ID: 1151664910

View in Genome Browser
Species Human (GRCh38)
Location 17:75540305-75540327
Sequence GGGGGCTGGTCTAGACCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151664910_1151664920 18 Left 1151664910 17:75540305-75540327 CCGCCAGGTCTAGACCAGCCCCC 0: 1
1: 0
2: 1
3: 20
4: 235
Right 1151664920 17:75540346-75540368 GCTTTTCCATGCCTTGACCTGGG 0: 1
1: 0
2: 0
3: 15
4: 197
1151664910_1151664914 -6 Left 1151664910 17:75540305-75540327 CCGCCAGGTCTAGACCAGCCCCC 0: 1
1: 0
2: 1
3: 20
4: 235
Right 1151664914 17:75540322-75540344 GCCCCCTCTTCAAGGAAGCGTGG 0: 1
1: 0
2: 0
3: 12
4: 101
1151664910_1151664923 25 Left 1151664910 17:75540305-75540327 CCGCCAGGTCTAGACCAGCCCCC 0: 1
1: 0
2: 1
3: 20
4: 235
Right 1151664923 17:75540353-75540375 CATGCCTTGACCTGGGCAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 184
1151664910_1151664919 17 Left 1151664910 17:75540305-75540327 CCGCCAGGTCTAGACCAGCCCCC 0: 1
1: 0
2: 1
3: 20
4: 235
Right 1151664919 17:75540345-75540367 TGCTTTTCCATGCCTTGACCTGG 0: 1
1: 0
2: 1
3: 15
4: 150
1151664910_1151664922 24 Left 1151664910 17:75540305-75540327 CCGCCAGGTCTAGACCAGCCCCC 0: 1
1: 0
2: 1
3: 20
4: 235
Right 1151664922 17:75540352-75540374 CCATGCCTTGACCTGGGCAGTGG 0: 1
1: 0
2: 1
3: 32
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151664910 Original CRISPR GGGGGCTGGTCTAGACCTGG CGG (reversed) Intronic
900290309 1:1920935-1920957 GGGGCCTGGCCTGGACCTGGCGG + Intergenic
900556886 1:3285090-3285112 GGGGGCTGGCCCAGAACTTGGGG - Intronic
901415689 1:9114483-9114505 GGAGGCTGGTCTGGAGCTGGGGG + Intronic
902465988 1:16619132-16619154 GGGGGATGGGCTGGTCCTGGGGG + Intergenic
902508703 1:16954172-16954194 GGGGGATGGGCTGGTCCTGGGGG - Intronic
904038720 1:27572126-27572148 GGGGGGTGGTCCAGACGGGGTGG + Intronic
906510589 1:46408452-46408474 GAGAGCTGGTGTAGACCTGGAGG - Exonic
907529461 1:55079324-55079346 GCTGGCTGGGCTGGACCTGGAGG + Intronic
911576130 1:99580738-99580760 GGGGCCTGGTCTAGAACAGAAGG - Intergenic
912403456 1:109416375-109416397 GTGGGCTGGGCTATACCTGAGGG - Intronic
912886521 1:113480342-113480364 GGGGGCTGGCCTGGTACTGGGGG + Intronic
913248541 1:116891905-116891927 AGGGGCTGGTCTGCAGCTGGAGG + Intergenic
915073155 1:153288793-153288815 TGGGGCTGGGCCAGCCCTGGTGG - Intergenic
915209891 1:154300665-154300687 GGGGGCTGGTCTTGAACTCCTGG + Intergenic
915441266 1:155946933-155946955 GGGGGCTGGTCGACATTTGGGGG + Exonic
919812295 1:201416779-201416801 GAGAGCTGGTCCAGTCCTGGGGG - Intronic
922904118 1:229160727-229160749 GAAGGCTGGTCTAGGGCTGGAGG - Intergenic
923485294 1:234423875-234423897 GGGGTCAGGGCTAGACATGGTGG - Intronic
1069487022 10:68830015-68830037 GGTGGGGGGTCTAGACCTGGGGG + Intronic
1069781856 10:70961867-70961889 TGGGGCTGGTCTTGACCTAGAGG + Intergenic
