ID: 1151662519

View in Genome Browser
Species Human (GRCh38)
Location 17:75526157-75526179
Sequence CTGGCGCCTGCACGTGGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151662519_1151662526 -9 Left 1151662519 17:75526157-75526179 CCGGGCCCACGTGCAGGCGCCAG 0: 1
1: 0
2: 1
3: 30
4: 221
Right 1151662526 17:75526171-75526193 AGGCGCCAGGCCAGCGGGGTTGG 0: 1
1: 0
2: 2
3: 16
4: 215
1151662519_1151662532 28 Left 1151662519 17:75526157-75526179 CCGGGCCCACGTGCAGGCGCCAG 0: 1
1: 0
2: 1
3: 30
4: 221
Right 1151662532 17:75526208-75526230 GGTGACCCCCTCCCCACGGGCGG 0: 1
1: 1
2: 0
3: 15
4: 160
1151662519_1151662529 7 Left 1151662519 17:75526157-75526179 CCGGGCCCACGTGCAGGCGCCAG 0: 1
1: 0
2: 1
3: 30
4: 221
Right 1151662529 17:75526187-75526209 GGGTTGGCGACGCGCGTCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1151662519_1151662531 25 Left 1151662519 17:75526157-75526179 CCGGGCCCACGTGCAGGCGCCAG 0: 1
1: 0
2: 1
3: 30
4: 221
Right 1151662531 17:75526205-75526227 TGCGGTGACCCCCTCCCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 143
1151662519_1151662530 24 Left 1151662519 17:75526157-75526179 CCGGGCCCACGTGCAGGCGCCAG 0: 1
1: 0
2: 1
3: 30
4: 221
Right 1151662530 17:75526204-75526226 CTGCGGTGACCCCCTCCCCACGG 0: 1
1: 0
2: 0
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151662519 Original CRISPR CTGGCGCCTGCACGTGGGCC CGG (reversed) Intronic
900159769 1:1217957-1217979 CTGGCGACAGCCAGTGGGCCCGG - Intronic
900318053 1:2069245-2069267 CTGGGGCCTGCAGCTGGGGCTGG - Intronic
900480500 1:2895868-2895890 CTGGCGGCTGCAGGTGGTTCTGG - Intergenic
901118500 1:6869232-6869254 CTGGCGCCTGGGAGTGGGGCAGG + Intronic
901139825 1:7021296-7021318 CTGGAGCCTGCACCTGAACCGGG + Intronic
901559451 1:10058657-10058679 CTGCCGCCTGCAGGTGGGCAAGG + Intronic
902796757 1:18805299-18805321 CTGGCGGCTGCATGTGGGAAAGG - Intergenic
903261060 1:22132110-22132132 CTGTGGCCTGAACGTGGACCTGG - Intronic
905284291 1:36869201-36869223 CTGGAGCCTGTAGGTGGGCTGGG + Intronic
905395467 1:37663785-37663807 CGGGCGCCTGCACCTTGGGCGGG - Intergenic
905824930 1:41020312-41020334 CTGGCGCCTGCAGACGGCCCTGG - Exonic
905923997 1:41737001-41737023 CTGGTGCCTGGAGGTGGGGCAGG - Intronic
907483265 1:54759102-54759124 CTGGCGGCTGCAGGTGGCCAGGG + Exonic
908169089 1:61487223-61487245 CTGGGGCCTGCCCCTGGGCCTGG - Intergenic
908747874 1:67393545-67393567 CTGGCCCTGGCACGTGGGTCTGG - Intronic
911127612 1:94355022-94355044 CTGGTCCCTGCAGGTGGGCATGG - Intergenic
912385969 1:109271317-109271339 CTGGTGCCTGCCCATGGCCCAGG - Intronic
915814501 1:158952200-158952222 CTAGCTCCTGCAGCTGGGCCTGG + Intronic
916684722 1:167134053-167134075 CTCTTGCCTGCACCTGGGCCAGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
