ID: 1151668012

View in Genome Browser
Species Human (GRCh38)
Location 17:75556622-75556644
Sequence TCATTCAGTGAGTGGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151668006_1151668012 3 Left 1151668006 17:75556596-75556618 CCTGACGCCCATGTCTCAGCCAG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1151668012 17:75556622-75556644 TCATTCAGTGAGTGGCTGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 172
1151668008_1151668012 -5 Left 1151668008 17:75556604-75556626 CCATGTCTCAGCCAGTGATCATT 0: 1
1: 1
2: 0
3: 15
4: 191
Right 1151668012 17:75556622-75556644 TCATTCAGTGAGTGGCTGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 172
1151668007_1151668012 -4 Left 1151668007 17:75556603-75556625 CCCATGTCTCAGCCAGTGATCAT 0: 1
1: 0
2: 1
3: 5
4: 144
Right 1151668012 17:75556622-75556644 TCATTCAGTGAGTGGCTGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 172
1151668005_1151668012 16 Left 1151668005 17:75556583-75556605 CCAGAGGGAAGGACCTGACGCCC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1151668012 17:75556622-75556644 TCATTCAGTGAGTGGCTGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151668012 Original CRISPR TCATTCAGTGAGTGGCTGGC TGG Intronic
900426729 1:2583828-2583850 TCATTCATGGCGTGGCAGGCAGG - Intergenic
900954402 1:5877718-5877740 GCCTTCAGTGAGTGGGGGGCAGG + Intronic
902441704 1:16434401-16434423 TCAGCCTCTGAGTGGCTGGCTGG + Intronic
903005543 1:20295734-20295756 CCATTGAGGGAGTGGCTGGAGGG + Intronic
903191354 1:21658021-21658043 TCATTCAGTGGGTGGGGGACAGG + Intronic
903746368 1:25589543-25589565 TCATTCTGTGAGAGACTGGATGG - Intergenic
903970633 1:27116665-27116687 ACATCCAGTGTGTAGCTGGCTGG + Intronic
905293151 1:36936967-36936989 TCATTCACTCTGTGGGTGGCGGG - Intronic
905795333 1:40812949-40812971 TCTTTCAGAGAGGGGATGGCTGG + Intronic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906318515 1:44803043-44803065 GCAGGCAGTGAGAGGCTGGCAGG - Exonic
909991478 1:82227811-82227833 TCATTTAGTGAATAGCTGCCTGG + Intergenic
911086274 1:93980032-93980054 TTATCCAGTGAGTAGCTGGTTGG + Intergenic
911265924 1:95743050-95743072 TCATTTAGTCACTGGCTGCCTGG - Intergenic
912797832 1:112703583-112703605 TCATTCAGTGACTGGGGGGCGGG + Intronic
915562713 1:156696738-156696760 TTGGTCACTGAGTGGCTGGCGGG - Intergenic
916726074 1:167525507-167525529 TCAGTGAGTGAGTGGCTAGATGG + Intergenic
917709177 1:177667169-177667191 TCATTGACCGAATGGCTGGCAGG - Intergenic
921825597 1:219668605-219668627 TTGTTGAGTGATTGGCTGGCTGG - Intergenic
922802050 1:228368888-228368910 ACATTTGGTGAGTGGGTGGCTGG + Exonic
923097766 1:230789034-230789056 TCTTTCAGTGGGGGCCTGGCTGG + Intronic
923317568 1:232796200-232796222 TCATTCAGTTGGTTGCTGGAGGG - Intergenic
923434004 1:233951362-233951384 TGAGTCAGTGAGTGGGTGGTGGG - Intronic
924197757 1:241625900-241625922 TCATTCAGTGGGTAGAGGGCTGG - Intronic
1064217630 10:13413769-13413791 TAAATCAGTGGCTGGCTGGCTGG - Intergenic
1068823899 10:61411190-61411212 TCCAGCAGTGAGTTGCTGGCGGG + Intronic
