCTGCGCTAGGAGGGCAGGCGG + Intergenic
1177262559 21:18749841-18749863 GGGAGGCCAAGGAGGGCTGAGGG + Intergenic
1177477412 21:21641953-21641975 GGGAGGCCGAGGAGGGCAGATGG - Intergenic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1178015928 21:28346126-28346148 GGCTGGTCATGGATGGCAAAGGG - Intergenic
1178031339 21:28529869-28529891 GGCTGTGCACGTGGGGCAGAGGG - Intergenic
1178376372 21:32070873-32070895 GGCAGAGCAAGGAGGACAGCGGG + Intergenic
1178512353 21:33216078-33216100 GGGTGGCTAAGGAGGGCAGCTGG + Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1179047616 21:37860598-37860620 GGCTGGGAAATGAGGGTGGAGGG - Intronic
1179210757 21:39322649-39322671 GGCTGGCCACGGAGGGCACGGGG - Intergenic
1179483852 21:41696512-41696534 GGCAGGGAAAGGAGAGGAGATGG + Intergenic
1179553840 21:42160204-42160226 GGATGGAGCAGGAGGGCAGAGGG - Intergenic
1179569229 21:42268243-42268265 GGGTGGGAAAGTAGGGCAGGCGG + Intronic
1179583550 21:42360566-42360588 GGCTGGCCTAGGAAGCCAGAGGG + Intergenic
1179615430 21:42580225-42580247 TGCTGGGCCGGGAGGGCAGCTGG + Intronic
1179617928 21:42593739-42593761 GGCTGGCCGAGGAGGGAGGATGG + Intergenic
1179654805 21:42838235-42838257 GGCTGTGGAAGGAGGCCAGAAGG - Intergenic
1179942829 21:44650776-44650798 GGCTGGGAAAGGAGTTCTGAGGG + Intronic
1180131711 21:45830919-45830941 GCCCGGGAGAGGAGGGCAGAGGG - Intronic
1180161564 21:46000642-46000664 GGCCGGGGAAGGAGGGCGGCCGG + Intronic
1180274507 22:10632136-10632158 GGCCGTGCTAGGAGGGCAGGCGG + Intergenic
1180548995 22:16527113-16527135 GGCCGCGCTAGGAGGGCAGGCGG + Intergenic
1180699307 22:17773132-17773154 CCCTGGGCAAGAGGGGCAGAAGG + Intronic
1180968543 22:19802990-19803012 GGCTGAGCAAGGAGACCTGAGGG + Intronic
1181049360 22:20231341-20231363 GGCTGGGGCAGGAGGGCTGTGGG + Intergenic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181861534 22:25823060-25823082 GGTTGGGGGAGGAGGGCAGCAGG + Intronic
1182508196 22:30800478-30800500 AGCTGGGCTGGGAGGGCGGACGG + Intronic
1182587882 22:31355986-31356008 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
1182738491 22:32548292-32548314 GCCAGGCCAAGGTGGGCAGATGG - Intronic
1183343399 22:37294267-37294289 GGCTGGGGGAGGTGGGCAGTGGG + Intronic
1183540481 22:38426780-38426802 GGCCGGGCCTGGAGGTCAGATGG + Exonic
1183586180 22:38754605-38754627 GGCGGGGCAGGGAGGGGGGAGGG - Intronic
1183702734 22:39458869-39458891 GGCTGGGCAGGGAGGCCAGGTGG + Intronic
1183733776 22:39632345-39632367 GGCTGGGCAAGGAGGTCTGCTGG - Intronic
1183915414 22:41114414-41114436 GTGAGGCCAAGGAGGGCAGACGG - Intronic
1184053092 22:42023432-42023454 GGGAGGGCAAGGCGGGCAGATGG - Intronic
1184057695 22:42063353-42063375 GGTTGGGAGAGGAGGGCAGCAGG - Intronic
1184147370 22:42619428-42619450 GGCCGGGAATGGTGGGCAGACGG + Exonic
1184352814 22:43955632-43955654 CTCTGGGCCAGCAGGGCAGACGG + Intronic
1184366435 22:44054571-44054593 GGCTGGGCAGGGAGGGGACAGGG + Intronic
1184406603 22:44304142-44304164 GCCTGGTCAGGGAGAGCAGAGGG + Intronic
1184479243 22:44737412-44737434 GGCCGAGCAAGGAAGGCTGATGG - Exonic
1184735967 22:46398033-46398055 GGCTGGGTGAGGAGCTCAGAGGG + Intronic
1185341564 22:50293484-50293506 GGCTGGGAGGGGAGGGCAGCAGG - Intronic
1185399943 22:50610533-50610555 TGCTGGGCCAGGAGAGCTGAGGG + Intronic
949285345 3:2396262-2396284 GGAAGGCCAAGGAGGGCAGATGG - Intronic
949505092 3:4719905-4719927 GGCTGGGGCAGGGGGACAGATGG + Intronic
949865283 3:8542239-8542261 GGGAGGCCAAGGCGGGCAGATGG - Intronic
950096116 3:10331678-10331700 GGGTAGGCAGGGAGGGGAGATGG - Intronic
950130946 3:10546402-10546424 GGCTGGGCAGGGTGGGCCCAAGG - Intronic
950219832 3:11186050-11186072 GGCTCTGCAAGGTGGGCAGGAGG - Intronic
950423503 3:12912267-12912289 GGCTGGGCTGGGAGGGGAGAGGG + Intronic
950482669 3:13254323-13254345 GGCTGGACACGGAGGCCTGATGG + Intergenic
950555925 3:13696011-13696033 AGCTGGGAAAGGAGGGGACATGG + Intergenic
950646103 3:14377749-14377771 GAATGGGCAAGGAGGCTAGAGGG + Intergenic
950886324 3:16366089-16366111 GGCAGGGCAAAGAGGGTAGTTGG + Intronic
951668360 3:25151949-25151971 GCCTGGGCAACGTGAGCAGAGGG + Intergenic
951706085 3:25545711-25545733 TGCTGGGCAGGGAGGAGAGAGGG - Intronic