919925394 1:202189350-202189372 CTGACACATCCACGTGGGCCTGG + Intergenic
921339683 1:214122222-214122244 CTGGCGCCTTCATGTAGGCTTGG - Intergenic
922606088 1:226890793-226890815 CTGGCGTCTGCAAGGTGGCCTGG + Intronic
922795932 1:228339844-228339866 CTGGCCCCTGCACAAGGGCTGGG - Intronic
1062840513 10:666717-666739 CTGGGGTCTGGACGTGGGCCTGG + Intronic
1063096480 10:2913245-2913267 CAGGCACCTGCACGCGGGACAGG + Intergenic
1063096492 10:2913285-2913307 CAGGCACCTGCACGCGGGACAGG + Intergenic
1063524546 10:6772780-6772802 CTGCGGGCTGCACGTGGCCCAGG - Intergenic
1065845104 10:29736936-29736958 CGGGCGCCTGCCCGCTGGCCGGG - Intergenic
1069623296 10:69851038-69851060 CAGGGGCCAGCACATGGGCCAGG + Intronic
1070768259 10:79068565-79068587 CTGGGGCCTGCAGGGGGGCTGGG + Intergenic
1070769054 10:79071633-79071655 CCGGCCCCTGCACTGGGGCCAGG - Intronic
1073495596 10:103888221-103888243 CTGGGGCCTGGACCTGTGCCAGG - Intronic
1075616344 10:123892893-123892915 CTGGTCCTCGCACGTGGGCCCGG + Intronic
1076944641 10:133637792-133637814 CCGGGGCCTGCAGGTGGCCCTGG - Intergenic
1076963435 10:133786056-133786078 CTGGCGCCAGCACGGGGCGCTGG + Intergenic
1077167118 11:1148733-1148755 CTGGCACCTGAATGTGGTCCTGG - Intergenic
1077278990 11:1733448-1733470 CCAGCACCTGCCCGTGGGCCTGG - Exonic
1077468540 11:2745808-2745830 CTGCCGCCTGCTCCTGGTCCTGG - Intronic
1077474126 11:2778436-2778458 CTGGGGCCTCCACTTGGGGCCGG + Intronic
1077497993 11:2896003-2896025 CAGGCACCTGCCCGAGGGCCTGG - Intronic
1077499557 11:2903028-2903050 CCGACCCCTGCAGGTGGGCCAGG - Intronic
1077910380 11:6567579-6567601 CTGGGTCCTGCACCTGGGCCAGG + Exonic
1081675569 11:44967092-44967114 CTGGTGCCTGCACAGGGGTCTGG + Intergenic
1083443232 11:62690509-62690531 CAGGAGCCTGAACCTGGGCCAGG + Exonic
1083951443 11:65958867-65958889 CTGGCGCCTGCAGGGGAGACAGG - Exonic
1084110343 11:67010354-67010376 CTGGAGCCTGGACCTGGGCAAGG - Intronic
1084174782 11:67417526-67417548 CTGGCGCCAGGACGTGGGCCTGG + Exonic
1084489696 11:69471665-69471687 CTGGCCCCGGCCCGTGGACCAGG - Intergenic
1089219567 11:116859400-116859422 CTGGAGCCTGCAGCTGTGCCTGG + Exonic
1089729431 11:120511441-120511463 CTTGCGGCTGCCCGGGGGCCCGG - Intergenic
1090029516 11:123195142-123195164 CTGGCGCCCGGACGGGAGCCGGG + Exonic
1090189852 11:124760570-124760592 CGGGCGCCTGCACGTTGCACCGG + Intronic
1100621844 12:96284316-96284338 CAGGCGCCTGCCCCTGCGCCTGG - Intronic
1102471493 12:113162229-113162251 CTGCCGCCAGCACTGGGGCCTGG + Intronic
1104434076 12:128742084-128742106 CTGGCTCTTACACGTGGGCACGG + Intergenic
1104771650 12:131367725-131367747 CTGATGTCTGCAGGTGGGCCTGG - Intergenic
1104949643 12:132433687-132433709 CTGGCATCTGCACGTGGCCTCGG + Intergenic
1110224643 13:73106575-73106597 CTGGCCACTGCACTTCGGCCTGG + Intergenic