1069784930 10:70981726-70981748 GGGGGCAGAACTAGGCCTGGGGG - Intergenic
1069891139 10:71653129-71653151 GGAGGCTGGGCTGGACCAGGAGG - Intronic
1070097065 10:73347736-73347758 GGGGTCTGGGCTAGAACTGCTGG + Intronic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1073097273 10:100987486-100987508 GGGGGCGGGACTAAACCTCGAGG + Exonic
1075627482 10:123973092-123973114 GGTGGCTGCTCTGCACCTGGTGG + Intergenic
1075682637 10:124343519-124343541 GGGAGCTGTGCAAGACCTGGTGG - Intergenic
1076698401 10:132257821-132257843 GGGGGCTCCTCTACACCTGCAGG + Intronic
1076793969 10:132789934-132789956 GGGGGCTGCACCAGACCGGGTGG - Intergenic
1076858861 10:133130219-133130241 GGGGGCTGCTCTGGACTTTGGGG + Exonic
1077024192 11:432102-432124 GAGGGCAGGTTGAGACCTGGAGG - Intronic
1077463123 11:2720866-2720888 GGGGCCTGGCCTGGACCTCGAGG + Intronic
1077638591 11:3860985-3861007 GTGGGCTGGGCTAGACTAGGTGG + Intronic
1080280446 11:30550743-30550765 GGGGCCTGAACTGGACCTGGCGG - Intronic
1081793102 11:45802988-45803010 GTGGGCTGTTCTCCACCTGGAGG - Intergenic
1083397721 11:62402731-62402753 GGGGGCTGGGATAGACCTCATGG - Intergenic
1085051864 11:73384088-73384110 GGGGGCTGGTGCCCACCTGGAGG - Intronic
1088914867 11:114219895-114219917 GTGGCCTGGTTTAGACATGGGGG - Intronic
1091100979 11:132873394-132873416 GGGGGCATGCCTACACCTGGGGG - Intronic
1091848082 12:3672954-3672976 GTGGGCTGATCTGGCCCTGGGGG + Intronic
1092569768 12:9709296-9709318 GGAGGTTGGGATAGACCTGGAGG - Intergenic
1094501717 12:31027296-31027318 GGGGGCTGGTTTTCAGCTGGCGG - Intergenic
1096229177 12:49888010-49888032 GCTGGCTGCTCCAGACCTGGAGG - Intronic
1096231142 12:49897568-49897590 GCAGGATGGTGTAGACCTGGGGG + Exonic
1096843074 12:54390889-54390911 GGGGGCTGGTCCTGGCCTGGTGG - Intronic
1097444817 12:59657629-59657651 TGGGTCTGCTTTAGACCTGGTGG + Intronic
1099428595 12:82553636-82553658 GGGGGCTGATCTGGACCCTGGGG + Intergenic
1102001067 12:109558460-109558482 GGGGGCAGGTAGAGAGCTGGGGG - Intronic
1102571670 12:113830584-113830606 GGGGGGTGGGCTATGCCTGGGGG + Intronic
1103708794 12:122895822-122895844 GGGGACTGGGCTAGAAATGGGGG - Intronic
1105256092 13:18744829-18744851 GGAGGCTGGTCTAGGGATGGAGG - Intergenic
1108576936 13:51798997-51799019 GGAGGCTGCTCTAGCCCTGGAGG + Intronic
1109936528 13:69292969-69292991 GGGGGCTGGCTCAGCCCTGGGGG + Intergenic
1112547318 13:100383415-100383437 CAGGGCTGGTCTAGACCTCCTGG - Intronic
1114754620 14:25245507-25245529 GGAGGCTGGCCTAGCACTGGGGG - Intergenic
1118778853 14:68992712-68992734 GGGGCCTGGTCCTGACCTGCAGG - Intergenic
1119580933 14:75780271-75780293 TGGGGCTGTTCCATACCTGGTGG + Intronic
1122720717 14:103720740-103720762 GGGAGCGGGTCTCGACCTGCAGG + Intronic
1202835918 14_GL000009v2_random:77199-77221 GGAGGCTGGTCTAGGGATGGAGG + Intergenic