952287128 3:31980524-31980546 GACTGGGAAAGGGAGGCAGAAGG - Intronic
952337943 3:32421054-32421076 GGGTGGGAGAGGAGGGCAGCAGG - Intronic
952439765 3:33314319-33314341 GGCTGGGAAAGCAGGGGAAATGG - Intronic
952815271 3:37442161-37442183 GGCGGGGCAAGAAGGGGTGAGGG - Intergenic
952964713 3:38614112-38614134 GGCTGGTCGGGGAGGGCAGGCGG - Intronic
953135112 3:40175497-40175519 GAATGGGAAAGGAGGGCAGCAGG - Intronic
953447100 3:42977979-42978001 GGTTGGGAAATGAGGGAAGAGGG - Intronic
953980097 3:47409321-47409343 GGCTGGGTGAGCAGGGTAGAGGG + Intronic
954248990 3:49353898-49353920 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
954289681 3:49643022-49643044 GGCTTGGCACAGTGGGCAGATGG - Exonic
954305188 3:49721931-49721953 GGCTGGGCTGGGTGGGGAGAGGG - Exonic
954417307 3:50399633-50399655 GGCTGTGAAAGGAGGGGAGCAGG - Intronic
954441033 3:50522055-50522077 GGCTGGGGAAAAAGGGAAGAGGG - Intergenic
954464276 3:50645620-50645642 GCCTGGGCAAGGTGGGGAGCAGG - Intronic
954701714 3:52454079-52454101 GGCTGGGCCAGGAATGCAGCGGG - Intergenic
954710300 3:52502097-52502119 GGCTGGGCAAGGTGGGGTGGAGG + Intronic
954947568 3:54439835-54439857 GGAGGGGGAAAGAGGGCAGACGG - Intronic
955064156 3:55520211-55520233 GGGAGGGCAAGGGGGACAGATGG + Intronic
956470930 3:69566200-69566222 GGCAAGGTGAGGAGGGCAGAAGG - Intergenic
956733085 3:72214631-72214653 AGCTGGGTAAGGAGGGAAGTGGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956842933 3:73156840-73156862 AGCTGCTCAAGGAAGGCAGAAGG + Intergenic
956915176 3:73863167-73863189 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
957034908 3:75284991-75285013 GCCTGTGCAAGGAGGGCAGTGGG - Intergenic
957054144 3:75431437-75431459 CCCTTGGAAAGGAGGGCAGAGGG + Intergenic
957372182 3:79309327-79309349 GGGAGGCCAAGGTGGGCAGAAGG + Intronic
957497266 3:81008015-81008037 GTCTGGGCAAGAAAGGCAGCTGG + Intergenic
958549192 3:95592819-95592841 AGCTGCTCAAGGAAGGCAGAAGG + Intergenic
958870158 3:99548909-99548931 GCCTGGGCAAAGAGGGAAAAGGG - Intergenic
959082152 3:101813341-101813363 GGCGGGGCAGGGAGGGCTGCGGG - Intronic
959754087 3:109875639-109875661 GCCTGGGCATGGAGCACAGAGGG - Intergenic
959963983 3:112333239-112333261 GGCTTGGGAAGGAGGGCGCAGGG + Intronic
961300694 3:125920276-125920298 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
961304684 3:125949864-125949886 ACCTGTGCAAGGAGGGCAGTGGG + Intergenic
961346869 3:126268641-126268663 GGCGGGGAAAGGGGGGCAGCAGG + Intergenic
961562146 3:127738059-127738081 GGGAGGCCAAGGTGGGCAGATGG + Intronic
961649012 3:128408275-128408297 GGCTGGGCAAGGAGGCCCTGGGG - Exonic
961798074 3:129424147-129424169 GGCTGGGCACCGAGGACACAGGG - Intronic
961834984 3:129650330-129650352 GGTTGTGCAAGGAGAGCAGGAGG - Exonic
961934823 3:130571920-130571942 GGGAGGCCAAGGGGGGCAGATGG - Intronic
962130551 3:132669506-132669528 GGGAGGGCTAGGTGGGCAGATGG - Intronic
962272259 3:133986504-133986526 TGCAGGGCAGGGAGGGCAGGAGG + Intronic
962298483 3:134215316-134215338 AGCTGGCCAATGAGGGCACAGGG + Intronic
962443042 3:135440387-135440409 GGCAGGGCTAGGAGGCCAGGTGG - Intergenic
962637564 3:137346642-137346664 GGGAGGCCAAGGTGGGCAGAGGG - Intergenic
962960539 3:140307340-140307362 GGAAGGGCAAGGAGAGCAGGAGG - Intronic
963085226 3:141429885-141429907 GGCAGCGCAAGGAGTGCAGTGGG + Intronic
963169509 3:142236686-142236708 GGGAGTTCAAGGAGGGCAGATGG - Intergenic
964344637 3:155744106-155744128 GCCTCGGGAAGGAGGGGAGAGGG + Intronic
964549200 3:157868029-157868051 AGCTGGGCAAAGAGTGAAGATGG + Intergenic
964629601 3:158795752-158795774 GGGAGGCCAAGGAGGGCGGATGG - Intronic
964907350 3:161733750-161733772 GACTGGGCAAGGAGGGTGGGAGG - Intergenic
964927311 3:161975120-161975142 GGGAGGCCAAGGAGGGCTGAGGG - Intergenic
966098989 3:176243084-176243106 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
966313951 3:178625018-178625040 AGCAGGGCAAGGAGGGCACAGGG + Intronic
967666035 3:192173124-192173146 GGTTGGGGAAGGAGGTGAGAGGG + Intronic
967983216 3:195077861-195077883 GGCTGGGCACGGGGAGCGGAGGG - Intronic
968044224 3:195614749-195614771 TACTGGGCAAGGAAGGCAGGGGG + Intergenic
968074591 3:195809516-195809538 AGCTGGGCCAGGAGAGGAGATGG - Intronic