1115342374 14:32306189-32306211 CTGGGGGCTTCCCGTGGGCCAGG + Intergenic
1119643594 14:76331798-76331820 CTGGTCCCTGCACCTGTGCCAGG + Intronic
1119749808 14:77069077-77069099 TGGGCACCTGCACCTGGGCCTGG - Intergenic
1122138759 14:99649879-99649901 CCGGCAGCTGCACGTGGACCAGG - Intronic
1122251286 14:100441583-100441605 CTGGGGCCTGCAGATGGGCTGGG + Intronic
1122504679 14:102224728-102224750 CTGGCGCCTTCGAGTGGGGCAGG - Intronic
1123018328 14:105386021-105386043 CTGAAGCCTGCAGGTCGGCCAGG + Intronic
1202926605 14_KI270724v1_random:31462-31484 CCGGGGCCTGCAGGTGGCCCTGG + Intergenic
1124079236 15:26475748-26475770 CTGACCCCTGCAGGTGGGTCTGG + Intergenic
1124333774 15:28842389-28842411 CTGGAGCCTGCACGAGAGGCCGG - Intergenic
1125508280 15:40279874-40279896 CTGCCGCCTCCCCGCGGGCCAGG + Intronic
1125722070 15:41849994-41850016 CTGGCGCCTGCAGATGGTCTGGG - Intronic
1127797848 15:62453967-62453989 CTGGCACCTGGGGGTGGGCCTGG - Intronic
1128161060 15:65423006-65423028 CTGGGGCCGGCGCGGGGGCCAGG + Exonic
1128906768 15:71474360-71474382 CAGGCGCCTGCCCCTGTGCCTGG + Intronic
1129356640 15:74996112-74996134 CTAGCGCCTGCAGGTGGACCCGG + Intronic
1129738893 15:77980297-77980319 CAGGTCTCTGCACGTGGGCCAGG - Intergenic
1129847370 15:78774102-78774124 CTGGGGCCTGCCAGTGGGGCTGG + Intronic
1133118967 16:3594837-3594859 CTGGCATCTCCACGGGGGCCAGG - Intronic
1133201582 16:4207336-4207358 CTGGCCTCTGCAGCTGGGCCGGG + Intronic
1135587737 16:23683766-23683788 CTGGGGGCTGCATGTGGGCTGGG + Intronic
1136448745 16:30340202-30340224 CATGCCCCTGCACCTGGGCCAGG + Intergenic
1137013161 16:35344461-35344483 CTGGGGCCTGCAGGTGGCCCTGG - Intergenic
1137019867 16:35414648-35414670 CTGGGGCCTGCAGGTGGCCCTGG - Intergenic
1138488429 16:57361637-57361659 CTGGGGCCTGCACCTGCACCTGG + Intronic
1139435007 16:66931599-66931621 CTTGCCACTGCACCTGGGCCTGG + Intergenic
1140033873 16:71358667-71358689 CTGGAGCCTGCGCCTGCGCCCGG - Intergenic
1140424744 16:74851358-74851380 CGGGGCCCTGCAGGTGGGCCTGG - Intergenic
1141164818 16:81653327-81653349 CTGGCCGCTGCCCGTGGGACGGG + Intronic
1141535113 16:84673735-84673757 CTGTCACGTGCACCTGGGCCAGG + Intergenic
1141624110 16:85252501-85252523 CTGGCGCCTGCAGATGGGCTTGG - Intergenic
1141728521 16:85806885-85806907 CCTGCGCCTGCACCTGCGCCTGG + Exonic
1142047118 16:87932660-87932682 ATGTCCCCTGCACCTGGGCCAGG - Intronic
1142178376 16:88655525-88655547 TTGGCTCCTGCACGTGGTCTTGG + Intronic
1142223254 16:88865479-88865501 CTGGCGCCCGGCCATGGGCCAGG - Intronic
1142240952 16:88944797-88944819 CTAGCGCCTGCCCTTTGGCCAGG - Intronic
1142406700 16:89894208-89894230 CCGGGGGCTGCACGGGGGCCGGG - Intronic
1142747480 17:1967112-1967134 CTGGGGCCTGCAGAGGGGCCTGG - Intronic
1144771338 17:17761319-17761341 CTGGTGGCTGCATGTGTGCCAGG - Intronic