1069141286 10:64828988-64829010 AAATTCAGTGAGTGCCTGGAAGG + Intergenic
1070532384 10:77348440-77348462 TCATTCAGCATGTGGCTTGCGGG - Intronic
1070825307 10:79387220-79387242 TCACCCAGTGAGTGTGTGGCAGG - Intronic
1070830168 10:79413294-79413316 TCACACAGTGAGTGAGTGGCGGG + Intronic
1071370227 10:84943763-84943785 TCATACAGTAAGTGGCTGGTTGG + Intergenic
1072300234 10:94053793-94053815 TCATTCAGCGACTGGAAGGCTGG - Intronic
1074979904 10:118611190-118611212 TCATTGAGCCTGTGGCTGGCAGG + Intergenic
1076088100 10:127653553-127653575 TGATTCAGTTAGAGGTTGGCTGG - Intergenic
1076623865 10:131809814-131809836 TCTTTTAGTGAGTGCCTGGAAGG - Intergenic
1077204436 11:1335761-1335783 ACAAACAGTGAGTGGATGGCTGG + Intergenic
1080262215 11:30361727-30361749 ACATTGGGTGAGTGGTTGGCTGG - Intergenic
1080516289 11:33024091-33024113 TCACTCACTTGGTGGCTGGCTGG - Intronic
1080878716 11:36299712-36299734 TTATTCAGCGAGTGGCGGGGAGG + Intronic
1082000263 11:47390273-47390295 TCATTCACTATGTGGCTGACGGG + Intergenic
1082807980 11:57462004-57462026 TCTCTCAGGGAGTGGCTGGTGGG + Intronic
1083185545 11:61015829-61015851 TTCTACAGTGAGTGCCTGGCCGG + Exonic
1084296677 11:68216637-68216659 TCACTCAGTGACAGGATGGCAGG + Intergenic
1086338194 11:85820960-85820982 TCATTTATTGAGTGCCAGGCAGG + Intergenic
1089949658 11:122513538-122513560 TCCTTCATAGAGTGGCTGGGTGG + Intergenic
1090093248 11:123718154-123718176 TCATTCTGTGAATGACTGGGAGG + Intergenic
1090153599 11:124412321-124412343 TGAGTCAGTGAGTGAGTGGCAGG + Intergenic
1091635021 12:2190495-2190517 TAAATAAGTGAATGGCTGGCAGG - Intronic
1091748566 12:3008696-3008718 TCATTCAGTGAGTAGGTGCCAGG + Intronic
1093816069 12:23548996-23549018 TCTTTCAGAGAGGGGATGGCTGG - Intronic
1095666716 12:44810676-44810698 TCATCCAGTCAGTGGTTTGCTGG - Intronic
1096740491 12:53690332-53690354 TCACTCAGTGAGTGAATGGCAGG - Intergenic
1102723513 12:115037946-115037968 TCAGTTCGTGAGTGGATGGCAGG - Intergenic
1103016063 12:117495495-117495517 CCATTAAGTAAGGGGCTGGCTGG + Intronic
1103830053 12:123771837-123771859 AGATTCAGTGATTGGCTGGAAGG + Intronic
1104485842 12:129150711-129150733 TCAGTCACAGAGAGGCTGGCAGG + Intronic
1104941970 12:132399474-132399496 TCATCCAATGAGTGGCAGGCTGG + Intergenic
1106305170 13:28503392-28503414 TCAGTCAGTGAAAGGCAGGCAGG + Intergenic
1110646123 13:77886650-77886672 TGAATCACTGAGTGGCTGGTAGG + Intergenic
1113364853 13:109666508-109666530 TAATTCTGTGTGTGGCTGGATGG - Intergenic
1119157428 14:72423940-72423962 TCATTCATTCAGTGCCTGGCTGG + Intronic
1119781936 14:77281744-77281766 GCATTCAGTGAGTGGAGGCCAGG - Intronic
1120284542 14:82482044-82482066 TCATTGAGTTAGTGGCGGGAGGG + Intergenic
1121457633 14:94048816-94048838 TAACTCAGTGAGTGGCTTCCAGG + Exonic
1127329402 15:57923843-57923865 CCAGTCAGTGAGTGGCTGCTTGG + Intergenic
1127719432 15:61685264-61685286 TCTTTAAGTGAGAGGCTGTCAGG + Intergenic
1127727897 15:61768298-61768320 TCAATCATTGAGAGGCTGCCTGG - Intergenic
1128667589 15:69549814-69549836 GGATGCAGTGAGGGGCTGGCTGG - Intergenic
1128738370 15:70066321-70066343 TCCTTCACTGGGTGGGTGGCAGG + Intronic