1124624896 15:31302226-31302248 GGGGGCTGGTCTGGACTCAGGGG - Intergenic
1125322202 15:38500553-38500575 GTGGGCTGGTCTCGAACTCGGGG + Intronic
1129845661 15:78766643-78766665 GGAGCCCGATCTAGACCTGGCGG - Exonic
1130256197 15:82327218-82327240 GGAGCCCGATCTAGACCTGGCGG + Intergenic
1130598756 15:85262769-85262791 GGAGCCCGATCTAGACCTGGCGG - Intergenic
1131467547 15:92667814-92667836 GGGGGCTGGTCTCAAACAGGAGG - Intronic
1202952591 15_KI270727v1_random:52541-52563 GGGGGCGGGTCTCCGCCTGGTGG + Intergenic
1132749715 16:1451952-1451974 GGGGCCGTGTCTAGCCCTGGGGG + Intronic
1132901245 16:2255662-2255684 GGGGGGTGGCCTAGGCCAGGGGG + Exonic
1134103730 16:11470784-11470806 GGATGCTGGTCTAGACAGGGAGG + Intronic
1135404909 16:22190832-22190854 GGGGGCGGGGCTAGGTCTGGAGG - Exonic
1135425916 16:22335814-22335836 GGGGGCTGGCCTAGAACCTGGGG - Intergenic
1135616549 16:23915473-23915495 CAGGGCTGGTCTAGACCTCTTGG - Intronic
1136080921 16:27852224-27852246 AGGGGCTGGTGGGGACCTGGAGG + Intronic
1137374627 16:47942024-47942046 GGGGGTTGGCCTGGAGCTGGTGG - Intergenic
1137846889 16:51698593-51698615 GGTGGCCCTTCTAGACCTGGAGG - Intergenic
1138917524 16:61485071-61485093 GGGGCCTACTCTAGACCAGGTGG + Intergenic
1140247883 16:73267704-73267726 GGTGACTGGGCTAGACCTTGAGG + Intergenic
1141759418 16:86018022-86018044 GGGGGCAGGTCTGCACTTGGGGG - Intergenic
1141824305 16:86468313-86468335 GGAGGGTGTCCTAGACCTGGTGG - Intergenic
1141848650 16:86628965-86628987 GGAGGCTGGTTTGCACCTGGGGG + Intergenic
1141933049 16:87217965-87217987 GGGGTCAGGTCCACACCTGGGGG - Intronic
1142140058 16:88468826-88468848 AGGGGCTGCCCTTGACCTGGGGG + Intronic
1143568973 17:7742555-7742577 GGAGGCTGGTTTGGGCCTGGTGG + Intronic
1145289869 17:21534585-21534607 GGGGGCTGTTCTGGAATTGGTGG - Exonic
1145294484 17:21576616-21576638 GGAGCCTGGTCTTTACCTGGGGG + Intergenic
1145728523 17:27155377-27155399 GGGGGCTGGCTGAGACCTGTCGG - Intergenic
1146587209 17:34092503-34092525 GGGAGCTGGTCTGGCCCTGTAGG + Intronic
1146824411 17:36010430-36010452 GGGGGATGGGGTGGACCTGGCGG - Intergenic
1147967067 17:44199384-44199406 GGGCGCTGACCCAGACCTGGGGG + Intronic
1149984948 17:61340264-61340286 GGGGGCTGGTGCATACATGGAGG + Intronic
1151514156 17:74581391-74581413 GGGCTCTGGCCTTGACCTGGGGG + Intronic
1151664910 17:75540305-75540327 GGGGGCTGGTCTAGACCTGGCGG - Intronic
1151784872 17:76270520-76270542 GGGCGCTGGGCTGGAGCTGGGGG + Exonic
1151791263 17:76307391-76307413 GGGGACTCGGCTAGGCCTGGAGG + Intronic
1154434941 18:14335849-14335871 GGAGGCTGGTCTAGGGATGGAGG + Intergenic
1155533508 18:26791821-26791843 GAGGGCTGGACTGGGCCTGGTGG + Intergenic
1157083818 18:44556367-44556389 GGGGGCTGGTTCAGGCCTGCGGG + Intergenic
1157545945 18:48546607-48546629 TGAGGCTCGTCTAGGCCTGGGGG + Intronic