1145217826 17:21065552-21065574 CTGGCGCCACACCGTGGGCCTGG - Intergenic
1145764460 17:27448786-27448808 CTTGAGCCTGCTCGAGGGCCTGG + Intergenic
1145827654 17:27889239-27889261 CTGGGGCCCTCACGTGGCCCTGG + Intronic
1147573699 17:41586814-41586836 CTGGCGGCTGCAGGTGGTCATGG + Exonic
1147577814 17:41612668-41612690 CTGGCGGCTGCAGGTGGTCATGG + Exonic
1150250280 17:63700790-63700812 GAGGAGCCTGCACGAGGGCCCGG + Intronic
1150802040 17:68290635-68290657 CTGGCGCGCGCACGCAGGCCGGG - Intronic
1151662519 17:75526157-75526179 CTGGCGCCTGCACGTGGGCCCGG - Intronic
1155928219 18:31680236-31680258 CTGGCCCTGGCAAGTGGGCCTGG - Intronic
1157763795 18:50283000-50283022 CTGGCACCTGCAAGGAGGCCAGG + Exonic
1157901979 18:51526716-51526738 CAGGGGCCTGCAGGTGGTCCTGG - Intergenic
1160575694 18:79852656-79852678 CCAGCGCCTGCACCTGGGCGTGG + Intergenic
1160659818 19:292632-292654 CAGACACCTGCACGTGGGGCAGG + Intergenic
1160756156 19:758047-758069 GGAGGGCCTGCACGTGGGCCGGG + Exonic
1160902298 19:1434580-1434602 CTGAGGCCAGCACCTGGGCCGGG - Intronic
1161008337 19:1947690-1947712 CTGGAGCCTGCAGGTGGGCTGGG + Intronic
1161719169 19:5893865-5893887 CTGGGCCCTGCTGGTGGGCCGGG - Intronic
1165793979 19:38507854-38507876 CTGGTGTCTGCAGGTGGGGCGGG - Intronic
1165850805 19:38849506-38849528 CAGGCGCCTGCGCGTGCGCGGGG - Intronic
1165863191 19:38919884-38919906 CAGGCGGGTGCACATGGGCCAGG + Intronic
1166077696 19:40423254-40423276 CTGGGGGCTGCAGGTGGGCTAGG + Exonic
1166178412 19:41090388-41090410 TTGGCGCCTGCAGGTGTGGCGGG - Exonic
1166936545 19:46336842-46336864 CAGGCGCCTGCCAGTGTGCCTGG - Intronic
1167587226 19:50382081-50382103 CCGGCTCCTGCACGTTGGGCCGG - Exonic
1168292264 19:55362433-55362455 CTGGCGCCTGAAGCTGCGCCTGG - Exonic
1168686649 19:58353099-58353121 CTGGAGTCTCCAGGTGGGCCTGG + Exonic
926697555 2:15781358-15781380 CTGGCTCCTGGCCGTGGCCCTGG - Intergenic
927628706 2:24751438-24751460 CAGGCGCCTGCCACTGGGCCTGG - Intronic
929974315 2:46617038-46617060 CCTGCGCCTGCGCGTGGGCCTGG - Exonic
931304337 2:61013893-61013915 CTGGCGCCTGCACTCCAGCCTGG + Intronic
934058815 2:88275105-88275127 CTGTGGCCTGCATGTGGCCCAGG - Intergenic
935812645 2:106814660-106814682 CTGGTGCCTGCTGGTGTGCCTGG + Intronic
938482482 2:131673301-131673323 CTGGCGCCTGCGCATGGCACAGG - Intergenic
944778537 2:202994310-202994332 CAGGCGCCTGCCCCTGCGCCTGG + Intronic
945084350 2:206116440-206116462 CTGCAGCCTGCACGTGGTCCTGG - Intronic
947742334 2:232490397-232490419 CTGCGGCCTGCACGTGGGTGGGG + Intergenic
948591792 2:239055101-239055123 CTGGCACCTGCACGTGAACTTGG + Intronic
948981492 2:241497035-241497057 CTGGGGCCTCCACATGGGCTGGG + Intronic
1171252800 20:23662382-23662404 CTGCCGCCTGCACATGGGCTGGG + Intergenic