968086628 3:195876808-195876830 GCCCGGGCAAGGCGGGCAGTGGG - Intronic
968267016 3:197370160-197370182 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
968317358 3:197736341-197736363 GACTGGGCGAAGAGGCCAGAGGG - Intronic
968549173 4:1213648-1213670 GGCTGGGTACGGAGGGGAGGTGG + Intronic
968551529 4:1226055-1226077 GGTGGGGCATGGAGGGCGGAAGG - Intronic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
968616286 4:1579177-1579199 GCCAGGGCAGGGAGGGCAGGGGG - Intergenic
968905153 4:3447471-3447493 GGCTGTGCAAGGGGGGCTGGAGG - Exonic
968929808 4:3572896-3572918 GGCTGGAGAAGCAGGGCAGAGGG - Intergenic
969036938 4:4262027-4262049 GGGTGGGGATGGAGGGCACAAGG - Intergenic
969261261 4:6035633-6035655 TGCTGGAGAAGGAGGGCCGAGGG + Intronic
969370194 4:6727132-6727154 GGCTGGGCCAAGAGTGCAGCCGG - Intergenic
969486306 4:7474271-7474293 GGCTGGGCAGTGAGGTCAGCGGG + Intronic
969605780 4:8201611-8201633 GGCTGGGCCTGCAGGGCTGAGGG + Intronic
969757062 4:9156936-9156958 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
971030603 4:22633744-22633766 GGCTGGGTTAGGGGGGCTGAAGG - Intergenic
971341985 4:25779155-25779177 GGCTGCGCAAGGTGGACACATGG - Exonic
971407867 4:26339058-26339080 GGGAGGCCAAGGTGGGCAGACGG - Intronic
971582314 4:28357464-28357486 GGGAGGCCAAGGAGGGTAGATGG + Intergenic
971614066 4:28764638-28764660 GCCTGGGCATGGAGTGAAGAGGG - Intergenic
971759090 4:30741431-30741453 GGGAGGCCAAGGCGGGCAGATGG - Intronic
972314213 4:37910662-37910684 GGCTGGGGAGTGAGGGGAGATGG + Intronic
972381656 4:38525307-38525329 GGCTGGGGAAGGAGGCCCGGTGG - Intergenic
972609671 4:40645028-40645050 GGGAGGCCAAGGAAGGCAGATGG - Intergenic
972632874 4:40857178-40857200 GGCGGGGCAGGGAGGGCGCAGGG - Intronic
972732928 4:41813033-41813055 GGGTGTGGAAGGAAGGCAGAAGG - Intergenic
972786974 4:42335532-42335554 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
973334127 4:48938666-48938688 GCCTGGGCAGGCAGGGTAGACGG + Intergenic
973737704 4:53888798-53888820 GCCAGGGGATGGAGGGCAGAGGG + Intronic
973801465 4:54482826-54482848 GCCTGGGGAAGGAGGACAGGAGG - Intergenic
974416835 4:61618954-61618976 GGAGGCCCAAGGAGGGCAGACGG - Intronic
975443326 4:74436871-74436893 GGCAGGGCAGGGAGGGTAGCGGG + Intergenic
975877556 4:78860952-78860974 GCCTGGAAAATGAGGGCAGAAGG - Intronic
976576347 4:86676851-86676873 GACTGGGCAGAGAGGGTAGAGGG + Intronic
976927653 4:90520827-90520849 GGCTGGGGCAGGATGGCAGGAGG + Intronic
977591046 4:98827595-98827617 TGCTGGGCAAGGACAACAGAGGG - Intergenic
977810211 4:101348078-101348100 GGCGGGGATAGGAGGGAAGAGGG + Intronic
977983345 4:103352581-103352603 GGCTGGGAAGGGAAAGCAGAGGG - Intergenic
978795380 4:112703302-112703324 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
979546066 4:121941431-121941453 TGAAGGGCAAGAAGGGCAGATGG + Intronic
979691677 4:123565651-123565673 GGCTGGGCAACCAGGGAAGTAGG - Intergenic
979809814 4:125022322-125022344 GGCAGAGACAGGAGGGCAGAAGG + Intergenic
980092433 4:128456348-128456370 AGCAGGGCAAGGGGGGCACACGG + Intergenic
980537569 4:134148696-134148718 TGCTGTGCAATGAGGGTAGAAGG - Intergenic
980722525 4:136716914-136716936 TGCAGGGAAGGGAGGGCAGAGGG - Intergenic
981202746 4:142000635-142000657 GGCTGGGCAAAGTGGGAATAAGG + Intergenic
982134144 4:152257972-152257994 GGCTGGGGCAGGAAGGAAGAAGG + Intergenic
984400069 4:179251988-179252010 GGCTGGGCCAGCCGGCCAGAAGG - Intergenic
985089441 4:186348424-186348446 GGCTGGGGAGGGGGGGCAGGTGG - Intergenic
985487124 5:158185-158207 GGCAGGGGGAGGAGGGGAGATGG - Intronic
985521158 5:374423-374445 GGCTGAGCCTGGAGGGCAGGAGG + Intronic
985523765 5:391524-391546 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523780 5:391573-391595 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523807 5:391671-391693 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523822 5:391720-391742 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523837 5:391769-391791 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
986172269 5:5324600-5324622 GCATGGGCAAGAGGGGCAGATGG + Intergenic
986316374 5:6591204-6591226 GGCTGGGCAAGGGGGTGGGAGGG + Intergenic
986445401 5:7816513-7816535 GGAGGGGAAAGGAGGGAAGAAGG + Intronic