1157767100 18:50307592-50307614 GGTGGGTGGGCTAGGCCTGGGGG + Intergenic
1158781983 18:60663103-60663125 GGGGGCCGTTCATGACCTGGGGG - Intergenic
1159782342 18:72674869-72674891 GGAGGCTGGGGCAGACCTGGGGG - Intergenic
1160383540 18:78479206-78479228 GGGGGCGGGTGTGGACATGGAGG - Intergenic
1160800094 19:963708-963730 GGGGGTTGGGCTAGCCCAGGAGG - Intronic
1160820478 19:1055408-1055430 TGGGGCTGGTGTGGTCCTGGAGG + Intronic
1160944442 19:1634656-1634678 GGGGACTGGTCTTTGCCTGGTGG + Intronic
1161593015 19:5137227-5137249 GGGGGCTGGCTGAGATCTGGGGG - Intronic
1162561578 19:11420766-11420788 GGGGCCTGCGCTAGACCCGGAGG + Exonic
1163054822 19:14710332-14710354 TGGTGCTGGTCTAGACTTGGGGG + Intronic
1163253984 19:16143817-16143839 GGGGGCTGGGCTAGGCCAGAAGG + Intronic
1163650813 19:18516645-18516667 GGGGGCTGGTCCCTGCCTGGAGG - Intronic
1165307667 19:35012216-35012238 GGGAGCTGGTCTACAGCCGGGGG - Intronic
1165442246 19:35835746-35835768 GAAGGCTGGTGGAGACCTGGGGG + Exonic
1165954656 19:39494734-39494756 GAGGACTGGTTTAGACCTGATGG + Intergenic
1166067748 19:40370046-40370068 TGGGGCTGGTCTGGGCCTGGGGG + Intronic
1166256215 19:41606662-41606684 AGGGGCTGGTACAGGCCTGGAGG - Intronic
1166306839 19:41940216-41940238 GGGGGCAGGGCGAGGCCTGGCGG + Intergenic
1166335383 19:42103169-42103191 AGGGGCTGGTATAGACTGGGTGG - Intronic
1166669949 19:44703858-44703880 GGAGGCAGGTCTAATCCTGGAGG - Intronic
1167323286 19:48809503-48809525 GGGGGCAGTTCTAGACGTGATGG - Intronic
1167575847 19:50317074-50317096 AGGGGCCCCTCTAGACCTGGGGG + Intronic
1168124555 19:54276286-54276308 GGCAGCTGGGCTGGACCTGGGGG + Exonic
1168177431 19:54635252-54635274 GGCAGCTGGGCTGGACCTGGGGG - Exonic
1202636719 1_KI270706v1_random:50163-50185 GGAGGCTGGTCTAGGGATGGAGG - Intergenic
926318137 2:11726523-11726545 GGGATCTGATCCAGACCTGGAGG - Intronic
928197815 2:29227883-29227905 GGGAGCTGGCCTGGACCTGAGGG - Intronic
930206431 2:48591646-48591668 TGGGGATGATCTAGACCTCGAGG - Exonic
931263107 2:60637529-60637551 GGAGGCTGGACTAGTTCTGGAGG - Intergenic
931266032 2:60661119-60661141 GGGGGCAGATCTAGATTTGGGGG - Intergenic
932715556 2:74098984-74099006 GGGGCCTGGCCAGGACCTGGAGG - Intronic
933747245 2:85580237-85580259 TGGGGCTTGTCCAGACATGGTGG - Intronic
935831276 2:107003115-107003137 GGTGGCTGGTGTGGACCTGGCGG + Intergenic
936591768 2:113811144-113811166 GGGGGCTGGTCTAGGAATAGGGG + Intergenic
937351476 2:121166432-121166454 GGGGGCTGATTTGAACCTGGGGG - Intergenic
943321405 2:186448093-186448115 GTGGTCTGGTCTAGACATGGAGG - Intergenic
943754329 2:191542183-191542205 GGGGGCAGGACCTGACCTGGGGG + Intergenic
947704785 2:232265415-232265437 TGGGGCTGGACTAGAGCTGGGGG - Intronic
947776094 2:232710492-232710514 AGGTGCTGGACTAGCCCTGGTGG + Intronic
948092221 2:235303819-235303841 GAAGGCTGGTCTAGACCTGGGGG + Intergenic