1128797213 15:70474694-70474716 TCATTCAGGGACTTGTTGGCTGG + Intergenic
1129852051 15:78798952-78798974 TCATTCAGTGAGTGGTGGGCGGG - Intronic
1130239413 15:82172404-82172426 TGATTTAGTGAGTGACTGGTGGG + Intronic
1130250951 15:82300135-82300157 TCATTCAGTGAGTGGTGGGCGGG + Intergenic
1132005433 15:98222295-98222317 TCCTTCAATGGGAGGCTGGCAGG + Intergenic
1133231475 16:4369082-4369104 TGAGTCAGTGGCTGGCTGGCTGG - Intronic
1141728426 16:85806207-85806229 TCATTCATTGAATGACTGTCTGG + Intronic
1141925024 16:87162458-87162480 TAATGCAGTCAGTGCCTGGCAGG + Intronic
1141947965 16:87323295-87323317 TCAGCCAGTGAGGGGCTGCCTGG + Intronic
1143300868 17:5909852-5909874 ACTTTCTGGGAGTGGCTGGCTGG - Intronic
1143934938 17:10473838-10473860 TCATTGACTGAGTGGAAGGCAGG + Intergenic
1144207890 17:12992104-12992126 TCAATCAGTGAGAGCCTGGCTGG - Intergenic
1144320588 17:14115068-14115090 CCATTCACTGAGTGCCTGTCAGG - Intronic
1144945814 17:18968984-18969006 TCACCCAGGGAGTGGCTTGCTGG + Exonic
1146945255 17:36869231-36869253 TCAGTCATTAAGTGGATGGCGGG + Intergenic
1146945256 17:36869235-36869257 TCATTAAGTGGATGGCGGGCTGG + Intergenic
1147976531 17:44251143-44251165 TCAGTGTGTGAGTGGCTGCCTGG - Exonic
1149982803 17:61324635-61324657 TCAAACAGCTAGTGGCTGGCAGG - Intronic
1150154526 17:62841003-62841025 TCTGTCACTGTGTGGCTGGCTGG + Intergenic
1151668012 17:75556622-75556644 TCATTCAGTGAGTGGCTGGCTGG + Intronic
1153164002 18:2241390-2241412 TCATTAAATGAGTGGCTCACCGG + Intergenic
1153502174 18:5760757-5760779 TCATTCGGTGGGTTGCAGGCAGG + Intergenic
1158716595 18:59885783-59885805 TGATTCAGTGACTTTCTGGCAGG - Intergenic
1164834434 19:31348845-31348867 TCTTTCTGTGGGTGGCGGGCGGG - Intronic
1165335163 19:35164657-35164679 TCATTCACTGGGGGGCTGACTGG - Intronic
1165382166 19:35489235-35489257 TCGATCAGTGAGAGGCAGGCGGG - Intronic
1166158034 19:40930032-40930054 TCATTCTTTCAGTGGCAGGCAGG - Intergenic
1166166901 19:40997061-40997083 TCATTCTTTCAGTGGCAGGCAGG - Intronic
924993091 2:331449-331471 TCATTCAGTGGATAGTTGGCAGG + Intergenic
925202350 2:1978801-1978823 TCATTCTGGGAGTGGCAGGATGG - Intronic
926932579 2:18055183-18055205 TCATTCATGCAGTGGTTGGCAGG + Intronic
927872341 2:26631596-26631618 TGAAACAGTGAGTGGCTGGCAGG - Intronic
928298926 2:30108819-30108841 TCATTCTGTGACTGGCTGGAGGG + Intergenic
928849109 2:35720845-35720867 TCATTCTGTGAGTGCCAGCCTGG - Intergenic
933563385 2:83917804-83917826 TCATTCAGAGGGTGGCTCGGTGG - Intergenic
937370049 2:121291052-121291074 TCCTTCAGCCTGTGGCTGGCAGG - Intergenic
940307688 2:152244202-152244224 TCCTGCAGTGAGTTGCTGGCTGG - Intergenic
940734483 2:157434232-157434254 TTATTCAGTGTGTGGCTGTTTGG - Intronic
941007403 2:160262144-160262166 TCATACAGTGCGTGTTTGGCTGG - Intronic
941809656 2:169742870-169742892 TTATTCAGTCAGTGTGTGGCAGG + Intronic
945710159 2:213284777-213284799 AAATTCAGTGAGTGGCTCTCAGG - Intronic
1169682147 20:8227484-8227506 TAATTCAGGGATTGGTTGGCTGG - Intronic
1172763887 20:37340646-37340668 TCACACAGAGAGTTGCTGGCAGG - Intergenic