987062694 5:14257565-14257587 GGGTGGGGAAGGGGGACAGACGG + Intronic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
988798999 5:34678850-34678872 GGAAGGACAAAGAGGGCAGAGGG - Intronic
988824672 5:34923515-34923537 GGGAGGCCAAGGCGGGCAGATGG - Intronic
990312032 5:54549369-54549391 AGGTGGGCAAAGTGGGCAGAAGG - Intergenic
990534217 5:56704192-56704214 GGCTGGGCCAGGACGGCATGGGG - Intergenic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
991921581 5:71662779-71662801 GGCTAGGGAAGGTGGGCCGAGGG + Intergenic
992487757 5:77211499-77211521 GGCGGGGAAGGGAGCGCAGAAGG + Intronic
993669810 5:90747028-90747050 TGTTAGGCAAGGAAGGCAGATGG + Intronic
994399725 5:99264072-99264094 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
995903145 5:117093446-117093468 GTCTGGGAAAGGTGGGAAGAGGG - Intergenic
996339089 5:122416382-122416404 GGCTGAGGAAGGAGGACAGAAGG - Intronic
996477590 5:123938494-123938516 GGCTGGCAAAGAAGGGAAGATGG + Intergenic
996688004 5:126305603-126305625 GGTTGGGCAAGGAGAGCACCAGG + Intergenic
996698638 5:126425862-126425884 GGGTGGGGAAGGAGGGAATAGGG + Intronic
996994450 5:129678050-129678072 GGGAGGTCAAGGTGGGCAGATGG - Intronic
997013275 5:129904177-129904199 AGCTGGGGGAGGAGGGAAGAGGG + Intergenic
997013355 5:129904426-129904448 GGCTCGGGAAGGAGGGAGGAGGG + Intergenic
997207216 5:132056969-132056991 GGATGGGCAGGGAGGCCAGCTGG - Intergenic
997426326 5:133805145-133805167 GGCTGGGAAATGAGGGGAGGTGG - Intergenic
997512371 5:134462407-134462429 AGCCAGGCAAGGAGGGCAGATGG + Intergenic
997516042 5:134490669-134490691 AGCTGGGTAAGGAGGGAAGGCGG - Intergenic
997925840 5:138030744-138030766 GGCTGGGCAAGGTGGCAAGGTGG + Intronic
997972931 5:138419137-138419159 GTCAGGGCAAGGAGGCCTGATGG - Exonic
998130649 5:139649634-139649656 GGCTGGGAAAGGAGGGAGGGAGG - Intronic
998385748 5:141756267-141756289 TGCTGGGGAGGGAGAGCAGAGGG + Intergenic
998506823 5:142679040-142679062 CGATGGGCTAGAAGGGCAGATGG - Intronic
998963533 5:147512636-147512658 GGGGGGCCAAGGTGGGCAGATGG - Intergenic
999093416 5:148957208-148957230 GGCTGTGCAGGGCTGGCAGAGGG - Intronic
999318071 5:150596823-150596845 GTCAGGGCAAGGAGGCTAGAAGG + Intergenic
999323798 5:150630717-150630739 GGCTGGGCAGGGATGGAGGAGGG - Intronic
999817015 5:155187249-155187271 GGAAGGGTAAGGAGGGCAGGTGG - Intergenic
999911894 5:156210200-156210222 GGCTGGCCTAGGTGAGCAGATGG - Intronic
1000046760 5:157528238-157528260 GGCTGGGAAAGTAAGGCAGGTGG + Intronic
1000091113 5:157930391-157930413 GGGTGGCCAAGGCAGGCAGATGG + Intergenic
1000294117 5:159898040-159898062 GGCTGGGCAGGGTGAGGAGAGGG - Intergenic
1000346958 5:160322258-160322280 GGTTGGGAAAAGAGGGAAGAGGG - Intronic
1000357644 5:160416131-160416153 GGGAGGCCAAGGTGGGCAGATGG - Intronic
1000684502 5:164230374-164230396 GGGTGGCCAAGGTGGGCAGATGG + Intergenic
1000878681 5:166671301-166671323 GGGAGGCCGAGGAGGGCAGATGG + Intergenic
1001288652 5:170441156-170441178 TGCTGGGCTGGGAGGGCAGCTGG - Intronic
1001382702 5:171314790-171314812 GGCTGGGCAAGGCTGGGTGAGGG - Intergenic
1001651497 5:173319191-173319213 GGGTGGACAAGGTGTGCAGAAGG + Intronic
1001886090 5:175291700-175291722 AGCTGGGCCATCAGGGCAGAAGG - Intergenic
1001964931 5:175903387-175903409 GTCTGGTCAAGGAGGTCAGAAGG + Intergenic
1002063957 5:176643008-176643030 GGATGGGCAGGGTGGGCACAGGG + Intronic
1002252024 5:177935801-177935823 GTCTGGTCAAGGAGGTCAGAAGG - Intergenic
1002635045 5:180603132-180603154 GGCCCGGCAGGGCGGGCAGAGGG - Exonic
1002990389 6:2232985-2233007 GGCTGGGAAAGGAGGGGATGGGG + Intronic
1003241748 6:4351212-4351234 TGCTGGGGAAGGAGGGGAAATGG - Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1004288518 6:14345576-14345598 GGCTGGGCAATGGTGGCAGCTGG - Intergenic
1004488947 6:16095525-16095547 GGGTGGACAAGGAGAGAAGAGGG - Intergenic
1004955590 6:20724475-20724497 GGGAGGCCAAGGAGGACAGATGG + Intronic
1005666722 6:28064898-28064920 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
1006026924 6:31152884-31152906 GGCGGGGACAGGAGGCCAGAAGG - Intronic
1006085282 6:31590660-31590682 GGCTGGAGAATGATGGCAGAGGG - Intronic
1006368947 6:33632788-33632810 GGCTGGTCCTGGAGGGGAGAAGG + Intronic