1169276221 20:4235356-4235378 GGGGCCTGGTGGAGACCTAGAGG - Intronic
1170868786 20:20185393-20185415 GGAGGCTGGACTAGCACTGGAGG + Intronic
1171847349 20:30285062-30285084 AGGGACTGGTCTAGGGCTGGGGG - Intergenic
1171882846 20:30631094-30631116 GGAGGCTGGTCTAGGGATGGAGG - Intergenic
1172876885 20:38169845-38169867 GGGGGATGCACTACACCTGGAGG - Intergenic
1173534431 20:43798588-43798610 CGGGGCTCGTCTAGGACTGGGGG + Intergenic
1175368612 20:58471796-58471818 GGGCGCTGGCCTGGCCCTGGAGG + Intronic
1175543008 20:59759951-59759973 GGGTGATGGTCTACACCTGCAGG + Intronic
1175795780 20:61769887-61769909 GGGAGCTGGTCTCTACCTTGGGG - Intronic
1176654391 21:9576653-9576675 GGGGCCTGATATACACCTGGAGG - Intergenic
1176842094 21:13849853-13849875 GGAGGCTGGTCTAGGGATGGAGG - Intergenic
1177240653 21:18452452-18452474 GTAGGCTGGTCTAGAGCTGTTGG - Intronic
1178884571 21:36475188-36475210 AAGGGCTGGACTGGACCTGGTGG + Intronic
1180364150 22:11924150-11924172 GGAGGCTGGTCTAGGGATGGAGG + Intergenic
1180741341 22:18055245-18055267 GGAGGGTGGCCTAGATCTGGGGG - Intergenic
1180867110 22:19126039-19126061 TGGGGCTGGGAGAGACCTGGAGG + Intergenic
1180976490 22:19851551-19851573 GGCGGCTGGTAAAGACCTGGGGG + Exonic
1182509312 22:30807664-30807686 GGAGGCAGCTCTAGAGCTGGAGG - Intronic
1182664374 22:31946243-31946265 GGGGGACGGTCTAGGTCTGGAGG + Intronic
1182718511 22:32378640-32378662 TGGGGCTGGACTGGAGCTGGAGG + Intronic
1183395979 22:37571128-37571150 GGAGCCTGGGCTAGACCTGCAGG + Intronic
1184480393 22:44743343-44743365 GCGGGGTGCTCTAGATCTGGAGG + Intronic
950352096 3:12365247-12365269 TGGTACTGGTCTGGACCTGGAGG + Intronic
950559999 3:13715701-13715723 GGGGGCTGGTCTACCATTGGGGG + Intergenic
950765572 3:15270586-15270608 GGGGGCAGCTCTAGACGTGGTGG - Intronic
952419035 3:33114642-33114664 GGAGCCAGGTCTAGAACTGGAGG - Intronic
953797772 3:45998462-45998484 GGAGGCTGGGGTAGAGCTGGGGG + Intergenic
954313261 3:49786411-49786433 GGGGGCGGGCCGAAACCTGGAGG - Intronic
954427288 3:50450077-50450099 GAGGACTGGTTGAGACCTGGGGG - Intronic
954533958 3:51344090-51344112 AGTGGCTGGTCTAGCCCTGATGG - Intronic
959359048 3:105367178-105367200 GTGGGCTGGTGTTGACCGGGAGG + Exonic
964759617 3:160122326-160122348 GGGGGCTGTGCTAGAGGTGGGGG + Intergenic
965528378 3:169745818-169745840 GGTGGCTGGTGTTGAGCTGGAGG + Intergenic
967084424 3:186080885-186080907 GGGGACTGGACTACACCCGGAGG + Intronic
968442987 4:633961-633983 AGGGGCTGCTCTAAATCTGGTGG + Intronic
968503932 4:963385-963407 GGGGGCTGGTCCAAGCCAGGTGG - Intronic
969015293 4:4099805-4099827 GGGGGCTGGTTCTGGCCTGGGGG + Intergenic
969067075 4:4494329-4494351 GGGAGCTGGACTAGACCTTAGGG - Intronic
969505152 4:7581718-7581740 GAGGGCTGGGCTAGAGCTGTGGG - Intronic
969607944 4:8211623-8211645 GGGGCCGAGTCTTGACCTGGAGG + Intronic