1173861006 20:46283584-46283606 TCATTCAGTGAGTCAGCGGCAGG + Intronic
1175772529 20:61632713-61632735 TGAATGAGTGAGTGGCTGGTTGG - Intronic
1176112159 20:63415706-63415728 TCACTGGGTGAGGGGCTGGCAGG - Intronic
1176170030 20:63692583-63692605 TCACACAGTGAGAGGCTGGCAGG - Intronic
1179722964 21:43325756-43325778 GCATGCAGTGAGTGGAAGGCTGG + Intergenic
1180600213 22:17010570-17010592 TCCTTCTGTGAGTGTCTGTCCGG + Intergenic
1182364963 22:29772426-29772448 TCATTCAGCAAGTGTTTGGCTGG + Intergenic
1182684780 22:32113612-32113634 TCTTTCACTGAGTGGCTCTCAGG + Intergenic
1182828266 22:33284129-33284151 TCCTTCTGTGCCTGGCTGGCAGG - Intronic
1183425960 22:37739537-37739559 TTATACAGTCAGTGGCTAGCTGG + Intronic
1184432733 22:44450830-44450852 TGATTCAGTGATTGGCTTGGCGG - Intergenic
950949096 3:16980163-16980185 TCCTGGACTGAGTGGCTGGCCGG + Intronic
952010992 3:28901245-28901267 TCTGCCAGTAAGTGGCTGGCTGG + Intergenic
954189938 3:48952294-48952316 TCATTCAGTGAATTGCTGTGGGG + Intronic
964201288 3:154121663-154121685 GCACTCAGTGAATGGGTGGCGGG + Intronic
966451204 3:180064100-180064122 TCATTCAGTGAGTGAGTGGTTGG - Intergenic
967959228 3:194907142-194907164 TCATTCATTGAGAGGAAGGCAGG + Intergenic
967975024 3:195029390-195029412 GCACTCAGCGAGGGGCTGGCAGG + Intergenic
973299787 4:48568309-48568331 TCAGTCAGTCAGTGGTTGCCAGG - Intronic
979915523 4:126428183-126428205 TCATTCACTGAGTGGCAGTGGGG - Intergenic
980305956 4:131061680-131061702 TCTTTCTGTGATTGGCTGCCAGG - Intergenic
982569188 4:157026946-157026968 GCATTCAGTGAGAGGCTGCAGGG - Intergenic
983308198 4:166021300-166021322 TCATTTAGTGAATGGTTGCCAGG + Intronic
985654207 5:1121616-1121638 ACAGCCAGTGAGTGGCAGGCAGG + Intergenic
985804750 5:2034570-2034592 ACATTCAGTGACTGGCTGCTGGG + Intergenic
986494797 5:8331616-8331638 ACAATAAGTGAGTGGCTGCCTGG - Intergenic
987027937 5:13946494-13946516 TCATTCTGGCAGGGGCTGGCGGG - Intergenic
996355409 5:122590896-122590918 TCATACAGTGAGTATGTGGCAGG + Intergenic
997419384 5:133753796-133753818 TCAGGTAGTGAGTGGCTGTCTGG + Intergenic
998504289 5:142659694-142659716 TCTTTCAGAGAGTTGCTGGCGGG + Intronic
1001441550 5:171747649-171747671 TCAGGCAGTGAGTAGCTGCCAGG - Intergenic
1003572908 6:7267712-7267734 GCATTCAGTGATTTGCAGGCTGG - Intergenic
1006799739 6:36752320-36752342 TCTTTCCGTGAGCTGCTGGCTGG + Intronic
1007646215 6:43383245-43383267 TCATTCAGTAAGTTTCTGGATGG + Intergenic
1007869270 6:45014337-45014359 TCATTCATTTAGTGGCAGGCAGG + Intronic
1009969841 6:70614785-70614807 ACCTTCAGTGAGAGGCTGGCAGG - Intergenic
1013957900 6:115861657-115861679 TCATTCACAGGGTGGCAGGCTGG - Intergenic
1015102487 6:129497702-129497724 TCATGCTGTAAGTTGCTGGCAGG - Intronic
1015863554 6:137705214-137705236 TCTTTCAGTGGCTGGCTGGCAGG - Intergenic
1017112965 6:150949817-150949839 TCATGCAGTGAGTCAGTGGCAGG - Intronic
1017810959 6:157982872-157982894 TCATTCAATGCGTGGCTTCCTGG + Intronic
1019269844 7:140703-140725 TCATTCAGTCAGTGGAGGGGGGG - Intergenic
1020070639 7:5224655-5224677 GCACTCAGTGAGTTCCTGGCTGG + Intronic