1006635046 6:35456007-35456029 GGCTGGGCCTGGGGGGCAGGAGG + Exonic
1006732574 6:36247253-36247275 GGCTGGGAAAGGAGGGAGTAGGG - Intronic
1007125602 6:39423183-39423205 GGCTGGGCTTGGAAGGGAGAAGG + Intronic
1007422502 6:41728235-41728257 GGCTGGCCAAGCAGGGCGGGTGG - Intronic
1007513312 6:42391420-42391442 GGCTGGGAAATAATGGCAGATGG - Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007625183 6:43242484-43242506 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
1008231738 6:48991015-48991037 TGCTGGGCAGAGTGGGCAGAAGG + Intergenic
1008372930 6:50756325-50756347 GGCTGGGAAAGAAGTGAAGAGGG + Intronic
1008583433 6:52927178-52927200 GGTTGGGGGAGGAGGGCAGCAGG - Intergenic
1008590259 6:52986856-52986878 GGATGGGCAAGGAGGGAGCAGGG + Intronic
1008663827 6:53696777-53696799 GGCTGGGCAGGCAGGGCACTAGG - Intergenic
1009656911 6:66558847-66558869 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
1010086015 6:71918907-71918929 GGCTGGGCAAGAAAGAGAGAAGG + Intronic
1011382973 6:86762493-86762515 AGGTGGGCAAGGAGGAAAGAGGG - Intergenic
1011469201 6:87690731-87690753 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1011623185 6:89261796-89261818 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1011980802 6:93375374-93375396 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1013542544 6:111124600-111124622 GGAAGGCCAAGGCGGGCAGATGG - Intronic
1013591096 6:111620236-111620258 GCAAGGGCAAGGAGGGCAAAGGG - Intergenic
1014677013 6:124379207-124379229 GGGAGGGAAAGGAGGGAAGAGGG + Intronic
1015614693 6:135062801-135062823 GGCTGGCCAAGAAGGGAAGATGG - Intronic
1015737862 6:136420325-136420347 GGCTGGGCACGCAGGGCAAGCGG - Intronic
1015789822 6:136955253-136955275 GGATGGGCAAGGATGGGAGTAGG + Intergenic
1015823208 6:137284445-137284467 GGCTGGGAAAGGAGGGAAGATGG + Intergenic
1015937768 6:138420069-138420091 AACTGGGCAAGGAGTACAGAGGG - Exonic
1016714025 6:147203834-147203856 GGCTGGGCGGGGAGAGCCGACGG + Intergenic
1016798434 6:148143120-148143142 GGCTGGGGAAGGAGGATGGAGGG + Intergenic
1016827820 6:148404695-148404717 GGCTGGGCTTGGGGGGCAGGTGG - Intronic
1017796550 6:157850046-157850068 GCCTGGGCAAGGAGAGAAGGTGG + Intronic
1018033860 6:159865619-159865641 CACTGGGCAAGGAGGGGAAAGGG + Intergenic
1018225942 6:161629000-161629022 GGCAGGCAAAGGAGTGCAGAAGG + Intronic
1018391865 6:163347001-163347023 CCCTGGACAAGGAGGGCACATGG - Intergenic
1018730827 6:166649221-166649243 GGCAGGGGCAGGAGCGCAGACGG - Intronic
1018902413 6:168058230-168058252 GGCTGGGCACGGGAGGCGGATGG - Intronic
1018902443 6:168058375-168058397 GGCTGGGCACGGGAGGCAGATGG - Intronic
1018957422 6:168419576-168419598 GGCTGGGGAAGGGGGAGAGAGGG + Intergenic
1019409869 7:901748-901770 GGCGGGGGAAGGAGGGGAGGCGG - Intronic
1019697064 7:2451857-2451879 GGCTGGACCAGGAGGGCACTGGG + Intergenic
1020137994 7:5597104-5597126 GGGAGGCCAAGGAGGGAAGATGG + Intronic
1020262120 7:6536471-6536493 GGCTGGGAAAGGCGGGCATGGGG + Intronic
1020412231 7:7905301-7905323 GGATAGGGAAGGAGGGGAGAGGG + Intronic
1020541759 7:9467734-9467756 GGCTGGCAAAGAAGGGAAGATGG + Intergenic
1021747091 7:23752578-23752600 GGGAGGCCAAGGAGGACAGATGG - Intronic
1021874579 7:25036636-25036658 GAGAGGGCAAGGAGAGCAGAGGG + Intergenic
1022307143 7:29157324-29157346 GGCTGGGCATTGAGTGGAGAAGG - Intronic
1022363534 7:29685677-29685699 GGCTGGGGGAGGAGGGAAGGTGG - Intergenic
1022427753 7:30284848-30284870 GGCTGGGGGAGGAGGGAAGGTGG + Exonic
1022472830 7:30692310-30692332 AGCTGGGGAAGGGGGGCACAGGG - Intronic
1022528107 7:31051353-31051375 GGCTGGGTGGGGTGGGCAGAGGG + Intergenic
1022533122 7:31079307-31079329 GGCTGGGCAGGGAGAGCTGGAGG + Intronic
1022697840 7:32728067-32728089 GGCTGGGGGAGGAGGGAAGGTGG + Intergenic
1022728854 7:33004385-33004407 GGCCGGGTAAAGTGGGCAGAGGG - Intronic
1022984422 7:35636887-35636909 GGGTGGTCAAGGCAGGCAGATGG + Intronic
1023009916 7:35917472-35917494 GGAGGGGAAAGGAGGGGAGAAGG - Intergenic
1023037599 7:36147148-36147170 GGATGGGGAAGGAGTGCAGCTGG - Intergenic
1023052648 7:36266730-36266752 GGCTGGGCAAGAGGGGAAGGGGG - Intronic