970001854 4:11372693-11372715 GGGGGTTGGCCTAGGCCAGGGGG - Intergenic
970310638 4:14778863-14778885 GGTGGAAGGTCTAGACCTTGGGG - Intergenic
972640800 4:40923436-40923458 GCCAGCTGGTCGAGACCTGGGGG - Intronic
973394082 4:49578901-49578923 GGAGGCTGGTCTAGGGATGGAGG + Intergenic
975989968 4:80248574-80248596 TGGGGCTGGTCTAGAACTCCTGG - Intergenic
976670142 4:87643219-87643241 GGGGGCTGGTCTTGAACTCCTGG - Intergenic
979829384 4:125281212-125281234 GGGGGCCGGGCCAGACATGGCGG - Intergenic
982109919 4:152044654-152044676 GGAGGCTCTTGTAGACCTGGGGG - Intergenic
982653897 4:158121924-158121946 GGGGGGTGGTCTGGAGCTAGGGG - Intergenic
984729414 4:183053574-183053596 GGGGGCTGGTCTGGAACTCCTGG + Intergenic
1202764034 4_GL000008v2_random:136035-136057 GGAGGCTGGTCTAGGGATGGAGG - Intergenic
985531930 5:438892-438914 GAGGGCTGGCCTGGTCCTGGGGG - Intergenic
986300825 5:6477083-6477105 GGGCGCTGGTGTAGGCATGGGGG - Intronic
998092832 5:139381084-139381106 GGGGGCAGGTTTTGAGCTGGGGG - Intronic
998171133 5:139872572-139872594 TGGGGCTGTCCGAGACCTGGAGG - Intronic
1001241045 5:170070076-170070098 GGGGGCTGCTCTGGGCCTGGAGG - Intronic
1001582347 5:172807409-172807431 GGGGGCTGGGCTAAACGTGGGGG - Intergenic
1006116607 6:31779185-31779207 GGTGGCTGTTCTGGCCCTGGGGG - Exonic
1006638795 6:35478309-35478331 GGGGGCTGCTCCAGAACTGCAGG + Exonic
1007305118 6:40897728-40897750 GGTGCCTGGTCCAGACTTGGGGG - Intergenic
1007835029 6:44667678-44667700 GGTGGGCGGTCTAGTCCTGGTGG - Intergenic
1017712968 6:157186406-157186428 CGGGGCTGGACGAGACCAGGAGG - Intronic
1019215212 6:170438892-170438914 GGGGGGTGGTCTGGGGCTGGAGG + Intergenic
1019280805 7:199078-199100 GAGGGCTGGCCTAGGCCAGGAGG + Intronic
1019299497 7:296215-296237 AGGGGCTGGGCAGGACCTGGGGG - Intergenic
1019512972 7:1427321-1427343 CCGGGCTGGTCTTGACCTGCTGG - Intergenic
1023839154 7:44086166-44086188 AGGGGATGGTCTGGACCTGTGGG - Intergenic
1024824822 7:53379417-53379439 GGGGGCTGGTTTGGAAATGGGGG - Intergenic
1029339163 7:99929176-99929198 GGGGGCTCGGCTTGTCCTGGAGG - Exonic
1029406074 7:100374655-100374677 GGGGGCGGGGCTGGATCTGGAGG - Intronic
1029424191 7:100486325-100486347 GGAGGCTGCTCTGGTCCTGGAGG + Intronic
1030342832 7:108400357-108400379 GGAGGCAGGTCTAGAACTCGTGG - Intronic
1032067685 7:128783785-128783807 GCGGGCTGGGCCAGAGCTGGAGG + Intergenic
1032084097 7:128874567-128874589 GGGGGCAGCTCCAGCCCTGGGGG + Intronic
1033360586 7:140636376-140636398 GAGGGCTGGTAAAGACCTCGGGG + Intronic
1033968913 7:147013295-147013317 GAGGGGTGTACTAGACCTGGAGG + Intronic
1034829057 7:154293481-154293503 GGAGGCTTGTCTAGAACTTGGGG - Intronic
1035447800 7:158954916-158954938 TGGGGCTTGTCTAGGCCTGTGGG - Intronic
1035553092 8:544897-544919 GGGGGCGGGCCTAGTTCTGGGGG - Intronic
1036688733 8:10928109-10928131 GGGGGTTGGACTAGACCTCCAGG - Intronic