1020506793 7:9000732-9000754 TAATTCAGTGAGTGAATGACCGG + Intergenic
1020506795 7:9000758-9000780 TAATTCAGTGAGTGACTGACTGG + Intergenic
1021951051 7:25775458-25775480 TCAGTCAGTGAGTGAGTGGCGGG - Intergenic
1028964457 7:96786574-96786596 ACATTCTGGGACTGGCTGGCTGG + Intergenic
1029240909 7:99161645-99161667 TCTTTCAGTAAGTGGCAGACAGG - Intergenic
1029973009 7:104807804-104807826 ACGTTCAGTGAGTGGTTGGATGG - Intronic
1033927683 7:146483957-146483979 TGAGTCAGTGAGTGGGTGGTGGG - Intronic
1034213103 7:149382381-149382403 TAACTCAGAGAGTGGCTGGTAGG + Intergenic
1034508749 7:151518325-151518347 GCATCCAGTGAGCGGCAGGCAGG + Intronic
1038320913 8:26526715-26526737 TCCTTCAGTGAGTGACTACCAGG + Intronic
1038433279 8:27516579-27516601 TCATTCAGAGTGTGGGGGGCAGG - Intronic
1039018896 8:33183772-33183794 TCACTCAGTGAGTTAGTGGCTGG + Intergenic
1039894993 8:41710750-41710772 ACAGTAAGAGAGTGGCTGGCAGG - Intronic
1041618719 8:59939018-59939040 TGCTTCAGTGAGGGACTGGCAGG + Intergenic
1046598931 8:116295393-116295415 TCATTCAATGAGTGGCGATCTGG + Intergenic
1047583658 8:126244703-126244725 TGATTCAGTAAGTGGGAGGCAGG - Intergenic
1047865302 8:129017247-129017269 ACATTAAGTTAGTGGCTAGCTGG + Intergenic
1047906210 8:129475915-129475937 AGACTCTGTGAGTGGCTGGCTGG - Intergenic
1048375035 8:133815910-133815932 TGATTCAGTGCATGGGTGGCAGG + Intergenic
1049369670 8:142257775-142257797 TGAAGCAGTGAGTGTCTGGCAGG - Intronic
1053390081 9:37728597-37728619 TAATTCTGAGAGTGGCTGACAGG - Intronic
1055058548 9:72045928-72045950 TCATTCAGTGTGTGGGGGGAAGG + Intergenic
1056067624 9:82953538-82953560 TCATTCTGTGGGTGGGTGGGTGG - Intergenic
1057204397 9:93162768-93162790 CCTTTCAGTGAGCTGCTGGCAGG + Intergenic
1057273208 9:93662300-93662322 TGATTGAGTGAGTGGATGGGTGG + Intronic
1059365508 9:113783717-113783739 TGATTGAGTGAGTGGATGGATGG + Intergenic
1059604080 9:115813915-115813937 TTATTCATTGAGTGGCTGATAGG + Intergenic
1060086789 9:120710454-120710476 ACATTCACTGATTGGTTGGCTGG - Intronic
1061454152 9:130684949-130684971 TCATTCAGTGAGTGGCAGAGTGG + Intergenic
1062652352 9:137584471-137584493 ACATTCAGTCACAGGCTGGCCGG + Intronic
1186210108 X:7241872-7241894 TCATTCAGATAGTTGCAGGCAGG + Intronic
1188231299 X:27667231-27667253 TCATTCTGTGAGTGACTGGTTGG + Intronic
1192338165 X:70239140-70239162 TCAGGCAGTGAGTGAGTGGCAGG - Intronic
1195108132 X:101619811-101619833 TCATTCAGTGTTTGGCTGCTAGG + Intergenic
1195751996 X:108169150-108169172 CCATTTAGTGAGAGGTTGGCTGG - Intronic
1196065280 X:111457495-111457517 TCATTCAGAGAGAGGCTGATTGG - Intergenic
1197751664 X:129968262-129968284 TTGTTGAGTGAGTGTCTGGCAGG + Intergenic
1198061861 X:133053933-133053955 TCATTAAGTGAAAGGCTGGGAGG + Intronic
1198194993 X:134351295-134351317 TGATTCAGTGAGTGAGTGGTGGG - Intergenic
1199273809 X:145919087-145919109 TCATACATTGATTGGCTGGTGGG + Intergenic
1199753755 X:150845630-150845652 CCAGTCAGTGAGTGGCAGTCTGG - Intronic
1200335690 X:155349023-155349045 GCATTCAGTGAGTGGGCGGCAGG - Intergenic
1200350779 X:155492202-155492224 GCATTCAGTGAGTGGGCGGCAGG + Intronic