1171257101 20:23697767-23697789 CTGGAGCCTGCAGATGGGCTGGG + Intergenic
1171259279 20:23717699-23717721 CTGCTGCCTGCACATGGGCTGGG + Intergenic
1171264460 20:23759622-23759644 CTGGAGCCTGCAAATGGGCTGGG + Intergenic
1171274258 20:23842272-23842294 CTGGAGCCTGCAGATGGGCTGGG + Intergenic
1171411034 20:24949239-24949261 CTGGCACCTGCCCCTGGGCTGGG + Exonic
1171781980 20:29427783-29427805 CCGGGGCCTGCAGGTGGTCCTGG - Intergenic
1171981408 20:31631872-31631894 TTGGCTCCTGCACATGGGCATGG - Intergenic
1172883445 20:38216412-38216434 CTGTGGCCTGCACGTGGGGCTGG + Intronic
1173595624 20:44257140-44257162 CTGGCGCCTGCAGGTGCGGCTGG + Exonic
1173643374 20:44618630-44618652 CTGGCGCCGGGACTTGGGCGGGG + Exonic
1174194798 20:48765640-48765662 CTGGGGCCTGCACTTAGGTCTGG - Intronic
1175337561 20:58206109-58206131 CTGGCACCAGCAGGTCGGCCGGG - Intergenic
1175722223 20:61294246-61294268 CTGGGGTCTGCACCGGGGCCAGG + Intronic
1176063733 20:63183490-63183512 CAGGCACCTGCAGGAGGGCCTGG - Intergenic
1176218681 20:63959850-63959872 GTGGCGGCTGCATGGGGGCCAGG + Exonic
1176550715 21:8219627-8219649 CCGGCGCCTGCACGTGTCCCGGG + Intergenic
1176550848 21:8220423-8220445 CCGGCGTCTGCACGTGTCCCGGG + Intergenic
1176550959 21:8221155-8221177 CTGGCGTCTGCACGTGTCCCGGG + Intergenic
1176569646 21:8402690-8402712 CCGGCGTCTGCACGTGTCCCGGG + Intergenic
1176569758 21:8403422-8403444 CTGGCGTCTGCACGTGTCCCGGG + Intergenic
1176569868 21:8404154-8404176 CTGGCGTCTGCACGTGTCCCGGG + Intergenic
1176577557 21:8446897-8446919 CCGGCGCCTGCACGTGTCCCGGG + Intergenic
1176577669 21:8447629-8447651 CTGGCGTCTGCACGTGTCCCGGG + Intergenic
1176577779 21:8448361-8448383 CTGGCGTCTGCACGTGTCCCGGG + Intergenic
1178493875 21:33071029-33071051 ATTGCGCCTGCACGGCGGCCAGG - Exonic
1179727570 21:43348850-43348872 GTGGCGCCTGCACGCATGCCTGG + Intergenic
1180950382 22:19718198-19718220 CCGGGTCCTGCACGCGGGCCGGG - Intronic
1180960754 22:19761308-19761330 CTGGCGGCAGCACGTGGGGAGGG - Intronic
1182124128 22:27804163-27804185 CTGGAGCCTGGGGGTGGGCCAGG + Intergenic
1183284128 22:36952026-36952048 CTGGGGCCTGGGCCTGGGCCTGG - Intergenic
1183457995 22:37933137-37933159 CTGGCACCTGCCCTGGGGCCTGG + Intronic
1183720698 22:39559903-39559925 CTGGCGCCCCCTGGTGGGCCTGG - Intergenic
1184369609 22:44074271-44074293 CTGTTGCCTGCACGACGGCCTGG + Intronic
1184523633 22:45009366-45009388 CTGGAGCCTGCCCGGGGGCGGGG - Intronic
1184601828 22:45548517-45548539 CTGGGGGCTGCACTGGGGCCCGG - Intronic
1185214564 22:49591022-49591044 GTGGTGCCTGGACGTGGACCTGG + Intronic
1185259671 22:49854251-49854273 ACGGCGCGGGCACGTGGGCCAGG - Intronic
1203255616 22_KI270733v1_random:135970-135992 CCGGCGCCTGCACGTGTCCCGGG + Intergenic
1203255751 22_KI270733v1_random:136747-136769 CCGGCGTCTGCACGTGTCCCGGG + Intergenic