1037807570 8:22067006-22067028 GGGGGCGGCCCTAGGCCTGGGGG - Intronic
1044900054 8:96934652-96934674 GGGGGCTTGTTTAGCCCAGGTGG - Intronic
1045383458 8:101648864-101648886 GGGGCCTGGCCGTGACCTGGAGG - Intronic
1045474583 8:102542356-102542378 GGTGGCTGGTCTGGACCTCTTGG + Intergenic
1045499593 8:102734896-102734918 GGGGGCTGGTCTAGGCCCAAGGG + Intergenic
1049466991 8:142756042-142756064 TGGGGCTGGACTCCACCTGGAGG + Intergenic
1049789247 8:144465535-144465557 GGGGGAGGGTCGAGGCCTGGGGG + Intronic
1049789254 8:144465555-144465577 GGGAGAGGGTCGAGACCTGGGGG + Intronic
1052816214 9:33104283-33104305 GGGGGCTGGATTATCCCTGGGGG - Intronic
1052880668 9:33599411-33599433 GGAGGCTGGTCTAGGGATGGAGG + Intergenic
1053495305 9:38544799-38544821 GGAGGCTGGTCTAGGGATGGAGG - Intronic
1053544512 9:39009327-39009349 AAGGGCTGGTCTAGATCTTGGGG - Intergenic
1053666883 9:40323223-40323245 GGAGGCTGGTCTAGGGATGGAGG + Intronic
1053808944 9:41832809-41832831 AAGGGCTGGTCTAGATCTTGGGG - Intergenic
1053916475 9:42948330-42948352 GGAGGCTGGTCTAGGGATGGAGG + Intergenic
1054378035 9:64463251-64463273 GGAGGCTGGTCTAGGGATGGAGG + Intergenic
1054517726 9:66053060-66053082 GGAGGCTGGTCTAGGGATGGAGG - Intergenic
1054621648 9:67354619-67354641 AAGGGCTGGTCTAGATCTTGGGG + Intergenic
1054763086 9:69020800-69020822 GTGGCCTGGTCTTGACTTGGTGG - Intergenic
1055574919 9:77651217-77651239 AGGGGCTGGTATGGACCTAGTGG - Intergenic
1055985924 9:82056512-82056534 GGAGGCTGGTCTAGGGATGGAGG + Intergenic
1056585418 9:87924621-87924643 GGAGGCTGGTCTAGAGATGGAGG - Intergenic
1056611462 9:88128319-88128341 GGAGGCTGGTCTAGAGATGGAGG + Intergenic
1057675207 9:97132157-97132179 GGAGGCTGGTCTAGAGATGAAGG - Intergenic
1061327834 9:129874958-129874980 GGGCGCTGGGCCAGGCCTGGTGG + Intronic
1062107987 9:134766144-134766166 GGGGGCAGGCCTGGCCCTGGGGG - Intronic
1062294476 9:135816881-135816903 GGGGACTGGTCTGGACCTCACGG - Intronic
1062322093 9:135995086-135995108 GGGGGGTGGCCAGGACCTGGGGG - Intergenic
1062335134 9:136061618-136061640 GGGGGCTGGGGTAGACCTGCTGG - Intronic
1062437109 9:136551210-136551232 GGGGGCTGGACCAGACAGGGAGG + Intergenic
1203544783 Un_KI270743v1:120908-120930 GGAGGCTGGTCTAGGGATGGAGG - Intergenic
1186364653 X:8878692-8878714 CGGGGCTGGTCAAGGCCTTGGGG - Intergenic
1187143380 X:16615575-16615597 GAGTCCTGCTCTAGACCTGGGGG + Intronic
1192503276 X:71666716-71666738 GAGGGCTGGTTTCGACCTGGGGG - Intergenic
1192510494 X:71718100-71718122 TGGGGCCGGTTTCGACCTGGAGG - Exonic
1192516203 X:71763453-71763475 TGGGGCCGGTTTCGACCTGGAGG + Exonic
1198683024 X:139202904-139202926 GTGGGCTGGACTAGCCCTGAGGG - Intronic
1200934895 Y:8729816-8729838 GGGGGCTGCTCTTTCCCTGGTGG - Intergenic
1200937945 Y:8754732-8754754 GGAGGCTGGCCAAGACCTGCTGG - Intergenic