1023410506 7:39885222-39885244 GGCTGGGGTAGGAGAGCAGGAGG + Intergenic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1025044792 7:55683605-55683627 GGCCGGGTAAAGTGGGCAGAGGG + Intergenic
1025093689 7:56082106-56082128 GGCTGGGCAAGGGAGGAAGTAGG - Intronic
1025145397 7:56496751-56496773 GGCTGGGGCAAGAGAGCAGAGGG + Intergenic
1026019123 7:66694483-66694505 GGCGGGGCCTGGAGGGCAGTGGG + Intronic
1026834373 7:73628311-73628333 GGCTGGGGAAGGAGGGATGTTGG - Intergenic
1026852681 7:73734993-73735015 TGCTGGGAAGGGAGGGCAAAGGG + Intergenic
1026871723 7:73856895-73856917 GGCTTGGCAGGAAGGGGAGAAGG + Intergenic
1027495134 7:78878771-78878793 GCCTGGGCATGGAGTGGAGAAGG - Intronic
1027614379 7:80403118-80403140 AGCTGGGCAAGGGGGGCAGTTGG + Intronic
1028431215 7:90749292-90749314 GACTGGGCATGGAGTGAAGAAGG - Intronic
1028477133 7:91264966-91264988 GGCTGGCGGAGGAGGGCAGCGGG + Exonic
1029159837 7:98543799-98543821 GGCTGGGAAAGGATGGCTGAGGG - Intergenic
1029643498 7:101836481-101836503 TGCTGAGCAAGGAGGGCAGGTGG - Intronic
1029840614 7:103359235-103359257 GGGAGGCCAAGGTGGGCAGATGG - Intronic
1031234916 7:119162763-119162785 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
1031510457 7:122642352-122642374 GACTGGGCAAGGAGAGCCTAGGG - Intronic
1032030307 7:128477317-128477339 GGATGAGCAAGGAGGGAAAAGGG + Intronic
1032097673 7:128947586-128947608 GGATTGGCAAGGAGGGTGGAGGG + Intronic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032707167 7:134431496-134431518 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
1032777895 7:135134075-135134097 GGATGGGAAAGGAGGGAAGCAGG + Intronic
1032793964 7:135262918-135262940 GGTTGCTCAAGGAGGGAAGAGGG + Intergenic
1032849588 7:135782658-135782680 GGATGGGAAAGGAGGGAAGTGGG - Intergenic
1033369278 7:140694479-140694501 GGCTGGGCGAGTAGGTGAGATGG + Intronic
1033414034 7:141146791-141146813 GGGTGGGAAAGGATGGTAGAAGG - Intronic
1033679813 7:143583347-143583369 GCCTGGGCAAGAAGTGGAGATGG - Intergenic
1033692022 7:143746096-143746118 GCCTGGGCAAGAAGTGGAGATGG + Intergenic
1034242156 7:149618859-149618881 GGGTGGCCGAGGCGGGCAGATGG + Intergenic
1034516081 7:151580785-151580807 GGCTGGGAAGGGAGGGTAGTGGG + Intronic
1035003257 7:155634169-155634191 GGCTGGGGAGTGAGGGCAGGAGG - Intronic
1035153409 7:156893223-156893245 GGCGGGGCAGGGAGGGGAGGGGG + Exonic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035423836 7:158753686-158753708 GGCTGGGCCAGGAGAGAAGATGG + Intronic
1036380292 8:8232251-8232273 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
1036424228 8:8628494-8628516 GGCTCACCAGGGAGGGCAGAAGG - Intergenic
1036588860 8:10149449-10149471 GCCTGGGCAGGGAGGGCAGCAGG - Intronic
1037666859 8:20977164-20977186 GGCTGGGCTTGGTGAGCAGATGG + Intergenic
1037673784 8:21037399-21037421 GGCAGGGAAAGGAGAGAAGAGGG + Intergenic
1037879853 8:22567203-22567225 GGCTGGGCTGGGAGGGCGCAGGG + Intronic
1038150399 8:24938258-24938280 AGATAGGGAAGGAGGGCAGAAGG + Intergenic
1038249646 8:25891246-25891268 GGCTGGCCAAGCATAGCAGAAGG + Intronic
1038740254 8:30211053-30211075 GGGTGGGCGTGGAAGGCAGAGGG - Intergenic
1039981146 8:42410893-42410915 GGCTGGGAAGGGAGCTCAGAAGG + Intergenic
1040488074 8:47893270-47893292 GGCTGGGCCAGGATGCCCGAGGG + Exonic
1040846477 8:51847385-51847407 GGGAGGCCAAGGCGGGCAGATGG + Intronic
1040848143 8:51867804-51867826 GGCTGGGGCAGGAGGGTAGATGG + Intronic
1041023187 8:53658553-53658575 GGCTGGGCTAGGGAGACAGAGGG - Intergenic
1041095403 8:54344285-54344307 GGCTGGGCACGGTGGGGAGATGG + Intergenic
1042109700 8:65367596-65367618 GCCTGGGCATGGAGTGTAGAGGG - Intergenic
1042280195 8:67048034-67048056 GGGAGGCCAAGGTGGGCAGAAGG + Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043148917 8:76688386-76688408 GGCTGGGAAGGGAGAGAAGAGGG + Intronic
1043816052 8:84802884-84802906 GGCTGGGAATGGAATGCAGAGGG + Intronic
1044308565 8:90666168-90666190 TGCTGGGCATGGAGCGGAGACGG + Intronic
1044750492 8:95411167-95411189 GGCAGGGGAAGGAGGACAGAAGG - Intergenic
1045320845 8:101080537-101080559 TGCTTGACAAGGAGGGCGGAGGG - Intergenic
1045783238 8:105892358-105892380 GGCTGGGGAAGGGAGGAAGAAGG + Intergenic
1046229609 8:111335728-111335750 GGCTGGGCAAAGGGAGGAGATGG + Intergenic