1203255860 22_KI270733v1_random:137432-137454 CCGGCGTCTGCACGTGTCCCGGG + Intergenic
1203255966 22_KI270733v1_random:138122-138144 CCGGCGCCTGCACGTGTCCCGGG + Intergenic
949661378 3:6283312-6283334 CTGGAACCTGCACGTAGCCCAGG + Intergenic
950005306 3:9687624-9687646 CTGGCAGATGCATGTGGGCCGGG - Intronic
954427920 3:50453400-50453422 CTGGTGGGTGCACATGGGCCTGG - Intronic
957083514 3:75658614-75658636 CCGGGGCCTGCAGGTGGCCCTGG + Intergenic
962200911 3:133400359-133400381 CTGGAGCCGGCACGGTGGCCAGG - Exonic
966910525 3:184557135-184557157 CTGGGGCCTGGAGGGGGGCCAGG + Intronic
968288705 3:197522897-197522919 CTGGCAACTGCCCATGGGCCTGG + Intronic
968502672 4:958364-958386 GCTGCGCCTGCTCGTGGGCCTGG + Exonic
968586127 4:1416931-1416953 CTGGTGCCTGCAAGTGGCTCTGG + Intergenic
968629016 4:1640814-1640836 CTGCCGCCTGCACCTGCCCCGGG - Exonic
968727228 4:2253359-2253381 CAGGCAGGTGCACGTGGGCCTGG - Intronic
969055951 4:4402837-4402859 CTGGCTTCTCCAGGTGGGCCAGG - Intronic
972048334 4:34696389-34696411 CTGCAGCCTGCATGTGGCCCAGG + Intergenic
976257062 4:83110053-83110075 CTGGCGCCTGCCGCTGGGGCTGG - Intronic
976706676 4:88026750-88026772 CTGGGGCCTGGGCCTGGGCCTGG - Intronic
983353947 4:166631453-166631475 CTGCAGCCTGGACCTGGGCCTGG - Intergenic
985448027 4:190038302-190038324 CCGGGGCCTGCAGGTGGCCCTGG - Intergenic
985757899 5:1730147-1730169 CTGGCACCCGCGCGTGGGCTGGG + Intergenic
986184269 5:5422055-5422077 GTGGCGCCCACACCTGGGCCTGG + Intronic
988344265 5:30017914-30017936 CTGGAGCCTGAATGTGGGCTGGG - Intergenic
988527348 5:31998811-31998833 CTGTGGCCTGCATGTGGCCCAGG - Intronic
990211106 5:53482013-53482035 CTGGTGCCCGGACGTGGGCGCGG + Intronic
994094302 5:95835053-95835075 CTGCTGCCTGCACGGGAGCCTGG + Intergenic
994831923 5:104794627-104794649 CTGGCGCCACAACCTGGGCCTGG + Intergenic
996793238 5:127316028-127316050 CTGGGGCCTGCCTGTGGGCCTGG - Intronic
997657728 5:135567894-135567916 GTGGGGCCTGTATGTGGGCCGGG + Intergenic
998862650 5:146459174-146459196 CTTGTGCCTGGACCTGGGCCTGG - Exonic
1001822537 5:174721200-174721222 CTGGCGCCTGCCCGAAGCCCAGG + Intergenic
1002167779 5:177358853-177358875 CTGGGGCCTGGTGGTGGGCCAGG - Intronic
1002186838 5:177458590-177458612 CAGGCGCCTCCCCGGGGGCCAGG - Exonic
1002559605 5:180072230-180072252 CGCCCGCCTGCACGAGGGCCCGG + Intergenic
1006711761 6:36079571-36079593 CTGCGGGCTGCACGTGGCCCAGG - Intronic
1007413811 6:41680342-41680364 CTGGCGGCTGCAGCTGAGCCAGG + Intergenic
1013012753 6:106134847-106134869 CTGGGCCCTCCACGGGGGCCTGG - Intergenic
1014215704 6:118750873-118750895 TTGGCGAATGCACGTGGGCATGG + Intergenic
1016873383 6:148840534-148840556 CTGGTATCTGCAGGTGGGCCTGG - Intronic
1018997943 6:168724613-168724635 CTGGAGCCAGCCCGTGGCCCTGG - Intergenic