1046457853 8:114491181-114491203 GGAGGGGAAAGGAGGGCAGGAGG + Intergenic
1047547618 8:125834573-125834595 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1048292601 8:133192034-133192056 GGCAGTGCAAGGAGGGCAGGAGG + Intronic
1048332483 8:133480104-133480126 GGATGGGGAAGGAGGGAAGCTGG + Intronic
1048367543 8:133751630-133751652 GGTTGGGCAAGGAGGAAACAGGG - Intergenic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1049520119 8:143083513-143083535 GGCTGGGCAGGGCGGGTGGACGG - Intergenic
1049549627 8:143251106-143251128 GGCTGGGCCAAGAGGGCACGTGG - Exonic
1049578808 8:143401557-143401579 GGAGGGGAAGGGAGGGCAGAGGG + Intergenic
1049660701 8:143818596-143818618 GGGTGGGCCAGGAGGGGAGTGGG - Intronic
1049795106 8:144493633-144493655 TCCTGGGCAGGGAGGCCAGAGGG + Intronic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050837698 9:10104156-10104178 GGCTGGGAGAGGAGGGAAGGAGG + Intronic
1051214101 9:14778369-14778391 GGCTGGCCAAGGCGGGCAGATGG + Intronic
1051388589 9:16539278-16539300 GGCAGGCCAAGGTGGGCAGATGG + Intronic
1051421385 9:16892870-16892892 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1051792876 9:20827931-20827953 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1052610900 9:30772791-30772813 GGCAGGGCAGAGAGGGCTGAAGG - Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1054460471 9:65459576-65459598 GGCTGGAGAAGCAGGGCAGAGGG + Intergenic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1055206112 9:73732475-73732497 GGATGGGCAAGGCCGGTAGAGGG + Intergenic
1055471627 9:76617684-76617706 GGCTGGGCATGGAGGAGGGAGGG - Intronic
1055505817 9:76948047-76948069 GGCTGGGGAAGGAGGGTGGATGG - Intergenic
1055576148 9:77661824-77661846 GGTTGGGTGAAGAGGGCAGAGGG - Intergenic
1056328248 9:85500191-85500213 GGGTGGGCAAGGAGTGAAGGAGG + Intergenic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057437891 9:95058912-95058934 GGAAGGAGAAGGAGGGCAGAGGG + Intronic
1057572389 9:96214500-96214522 GGATGGGCATGGAGGGCTCAGGG + Intergenic
1057905131 9:98977311-98977333 TGCTGGGCAAGAAGGGAGGAGGG - Intronic
1058113445 9:101056986-101057008 GGCTGGGGACACAGGGCAGAGGG - Intronic
1058525064 9:105849661-105849683 GAGTGGGCAAGGAGAGCACAGGG - Intergenic
1059263230 9:112999721-112999743 CACAGGGCAAGGTGGGCAGAAGG + Intergenic
1059354307 9:113687345-113687367 GGTGGGGAAAGGAGGGAAGAGGG + Intergenic
1059438672 9:114290640-114290662 GGCTGGACCAGGAGGACAGGAGG - Intronic
1059743913 9:117181955-117181977 GGGTGGGGAAGGAGGGCACTGGG - Intronic
1060091800 9:120749552-120749574 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1060105431 9:120870015-120870037 GGCAGGGCTGGGAGGGCTGAGGG + Intronic
1060495935 9:124118596-124118618 GGCTTGGCCAGGAGATCAGAGGG + Intergenic
1060552599 9:124492689-124492711 GGCTGGGGAATGAGGGATGAGGG - Intronic
1060799587 9:126535162-126535184 GGCTGGTGAAGGAGCCCAGATGG + Intergenic
1060850167 9:126868503-126868525 GGCTGGGCAACCAGAGCAGGAGG - Intronic
1060879669 9:127109120-127109142 GGCTGGGGAGGGGAGGCAGAGGG + Intronic
1061113891 9:128596081-128596103 GGGAGGGCAAGCTGGGCAGACGG - Intronic
1061119179 9:128632764-128632786 GCCTGAGCAGGGAGGGCAGGTGG - Intronic
1061179301 9:129014372-129014394 GCCTGGGCCAGGAGGCCAGCGGG + Intronic
1061290580 9:129648651-129648673 GGCAGGAGAAGAAGGGCAGAAGG - Intergenic
1061324230 9:129853133-129853155 GGCTGGGGAGGGTGGGCACAGGG - Intronic
1061452922 9:130678317-130678339 GGCAGGGAGAGGGGGGCAGAGGG + Intronic
1061515528 9:131087812-131087834 GGCTGGGTAAGGAGGCCCTAAGG + Exonic
1061574568 9:131497917-131497939 GGCTTGGCAAGGAGGGCCGGTGG - Exonic
1061609801 9:131739208-131739230 AGCTCTGCAAGGAGGGCAGGTGG - Intronic
1061625278 9:131837677-131837699 GGCCGGGCCAGGAAGGCAGGAGG - Intergenic
1061677685 9:132227688-132227710 GGCTGGGCGAGGACAGGAGAGGG - Intronic
1061970230 9:134040978-134041000 GTCTGTGCAAGGAAGACAGAGGG + Intronic
1062100144 9:134723704-134723726 GGCAGGGGCAGGTGGGCAGAAGG + Intronic
1062106737 9:134759036-134759058 GGCTGAGAAAGCAGGGCAGGCGG - Intronic
1062187545 9:135226819-135226841 GGCTGCACAAGGATGGTAGAGGG - Intergenic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1062321929 9:135994361-135994383 GGCTTGGAAGGGAGGGCAGGCGG + Intergenic
1062344584 9:136109046-136109068 GGCAGGGCGGGGAGGGCAGAGGG - Intergenic
1062399773 9:136367280-136367302 GGGTGGGCTGTGAGGGCAGAGGG + Intronic
1062457712 9:136647245-136647267 GGCTGAGGAAGGACTGCAGAGGG + Intergenic
1062478197 9:136739910-136739932 GGTAGGGCCAGGAGGGCAAAGGG + Intronic
1062479074 9:136743150-136743172 GGCCGGGCACTGAGGGCAGGAGG - Intronic
1062502905 9:136858878-136858900 GCCTGGGCAACGGGGGCAGCAGG + Intronic
1062537517 9:137027483-137027505 GGCTGGCCAAGGCTGGCACAAGG + Exonic
1062549598 9:137079889-137079911 GGGTGGGACAGGATGGCAGAAGG - Intronic
1062610288 9:137370422-137370444 GGCTGGGCCATGAGGACAGATGG + Intronic
1203621685 Un_KI270749v1:133788-133810 GGCCGCGCTAGGAGGGCAGGCGG + Intergenic
1186384416 X:9094404-9094426 GGCTGTGCAAGCTTGGCAGAGGG + Intronic
1187069673 X:15875676-15875698 AGCTGTGGAAGGAGGACAGAGGG + Intergenic
1188483077 X:30653726-30653748 CGCTGGGCAAGGAGGGAGGCCGG + Intronic
1188498499 X:30802286-30802308 GGCAAGGCAAGGAAGGCACAAGG - Intergenic
1188836069 X:34955723-34955745 GGCTGGACCAGGAAGGCAGAAGG - Intergenic
1189134520 X:38534529-38534551 GGTTGGGGAAGGAAGGTAGAGGG - Intronic
1189259700 X:39669633-39669655 GGCAGAGCAAGGATGGCTGATGG - Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1189328283 X:40126613-40126635 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1189422445 X:40868190-40868212 GGCTGGGGAGGGTGGGGAGATGG - Intergenic
1189505793 X:41612181-41612203 GACTGGGCAAGCCAGGCAGAGGG - Intronic
1190201797 X:48368126-48368148 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
1190208742 X:48427285-48427307 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
1190322556 X:49187343-49187365 GGTTAGGCAAGGAGGGGAGGTGG - Intergenic
1190480263 X:50870325-50870347 GGCTGACCAAGGAGGACAGGTGG + Intergenic
1191178581 X:57534812-57534834 GGCTGGGAGAGGTGGACAGATGG - Intergenic
1191611078 X:63114372-63114394 GCCTGGGCATACAGGGCAGAGGG - Intergenic
1191807919 X:65155195-65155217 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1192072082 X:67951738-67951760 GACTGGGCAAGGTAGGCAGAAGG - Intergenic
1194298267 X:92154674-92154696 GGCTGGTCATCCAGGGCAGATGG + Intronic
1194923554 X:99796317-99796339 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
1195197776 X:102516466-102516488 GGCTCGGCATCGAGCGCAGAAGG + Intronic
1195431155 X:104791153-104791175 GGCAGGGCAGGCAAGGCAGAGGG - Intronic
1195516572 X:105783404-105783426 GCCTGGGGAAGGAGGGAAGTAGG - Intergenic
1195728039 X:107937184-107937206 GGCGGGGGACGGAGGGCGGAGGG - Intergenic
1196221076 X:113112772-113112794 GGCCTGGCGAGGAGGTCAGATGG + Intergenic
1196371027 X:114980089-114980111 GGCTTGGCAGGGATTGCAGAAGG + Intergenic
1196680001 X:118460929-118460951 GGCTGGGCAAGGTAAGCACAAGG + Intergenic
1197033886 X:121851962-121851984 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
1197279509 X:124518419-124518441 GGGCGGGCAGGGAGGGCAAATGG + Intronic
1197324400 X:125074353-125074375 GTCTGGGCAAGTAGGTTAGAAGG - Intergenic
1198311141 X:135426374-135426396 GGCGGGGGAGGGAGGGCAGAGGG + Intergenic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1199489144 X:148379543-148379565 GGCAAGACAAGGAGGACAGAGGG + Intergenic
1199963680 X:152800442-152800464 GGGAGGCCGAGGAGGGCAGATGG + Intergenic
1200002118 X:153067497-153067519 GGCTGGGCAAGGAGGGTCTAAGG - Intergenic
1200005615 X:153082528-153082550 GGCTGGGCAAGGAGGGTCTAAGG + Intergenic
1200059485 X:153477919-153477941 GGCTGGTCAAGGTGGGGAGGAGG - Intronic
1200072882 X:153537709-153537731 GGCTGGGCAAGGAGGAGGGAAGG - Intronic
1200088538 X:153623683-153623705 GGCTGGGCCAGGAGGAGGGAGGG + Intergenic
1200097675 X:153671825-153671847 GGCAGGGCCAGGTGGGCAGGTGG + Intronic
1200226168 X:154419075-154419097 GGCTGGGGAGGGAGGGCAGGTGG + Intronic
1200532931 Y:4359435-4359457 GGCCTGGCGAGGAGGGGAGAGGG + Intergenic
1201189734 Y:11436379-11436401 GGCCGTGCTAGGAGGGCAGGTGG + Intergenic
1201271938 Y:12264031-12264053 AGCTGCTCAAGGAAGGCAGAAGG + Intergenic
1201904907 Y:19077856-19077878 CACTGGGCAAGGAGAGCAGTGGG + Intergenic