1019433462 7:1010342-1010364 CTGGCGCCTGCCCGCAGGACTGG - Intronic
1020131921 7:5563500-5563522 CTGGCCCCTGCACCTGGGAGAGG + Intronic
1022442927 7:30448544-30448566 CTGGCGGCCCCACGTTGGCCAGG - Intronic
1023134694 7:37039399-37039421 CAGGCTCCTGCTCGTGGGCAGGG + Intronic
1024000192 7:45184660-45184682 CTGGAGCCTGGACAAGGGCCTGG - Intronic
1029548739 7:101225046-101225068 CTGCAGCCTGCATGTGGCCCAGG + Intergenic
1030086052 7:105816649-105816671 CTGGGGCCTCCACTTGGGCCAGG - Intronic
1034338973 7:150340507-150340529 CCGGGGCCTGCAGGTGGCCCTGG - Exonic
1034494653 7:151412206-151412228 CTGGAGCCTCCAAGAGGGCCTGG + Intergenic
1037859211 8:22392799-22392821 CTGGCTCCAGCGCCTGGGCCTGG + Intronic
1038372425 8:27007463-27007485 CTGGAGACTGCAGATGGGCCAGG + Intergenic
1047755356 8:127913926-127913948 CTGGATTCTGCATGTGGGCCTGG - Intergenic
1049006210 8:139857225-139857247 CTGGCGGCGGCTCATGGGCCTGG + Intronic
1049509150 8:143018952-143018974 CTGGCTCCTCTACGTGGGCCGGG + Exonic
1049645359 8:143733585-143733607 CTTGCGCCCACACCTGGGCCGGG - Intronic
1056757056 9:89388543-89388565 CTGGGGCCTGCTCATGGGCTGGG - Intronic
1057036047 9:91812381-91812403 CAGGCTCCTGCGCGGGGGCCGGG + Intronic
1057076018 9:92138530-92138552 CTGACACATCCACGTGGGCCTGG + Intergenic
1059123237 9:111661405-111661427 GTGGCACCTGCAGCTGGGCCTGG - Exonic
1060550026 9:124480717-124480739 CTGCCGCCACCACGTGGGGCTGG + Intergenic
1061002146 9:127908490-127908512 GGGGCGCCTGCTCGTGTGCCAGG + Exonic
1061253585 9:129440725-129440747 CTGTCCCTTGCACGTGGGCCCGG + Intergenic
1061290810 9:129649405-129649427 CTGGGGCCTGGACTTTGGCCTGG + Intergenic
1061538873 9:131266599-131266621 CTGGACCCTCCACATGGGCCAGG + Intronic
1061810921 9:133162415-133162437 CTGGGGGCTGCACCTGAGCCTGG + Exonic
1061853731 9:133430070-133430092 CTGTCGCCTGCACCTTCGCCAGG + Exonic
1062100279 9:134724399-134724421 CTGGAGCTGGCATGTGGGCCGGG + Intronic
1062235488 9:135505883-135505905 CTGGCCCCTGCACCTGGCACAGG + Intergenic
1062252761 9:135606534-135606556 CTGGCTTCTGCCCATGGGCCAGG + Intergenic
1062375421 9:136259777-136259799 CTGAGGGCTGCACGTGGCCCAGG + Intergenic
1062443374 9:136583424-136583446 CTGGTGCCTGCACTGGGCCCGGG - Intergenic
1062688030 9:137826375-137826397 CTGGTGCCTGGAAGTGGACCGGG - Intronic
1203441768 Un_GL000219v1:16008-16030 CCGGGGCCTGCAGGTGGTCCTGG - Intergenic
1203472013 Un_GL000220v1:119105-119127 CCGGCGCCTGCACGTGTCCCGGG + Intergenic
1203472126 Un_GL000220v1:119821-119843 CTGGCGTCTGCACGTGTCCCGGG + Intergenic
1203512578 Un_KI270741v1:134917-134939 CCGGGGCCTGCAGGTGGTCCTGG - Intergenic
1189268860 X:39736392-39736414 TTGGCTCCTGAAGGTGGGCCCGG - Intergenic
1189322836 X:40096943-40096965 CTGGCGCCTCCCGGTGGGCCAGG - Intronic